ID: 1151733561

View in Genome Browser
Species Human (GRCh38)
Location 17:75925080-75925102
Sequence CCTTTCCTTCTGAGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 7, 3: 45, 4: 437}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151733547_1151733561 23 Left 1151733547 17:75925034-75925056 CCTTTTATGATTTCAGGGGCTTT 0: 1
1: 0
2: 1
3: 13
4: 232
Right 1151733561 17:75925080-75925102 CCTTTCCTTCTGAGGCTGGGTGG 0: 1
1: 0
2: 7
3: 45
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151733561 Original CRISPR CCTTTCCTTCTGAGGCTGGG TGG Intronic
900708398 1:4094837-4094859 TGGTTCCTTCTGAGGCTGGGAGG - Intergenic
900727839 1:4230011-4230033 TGGTTCCTTCTGAGGCTGTGAGG + Intergenic
900749281 1:4384236-4384258 CTTCTACTTCTGTGGCTGGGAGG - Intergenic
900887061 1:5422743-5422765 CGTTTCCTTCTGAGGCTGTGAGG - Intergenic
901183920 1:7359957-7359979 TGGTTTCTTCTGAGGCTGGGAGG + Intronic
901416174 1:9118381-9118403 CCTGTGACTCTGAGGCTGGGAGG + Intronic
901760241 1:11466453-11466475 CTTTGCCTTCTGAGGCAGAGTGG + Intergenic
902076406 1:13790333-13790355 CCGTTCTTTCTAAGGCTGGCGGG + Intronic
902391380 1:16109119-16109141 CCTTTCTTTCTGAGATGGGGAGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903465024 1:23546027-23546049 CCTTTTCTTTCGAGGCAGGGCGG - Intergenic
903692369 1:25183645-25183667 CCTTTGCATGTGAGGCAGGGCGG - Intergenic
904905242 1:33892840-33892862 TCTTTCCCTCTGAGTCTGGTTGG + Intronic
905870195 1:41399194-41399216 CCTTTGCTTCCAGGGCTGGGAGG - Intergenic
905872804 1:41414826-41414848 CTGTCCCTGCTGAGGCTGGGGGG + Intergenic
905943706 1:41884548-41884570 GCTAACCTTCTGAGGCTGGCAGG - Intronic
906054016 1:42900201-42900223 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
906068051 1:42996369-42996391 CCTTACCTTCTCAGGCTCGATGG - Intergenic
907384456 1:54117090-54117112 ACTTTCCTTCTGAGTCTGAAGGG - Intergenic
908772793 1:67611343-67611365 CCGTTCCTTCCGAGGCTATGAGG - Intergenic
910108393 1:83655773-83655795 CTTTGCCTGCTGAGGATGGGAGG - Intergenic
910739042 1:90494945-90494967 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
911074782 1:93862495-93862517 CCTGTCCTTCTGAGGCAAGAGGG + Intergenic
912373208 1:109189578-109189600 TCTTTCCTTTTCAGGCTGGGAGG + Exonic
912519027 1:110232835-110232857 CATTGCCTTCTGGGGTTGGGGGG - Exonic
914455597 1:147833573-147833595 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
914927116 1:151898154-151898176 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
916256003 1:162788954-162788976 CCTTTCCATCTGAGACATGGTGG + Intergenic
916579868 1:166097425-166097447 CCTTTTCTTCTGCAGCTGAGAGG + Intronic
918428696 1:184436482-184436504 CCTCTACTTCTGAGGCAGAGTGG + Intronic
918591442 1:186245494-186245516 CCTTTCCATCTGAGACTTGGTGG - Intergenic
920297685 1:204969040-204969062 CCCTTCCCTCTGAGGGTGGTTGG + Intronic
920354014 1:205356890-205356912 CCTTTGCAGCTGAGACTGGGTGG - Intronic
