ID: 1151729380

View in Genome Browser
Species Human (GRCh38)
Location 17:75901898-75901920
Sequence CACGGCATCCAGCGGGACAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151729372_1151729380 -5 Left 1151729372 17:75901880-75901902 CCTCTCCCACTCGGCCCGCACGG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1151729380 17:75901898-75901920 CACGGCATCCAGCGGGACACTGG 0: 1
1: 0
2: 0
3: 5
4: 67
1151729374_1151729380 -10 Left 1151729374 17:75901885-75901907 CCCACTCGGCCCGCACGGCATCC 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1151729380 17:75901898-75901920 CACGGCATCCAGCGGGACACTGG 0: 1
1: 0
2: 0
3: 5
4: 67
1151729367_1151729380 26 Left 1151729367 17:75901849-75901871 CCAGACGCTGCTTGTGGTAGGGG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 1151729380 17:75901898-75901920 CACGGCATCCAGCGGGACACTGG 0: 1
1: 0
2: 0
3: 5
4: 67
1151729371_1151729380 3 Left 1151729371 17:75901872-75901894 CCACAGGTCCTCTCCCACTCGGC 0: 1
1: 0
2: 1
3: 11
4: 225
Right 1151729380 17:75901898-75901920 CACGGCATCCAGCGGGACACTGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151729380 Original CRISPR CACGGCATCCAGCGGGACAC TGG Exonic
904256891 1:29259934-29259956 CACGGCAGCCAGCGGGAAAGTGG - Exonic
913211574 1:116587048-116587070 CACTGCATTCAGCAGGGCACAGG + Intronic
921355622 1:214281634-214281656 CAGGGCGTGCAGCGGGGCACCGG - Intronic
922788058 1:228293248-228293270 CACAGAATCCAACTGGACACAGG - Intronic
1062884696 10:1007318-1007340 CACGTCATGCAGTGGGAAACGGG - Intronic
1068119454 10:52771210-52771232 CAGGCCATCCCGTGGGACACAGG - Intronic
1071765117 10:88655344-88655366 CATGGCATGCAGCTGGAGACTGG - Intergenic
1072226614 10:93375915-93375937 CATGGCATCTGGTGGGACACAGG + Intronic
1076832196 10:133001294-133001316 CCCGGCACCCAGCAGGACGCAGG - Intergenic
1077174648 11:1183320-1183342 CACAGCAACCAGCGTCACACAGG + Intronic
1077174864 11:1184439-1184461 CACAGCAACCAGCGTCACACAGG + Intronic
1080939692 11:36901590-36901612 CACAGCATCCAGCTAGATACAGG + Intergenic
1083844289 11:65321871-65321893 CAGGGCATCCAACGGGGCAGAGG - Exonic
1084088641 11:66866197-66866219 CGCAGCTTCCAGCCGGACACCGG - Exonic
1089645563 11:119876399-119876421 CACCCCAGCCAGCAGGACACAGG - Intergenic
1096661339 12:53126490-53126512 CACTGCATCCAGCCTTACACAGG - Intergenic
1104509248 12:129361009-129361031 CACGGCATCCTGGGGTGCACCGG + Intronic
1107717780 13:43217485-43217507 CAAGGCTTGCAGCGGGACAGAGG + Intronic
1108726582 13:53189896-53189918 CATGGCAACCACCTGGACACTGG - Intergenic
1113453810 13:110433075-110433097 CACGTCCTCCATCGGGACACAGG - Intronic
1118335122 14:64846958-64846980 CACGGCATCAAGCTTGACAGTGG + Intronic
1121108114 14:91293800-91293822 CCCTCCATCCAGGGGGACACAGG + Intronic
1122677316 14:103426477-103426499 CTGGGCATCCTGCAGGACACAGG - Intronic
1132017741 15:98333675-98333697 CACAGCATCAAGCTTGACACTGG + Intergenic
1132535213 16:475660-475682 CAGGGCATCCAGCCGGCCAGGGG + Intronic
1142470079 17:158316-158338 AAGGGGATCCAGGGGGACACAGG - Intronic
1144138027 17:12317957-12317979 CTCTGCATCCAGCTGGACCCTGG - Intergenic
1144711963 17:17407108-17407130 CACAGCACCCAGGGTGACACTGG - Intergenic
