ID: 1151728516

View in Genome Browser
Species Human (GRCh38)
Location 17:75897773-75897795
Sequence CATTTCCCCTGAAGCTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151728511_1151728516 25 Left 1151728511 17:75897725-75897747 CCTGGGGTCCAAGCTGATCTGCA No data
Right 1151728516 17:75897773-75897795 CATTTCCCCTGAAGCTGAGCAGG No data
1151728512_1151728516 17 Left 1151728512 17:75897733-75897755 CCAAGCTGATCTGCAGCCTCAGT No data
Right 1151728516 17:75897773-75897795 CATTTCCCCTGAAGCTGAGCAGG No data
1151728510_1151728516 30 Left 1151728510 17:75897720-75897742 CCTTGCCTGGGGTCCAAGCTGAT No data
Right 1151728516 17:75897773-75897795 CATTTCCCCTGAAGCTGAGCAGG No data
1151728514_1151728516 1 Left 1151728514 17:75897749-75897771 CCTCAGTATTTACAGGCACTCCA No data
Right 1151728516 17:75897773-75897795 CATTTCCCCTGAAGCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151728516 Original CRISPR CATTTCCCCTGAAGCTGAGC AGG Intergenic
No off target data available for this crispr