921802725 1:219419683-219419705 GTTTCCCCTCTGAGGCTGGGCGG + Intergenic
922242249 1:223763359-223763381 CCTTTCCTTGGGAATCTGGGAGG - Intronic
922621457 1:226991898-226991920 CCTTCTCTTCTCAGGCAGGGAGG - Exonic
922741062 1:228014508-228014530 CAAGTCCTTCTGAGGCTGGCAGG - Intronic
922763179 1:228144843-228144865 CCTTTCCCTTGGGGGCTGGGAGG + Intronic
923081184 1:230657101-230657123 CCTATCCTTATGATGCTAGGTGG + Intronic
923874636 1:238034476-238034498 CCTTTCCTTTTGCAGCTGGGAGG + Intergenic
923920549 1:238559699-238559721 CCTTCCCTTCTCAGGCTGTATGG + Intergenic
1062837582 10:646166-646188 ACATTCCTGCTGGGGCTGGGTGG - Intronic
1063187593 10:3665139-3665161 CCTTTTCCTCCCAGGCTGGGCGG - Intergenic
1064029508 10:11875011-11875033 CTTTTTCTTCTGTGGCTGGCTGG - Intergenic
1064282237 10:13961343-13961365 AATTTCCATCTGAGGCTGGGCGG + Intronic
1065329868 10:24584729-24584751 CCTTTCCATCTCAGACTGGCTGG - Exonic
1065333592 10:24630827-24630849 CCTTCACTTCTGAGGCCAGGAGG - Intronic
1066194865 10:33089349-33089371 CCTTTCCTGCTGAGGCTTCTGGG + Intergenic
1066476308 10:35750394-35750416 CTCTTCCCTCTGAGGCTGGTAGG + Intergenic
1066722465 10:38354604-38354626 CCTTTCCATCTGAGACACGGTGG + Intergenic
1067005162 10:42653999-42654021 CTCCTCCTTCTGAGGCTAGGAGG - Intergenic
1068060763 10:52064654-52064676 CCTGTGCTCCTGGGGCTGGGAGG - Intronic
1068130951 10:52894458-52894480 CTTTTCCTTCTGAGGCGCAGAGG - Intergenic
1068206734 10:53864424-53864446 CCTTTCCATCTGAGACATGGGGG - Intronic
1068712282 10:60147924-60147946 GCTTTCCTTCTGAAAATGGGTGG + Intronic
1068774865 10:60858637-60858659 CCCTTCCTTTTGAACCTGGGTGG - Intergenic
1068884200 10:62081496-62081518 CCTCTGCTTCTGAGGAAGGGAGG + Intronic
1069642276 10:69963670-69963692 CCTTTCCTTCCCAGCCTGGCAGG - Intronic
1070480811 10:76881029-76881051 CATTTCAGTCTGTGGCTGGGAGG + Intronic
1071730133 10:88239663-88239685 CCTTTCTTTCCCAGGCTGGGTGG + Intergenic
1072053407 10:91729170-91729192 CCTTTCCATCTGAGGTATGGTGG - Intergenic
1072176431 10:92927256-92927278 CCTTTCCTTCTGATGTTGGATGG + Intronic
1072643739 10:97234966-97234988 CCTTTTCTTCTGGGGCTAAGGGG - Intronic
1072680564 10:97503270-97503292 CTTCTCCTTCAGATGCTGGGTGG + Intronic
1074058705 10:109944896-109944918 CCTTTTCTTCTGAGGCTCCCAGG - Intronic
1074310004 10:112313908-112313930 CATTTCCTTCAGAGGCAGAGAGG - Intergenic
1074833194 10:117264049-117264071 CCTTTGCTTCCGGGGCTGGATGG + Intronic
1075784960 10:125042787-125042809 CCCTTCTGGCTGAGGCTGGGAGG + Intronic
1076267405 10:129119460-129119482 GGTGTCCTTCTGAGGCTGTGAGG - Intergenic
1076564652 10:131389832-131389854 CCATTTCATCTGTGGCTGGGAGG + Intergenic
1076725106 10:132409510-132409532 CCTTCCCCTCTCAGGCTCGGTGG - Intronic
1077827424 11:5826319-5826341 CCTTCCCATCACAGGCTGGGAGG + Intronic
1078637815 11:13068410-13068432 CCTTGCCCTCTCAGGCTTGGTGG - Intergenic
1078666703 11:13331817-13331839 CTTCTCTTTCTGAGGCTGGAAGG + Intronic
1079183454 11:18214817-18214839 CCTATTTTTCTGTGGCTGGGTGG - Intronic