1148069117 17:44896926-44896948 CACTGCACCCAGCTGGACTCTGG - Intronic
1149461394 17:56833168-56833190 CACGGAATCCAGAGAGGCACAGG - Exonic
1149583060 17:57764776-57764798 CACCGCATCCAGCCGGCCAGAGG + Intergenic
1151729380 17:75901898-75901920 CACGGCATCCAGCGGGACACTGG + Exonic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1157106874 18:44782133-44782155 CACTGCTTCCAGCAGGACATGGG + Intronic
1160452217 18:78973714-78973736 GCCGGGAGCCAGCGGGACACGGG + Intergenic
1165407293 19:35638622-35638644 CACCGCACCCAGCCGGTCACAGG - Intergenic
1166362510 19:42259776-42259798 CACTGCATCCTGGGTGACACAGG - Intergenic
930173409 2:48275466-48275488 CACTGCATCCAGCCAGACCCTGG + Intergenic
936075645 2:109399980-109400002 CAGGGCAGCCAGAGGGACTCTGG - Intronic
938732695 2:134158685-134158707 CAGGGCAGCCAGCGGGAGACGGG - Intronic
1173252997 20:41374498-41374520 CAAGGCATCCAGAGGGGCAGAGG + Intergenic
1184005993 22:41709526-41709548 CGCGGGATGCAGCGGCACACGGG + Intronic
1184408821 22:44315013-44315035 CAAGGCATACAGCGGGACGTGGG + Intergenic
1184697182 22:46146583-46146605 CACGGCACCTAGCATGACACAGG + Intergenic
1184987226 22:48144145-48144167 CACGGCCTCGTGCTGGACACAGG + Intergenic
1185338931 22:50283098-50283120 CACGGCACCCACCTGGACACGGG - Exonic
950555249 3:13691724-13691746 CACTGCACCCAGCTGGACAAGGG + Intergenic
953750836 3:45607267-45607289 CAGGGAAACCAGCTGGACACAGG + Intronic
968739537 4:2320306-2320328 CGCGGCACCCAGGGGGCCACAGG - Intronic
968895269 4:3397241-3397263 CTCGGCACCCAGAGGCACACAGG - Intronic
973030023 4:45326077-45326099 CAGGGCAGCCTGCTGGACACAGG + Intergenic
974508602 4:62808069-62808091 CCAGGCCTCCAGAGGGACACAGG - Intergenic
984566315 4:181335208-181335230 CCCAGCATCCAGCAGGAAACTGG + Intergenic
985670393 5:1203772-1203794 CACTGCAGCCAGAGGGACTCGGG + Intronic
993060210 5:83029781-83029803 CACGTGACCCAGCGAGACACTGG + Intergenic
995228369 5:109729702-109729724 CACTGCTTCCAGTGGAACACAGG - Intronic
997731758 5:136186113-136186135 CGTGGTATCCAGCTGGACACAGG - Intronic
1003143182 6:3488485-3488507 CCCGGCATCATGCTGGACACCGG + Intergenic
1008292993 6:49740811-49740833 CACCGCATCCAGCCCCACACAGG - Intronic
1018048457 6:159986109-159986131 GAAGGAAACCAGCGGGACACAGG - Intronic
1019606773 7:1913949-1913971 CATGGCGTCCAGCAGGACATGGG - Intronic
1019662461 7:2232526-2232548 CACGGTAGGCAGCGGGACCCCGG + Intronic
1019904055 7:4047565-4047587 CACAGCATCCAGAGGAACAAAGG - Intronic
1035414800 7:158673861-158673883 CACAACATCCAGAGGGACAAGGG + Intronic
1039119426 8:34129336-34129358 CACGGAACCCAGCAGGCCACAGG - Intergenic
1054326596 9:63715822-63715844 CACAGGATCCAGGTGGACACTGG - Intergenic
1057220367 9:93254443-93254465 CAGGGCAGCCAGCAGGACAGAGG - Intronic
1057727598 9:97579101-97579123 CACGGCAGGCAGAGGGACACTGG - Intronic
1061875671 9:133542385-133542407 CACGGCCTCCTGCTGGACCCAGG + Intronic
1062515332 9:136931222-136931244 CACTGCACCCAGCCGGAGACAGG + Intronic
1062527482 9:136983863-136983885 CACGGAGTCCAGAGGGACCCAGG + Intronic
1187665951 X:21609516-21609538 CACGTCATCCTGTGGGTCACAGG - Exonic
1189253387 X:39618912-39618934 CACCGCACCCAGCGGGATTCTGG + Intergenic