1080153086 11:29076510-29076532 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1081156015 11:39691953-39691975 CTTTTCCCTCTGAGGCTCAGAGG - Intergenic
1082229458 11:49745431-49745453 CCTTTCCATCACAGGCTTGGAGG - Intergenic
1083475091 11:62910218-62910240 CCTCTCCCTCTGAGGATGTGAGG + Exonic
1084538049 11:69769424-69769446 TGGTTCCTTCTGAGGCTGGGAGG + Intergenic
1084747484 11:71182458-71182480 TGGTTCCTTCTGAGGCTGTGAGG + Intronic
1085184567 11:74564561-74564583 GCTTTGCTTCTGATGCTGGCTGG + Intronic
1086076753 11:82862943-82862965 CCTTTCATTTTTAGGCTGAGTGG - Intronic
1086535184 11:87835728-87835750 TGGTTCCTTCTGAGGCTGTGAGG - Intergenic
1087077174 11:94136082-94136104 CCTTTCCTTTTAATGCTGGGAGG - Intronic
1088346803 11:108835815-108835837 CCTTTCCATTTGAGGCGTGGTGG + Intronic
1088416510 11:109595110-109595132 CCTTTCCTTCTGATTTAGGGAGG + Intergenic
1088884930 11:113998995-113999017 CCTGTCCTTCTGACGGTGGGGGG - Intergenic
1089180212 11:116578452-116578474 CATTGCCTTATGGGGCTGGGGGG - Intergenic
1090408732 11:126493150-126493172 CCTTTCCTCCTGAGTCCAGGAGG - Intronic
1090462348 11:126902845-126902867 CATTTCCTTCTGAGGCTACATGG + Intronic
1091121002 11:133057486-133057508 CCTTGCCTTCTGCTTCTGGGTGG + Intronic
1092077808 12:5687745-5687767 TCATTCCCTCTGAGGCAGGGAGG + Intronic
1092961066 12:13597441-13597463 CTTTTCCATCTGAGACTTGGTGG - Intronic
1093176619 12:15919950-15919972 CATTTCTTTCTCAGGCTGTGGGG - Intronic
1093389544 12:18602103-18602125 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1094362060 12:29640836-29640858 CCTTTTCTTATGCAGCTGGGAGG + Intronic
1095163277 12:38941497-38941519 CCTATCCTACTGTGGCTGTGAGG - Intergenic
1095672471 12:44876653-44876675 CCTTGCCTCCTGCAGCTGGGTGG - Exonic
1096031143 12:48416431-48416453 TCCTTCCTTCTGAGGATGGTGGG + Intergenic
1096103998 12:48986249-48986271 GCTTTCCTGATGAGGCTGGCAGG - Intergenic
1096883878 12:54698006-54698028 CCTGTGCTCCTCAGGCTGGGAGG + Intergenic
1097170539 12:57110381-57110403 GCTTCCCTTCTGAGTTTGGGAGG - Intronic
1097760493 12:63459243-63459265 CCTTTTCTTTTGCAGCTGGGTGG + Intergenic
1098141869 12:67457953-67457975 CCTTTCCTCCTGAGCCTGGGTGG + Intergenic
1099151428 12:79119026-79119048 CCTTTCCTACTTTGGCTGGATGG - Intronic
1101407719 12:104443363-104443385 CCTCTCCTCCAGAGGCTGTGGGG - Intergenic
1101650256 12:106671242-106671264 CTTTACCTACTGAGGGTGGGTGG + Intronic
1102277265 12:111592094-111592116 CCTTAGCTCATGAGGCTGGGCGG + Intronic
1102437993 12:112940151-112940173 ACCTTCCTTCTGGGGCTGTGAGG + Intronic
1102446478 12:113006860-113006882 CCTTGCCTACAGAGGGTGGGTGG + Intronic
1103544369 12:121689366-121689388 TGTTTCATTCTGAGACTGGGTGG + Intergenic
1104066323 12:125310143-125310165 CCCTTCCCTTTGAGTCTGGGTGG - Intronic
1104178688 12:126357289-126357311 CATCTTCTTCTAAGGCTGGGCGG - Intergenic
1104248107 12:127062199-127062221 CCTTTGCTTCTGTGCCTGGGAGG + Intergenic
1104704373 12:130932401-130932423 CCTCTCCCCCTGAGGCTGGGAGG + Intergenic
1105316335 13:19268109-19268131 GCTTTCTTGCTGAGGCTGTGGGG - Intergenic
1105578398 13:21673554-21673576 CCTTTACTTCTGGGGTGGGGAGG - Intronic
1105766648 13:23566646-23566668 TGGTTCCTTCTGAGGCTGTGAGG + Intergenic
1105811093 13:23996211-23996233 GCTTTCCTTCTGAGGCCATGAGG + Intronic
1106199195 13:27522306-27522328 ACTTTTGTTCTCAGGCTGGGTGG + Intergenic
1107310579 13:39073313-39073335 CCTTCCCTTCCTTGGCTGGGTGG - Intergenic
1108042496 13:46352243-46352265 GTTTTCTTTCTGAAGCTGGGTGG - Intronic
1108825491 13:54407977-54407999 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1108868481 13:54951196-54951218 TCTTTCCCTCTGAGAATGGGAGG - Intergenic
1110146169 13:72193004-72193026 CCTTTCCTTCTGTATTTGGGAGG + Intergenic
1113329903 13:109317675-109317697 CCTTTTCTTTTGCTGCTGGGCGG + Intergenic
1113922878 13:113923961-113923983 CCTCTCCTTCTGGGTGTGGGTGG - Intergenic
1115265116 14:31492838-31492860 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1115283393 14:31690241-31690263 CTTTTCCTTTTGAGGCTCAGAGG - Intronic
1115969765 14:38932346-38932368 CCTTTTCTTTTGAGGCTGGTAGG + Intergenic
1117056928 14:51921708-51921730 CCATTACTTCAGAGGCTGAGAGG + Intronic
1117920194 14:60721310-60721332 CCATTTGGTCTGAGGCTGGGAGG + Intronic
1118064910 14:62180249-62180271 CCTTGTCTTCTGAAGCTGGATGG + Intergenic
1118162267 14:63302138-63302160 CCTTTTCTTTGGAAGCTGGGAGG + Intergenic
1118435071 14:65763699-65763721 CCTCAGCTTCTGAGGCTGAGGGG + Intergenic
1118944727 14:70373794-70373816 TGTTTCCTTTTGAGGCTGGATGG + Intronic
1119639846 14:76306333-76306355 CATTGACTTCTTAGGCTGGGAGG + Intergenic
1120999712 14:90442864-90442886 CTGCTCCATCTGAGGCTGGGGGG - Intergenic
1122365725 14:101193860-101193882 CATGTCCTTCTGGGGCTGTGTGG + Intergenic
1122927353 14:104911437-104911459 TAATTCCTTCTGAGGCTGTGAGG - Intergenic
1124055974 15:26241324-26241346 TGGTTCCTTCTGAGGCTGTGAGG - Intergenic
1125514429 15:40309718-40309740 CCTTTCCTCCTCAGGCTGAGGGG - Intergenic
1125596946 15:40893483-40893505 CCTCTCCACCTCAGGCTGGGCGG + Intergenic
1126460847 15:48913526-48913548 CCTTTACTTTTGCAGCTGGGAGG - Intronic
1127198350 15:56614947-56614969 CCTTTCCATCTGAGACATGGTGG - Intergenic
1127869045 15:63054910-63054932 CTATTCCTTTTGAGGGTGGGGGG - Intronic
1128562544 15:68678183-68678205 CCTTTCCCACTGAGTCTGGGAGG + Intronic
1128748800 15:70133828-70133850 CCTGGCCTTCTTAGGCTGCGAGG + Intergenic
1128757885 15:70195762-70195784 CCTTTCCCCCTGAGACTGGAGGG - Intergenic
1130321282 15:82844217-82844239 CCTTTCCTTCTGAGGCATACAGG - Intronic
1131489403 15:92849498-92849520 TGGTTCCTTCTGAGGCTGTGAGG - Intergenic
1132138258 15:99366206-99366228 TGGTTCCTTCTGAGGCTGTGAGG + Intronic
1132203704 15:99972350-99972372 CTTTTCATTCTGAGGGTGTGGGG + Exonic
1132751226 16:1458592-1458614 CCGTCCCGTCTGAGGATGGGTGG - Intronic
1133133772 16:3694918-3694940 TGGTTCCTCCTGAGGCTGGGAGG + Intronic
1133788418 16:8990619-8990641 ACCACCCTTCTGAGGCTGGGAGG - Intergenic
1133835200 16:9361683-9361705 CCTTGCCTTCTGAGGCAGCATGG - Intergenic
1133935098 16:10262807-10262829 TTTTTCCTTCTGGGGCTTGGGGG - Intergenic
1133964821 16:10523098-10523120 CCTTTCCTTCTGAGTCTTGGTGG + Intergenic
1134320793 16:13160884-13160906 ACTTTCCTTTTCAGGCTGGATGG + Intronic
1134409861 16:13994873-13994895 CCTTTCCTTCTGGTTCTGGAAGG + Intergenic
1135965628 16:27032708-27032730 CCTTTCCATCTGAGACATGGCGG + Intergenic
1136078178 16:27831209-27831231 AATTTCATTCTCAGGCTGGGTGG - Intronic
1136279531 16:29199847-29199869 CCTTCCCTTTTAAGGCTGAGTGG + Intergenic
1137746271 16:50822538-50822560 ACGCTCCTTCTGAGGCTTGGTGG - Intergenic
1137875121 16:51989351-51989373 CCTTTTCTTCTGGGGGTAGGTGG - Intergenic
1138027110 16:53530742-53530764 TCTTGCCTACTGAGACTGGGTGG + Intergenic
1138820556 16:60254132-60254154 ACATTCCTTTTGAAGCTGGGGGG + Intergenic
1139916475 16:70431317-70431339 GCTGACCTGCTGAGGCTGGGGGG + Intronic
1141157947 16:81610102-81610124 TCATTCCTTCTGGGGCTGGAGGG + Intronic
1141422657 16:83926652-83926674 CCCTTCCTTCAGGGGCTGTGGGG + Exonic
1142083924 16:88165948-88165970 CCTTCCCTTTTGAGGCTGAGTGG + Intergenic
1142537721 17:631333-631355 CCTCTCTTTCTGAGGCTGGAAGG + Intronic
1143270102 17:5669036-5669058 CCTCTCTTTCTGAGGCAGGCAGG - Intergenic
1143885178 17:10059953-10059975 CCTTTCCCCCTGAGGGTGGGTGG + Intronic
1144061908 17:11590569-11590591 CCCTCCCTTCTAAGGCAGGGAGG + Intergenic
1144416306 17:15050632-15050654 CCTTGCCTTCTGTGGCAAGGAGG + Intergenic
1144636012 17:16909609-16909631 CCTTTCCATCTGAGACGTGGTGG - Intergenic
1144680578 17:17191031-17191053 CATTTCCTTATAATGCTGGGCGG - Exonic
1146579931 17:34028174-34028196 TCTCTGCTTCTAAGGCTGGGGGG - Intronic
1146583345 17:34059557-34059579 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1146603438 17:34237867-34237889 CCTTGCCTTCTGACACTGTGTGG - Intergenic
1146647459 17:34584663-34584685 CCTTTTCAACTGATGCTGGGAGG - Intronic
1147428125 17:40355997-40356019 CCTTTCCTGCAGGGGCTGAGCGG + Exonic
1148080749 17:44966776-44966798 TTTTTCCTCCTGAGGCGGGGAGG - Intronic
1148484149 17:47979825-47979847 CCTCTCCCCTTGAGGCTGGGAGG - Intronic
1149182536 17:53956606-53956628 CCTCTCCATCTGGGGCAGGGTGG + Intergenic
1150613009 17:66748894-66748916 CCCTTCCTCCTGAAGCTGAGAGG - Intronic
1150846731 17:68666139-68666161 TGGTTCCTTCTGAGGCTGTGAGG - Intergenic
1151099178 17:71536154-71536176 CCTTTCCTTTTTAGTGTGGGAGG + Intergenic
1151480941 17:74369759-74369781 CGTTTCCTGCTGAGGCCGGGGGG - Intronic
1151688726 17:75666516-75666538 CCTTTCCTTTTGACCCTGAGCGG - Exonic
1151733561 17:75925080-75925102 CCTTTCCTTCTGAGGCTGGGTGG + Intronic
1151758235 17:76086804-76086826 CCTGTCCCTCTGAAGCTTGGTGG - Intronic
1151830058 17:76544338-76544360 CCTTCCCTTCAGAGGCAGAGTGG - Intronic
1152201979 17:78952529-78952551 CCTTTTCTTCCATGGCTGGGAGG + Intergenic
1152770739 17:82167172-82167194 TCTTTCCTTCTGGGGCTCTGAGG - Intronic
1154191867 18:12236858-12236880 AGGGTCCTTCTGAGGCTGGGGGG + Intergenic
1154982602 18:21515966-21515988 GATTTCCTTCTGAGTCTGGAGGG - Intronic
1154982610 18:21516023-21516045 GATTTCCTTCTGAGTCTGGAGGG - Intronic
1155160260 18:23189754-23189776 CTCTTCCTTCTGAGCCTGGCAGG + Intronic
1156268464 18:35509318-35509340 GCTTTCCCTCTAAGACTGGGAGG - Intergenic
1156282873 18:35658150-35658172 CCTTTCCTCCAGAGGCAAGGAGG - Intronic
1157174882 18:45442362-45442384 TCATTCCTTCTGAGACTGTGAGG + Intronic
1159368281 18:67498940-67498962 CCCTTCCTTCTGAGTATGGATGG + Intergenic
1159682881 18:71376948-71376970 TGTTTCCTTCTGAGTCTTGGTGG - Intergenic
1160091055 18:75826899-75826921 CGGTTTCTTCTGAGGCTGCGAGG + Intergenic
1160224995 18:77005607-77005629 CATTTCCTTCTGAGAATGGTGGG + Intronic
1160395457 18:78567710-78567732 CCTTTCCTTCTGGGACTCTGAGG - Intergenic
1160507735 18:79436811-79436833 CCTTTCCTTCAGAGGGAAGGAGG + Intronic
1160629241 18:80233775-80233797 CCTTTGCTTCTGAGACAGGATGG - Intronic
1161199178 19:3005133-3005155 CCTTTCCTCGTGTAGCTGGGTGG - Intronic
1161220608 19:3116390-3116412 CAGGTCCTTCTGAGGCTGAGGGG + Intronic
1161244758 19:3243748-3243770 TGGTTCCTTCTGAGGCTGTGAGG + Intronic
1163298539 19:16428658-16428680 CATTTCCTTCCTGGGCTGGGTGG + Intronic
1163427552 19:17247448-17247470 CCTTTGGTTCTGAGGCTGCATGG + Intronic
1163449699 19:17369025-17369047 TGGTTCCTTCTGAGGCTGTGAGG - Intronic
1163984996 19:20937839-20937861 TCTTTCATACTGTGGCTGGGAGG + Intronic
1165433573 19:35785175-35785197 CCTTTCCTCCTGCGGTTTGGGGG - Exonic
1167942946 19:52962409-52962431 CCTTTCCATCTGAGACGTGGTGG - Intronic
1168570008 19:57458812-57458834 CACTTCTTTCTGAGGCTAGGAGG - Intronic
1168649863 19:58086109-58086131 CTTTTTCTTCAGAGGCTGAGGGG - Intronic
1168722183 19:58560184-58560206 CCTTTGCTTCTCAGACTGGCTGG + Intergenic
925736629 2:6969444-6969466 CAGTTCCTTCTGAGGCTGGGAGG - Intronic
925792007 2:7499152-7499174 TGGTTCCTTCTGAGGCTGTGAGG + Intergenic
926170972 2:10552446-10552468 TGGTTCCTTCTGAGGCTGTGAGG + Intergenic
926385559 2:12332664-12332686 CCTTTCTTGCTGAGGTTGTGGGG + Intergenic
927440752 2:23115246-23115268 CCTTTACTTCAGGGGCAGGGTGG + Intergenic
927620264 2:24648595-24648617 CCTTTCCCTTTCAGGTTGGGAGG + Intronic
927783654 2:25957825-25957847 CCTTGGCCTCTGAGGCTGTGTGG - Intronic
928040387 2:27870063-27870085 CCATTCCTTCCCAGTCTGGGGGG + Intronic
928904796 2:36356901-36356923 CCGTTCCTGCTGGGACTGGGTGG + Intronic
928970009 2:37018127-37018149 CCTTTCCTTCTGTTGCTGGGAGG - Intronic
929175296 2:38969501-38969523 CTCTTCCCTCTGAGGCTGGGAGG + Intronic
929242107 2:39664797-39664819 GGTTTCCTTCTTGGGCTGGGGGG - Intergenic
929594943 2:43170055-43170077 CCTTTTCTTTGGAGGCTGGGAGG - Intergenic
929623443 2:43381391-43381413 CTTCACCTCCTGAGGCTGGGTGG - Intronic
930234740 2:48877717-48877739 TCTCTCTTACTGAGGCTGGGTGG - Intergenic
930887404 2:56342128-56342150 CCTATTATTCTGAGGCTGGTTGG + Intronic
931220263 2:60283085-60283107 TGTTTCATTCTGAGGCTGGCTGG - Intergenic
931525270 2:63145682-63145704 CCTTTTCTTTTGCAGCTGGGAGG - Intronic
932270328 2:70403510-70403532 CCTTTTCTTCTGCAGCTGGAAGG + Intergenic
932564951 2:72900377-72900399 TCTTTCCTTCTGGGGTTGTGTGG + Intergenic
932790523 2:74650838-74650860 CCATTCCTTTTAAGGCAGGGAGG - Intergenic
934584169 2:95475143-95475165 CCTTTCCTTCTGAGTATGAGAGG + Intergenic
934595283 2:95601571-95601593 CCTTTCCTTCTGAGTATGAGAGG - Intergenic
934787487 2:97023963-97023985 CCTTCCCTTCTGAGTATGAGAGG + Intergenic
934915620 2:98298972-98298994 CCTTTCCCTCTGAGCCGGGGTGG + Intronic
935332579 2:101987935-101987957 CTCTTCCTGCTGAGGCTGGTGGG + Intergenic
935874925 2:107496124-107496146 TGGTTCCTTCTGAGGCTGTGAGG + Intergenic
936410003 2:112249349-112249371 TGGTTCCTTCTGAGGCTGTGGGG - Intronic
936520783 2:113210795-113210817 CCTATGCTTCTGTGTCTGGGAGG - Intergenic
937271824 2:120657771-120657793 ACTTGCCTTCTGAGGCAGAGGGG + Intergenic
937498405 2:122450336-122450358 CCTGTCCCTCTTTGGCTGGGTGG - Intergenic
940431302 2:153593140-153593162 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
940722588 2:157298392-157298414 CCTTTCCTTCTGAGATGTGGTGG - Intronic
941381091 2:164793012-164793034 TCTTTCTTTCTCAGACTGGGTGG - Intronic
941917880 2:170823849-170823871 CCTGGCCTGCTGAGGGTGGGGGG + Intronic
942140434 2:172972141-172972163 GCTGTCCTGCAGAGGCTGGGTGG + Intronic
942206567 2:173625390-173625412 CATTCCCTTCTGAAGCTGGCGGG + Intergenic
944165423 2:196714432-196714454 CCTTTCCATCTGAGACATGGTGG + Intronic
944391043 2:199220021-199220043 CCTTTCCATCTGAGGGGGTGAGG - Intergenic
946782320 2:223204779-223204801 CCTTTCCTTCTGTGCCTGGGAGG - Intergenic
947457130 2:230265376-230265398 CTTTTTCTTCTGCAGCTGGGAGG - Intronic
948076331 2:235167877-235167899 TGGTTCCTTCTGAGGCTGTGAGG - Intergenic
948711044 2:239825761-239825783 CTGTGCCTTCTGAGGCTGGGAGG - Intergenic
1170704157 20:18729753-18729775 GCTCTGCTTCTTAGGCTGGGAGG - Intronic
1170858096 20:20076177-20076199 CCTCTCTTCCTGAAGCTGGGTGG + Intronic
1171487382 20:25494568-25494590 CCTTTCCTTCCAGGGCTGGCTGG - Intronic
1172449927 20:35014783-35014805 ACTTTCCTTCTCATGCTGGTAGG + Intronic
1172949641 20:38714617-38714639 CACTTCCATCTGAGGCTGTGGGG + Intergenic
1173574073 20:44098894-44098916 CCTTTCCATCTGAGACATGGTGG + Intergenic
1173669228 20:44786241-44786263 CCCCTCCCTCAGAGGCTGGGTGG - Intronic
1174210791 20:48876272-48876294 CCTGCCCACCTGAGGCTGGGTGG - Intergenic
1174716921 20:52768857-52768879 CCTTTCCTTCTGCCGTTGTGTGG - Intergenic
1175544509 20:59769475-59769497 TGGTTCCTTCTGAGGCTGTGAGG - Intronic
1175715195 20:61250965-61250987 CCTCTCCTTCTTCGGCTAGGTGG + Intergenic
1176085356 20:63293288-63293310 CCTGTGGTCCTGAGGCTGGGTGG + Intronic
1176234957 20:64049741-64049763 CCCTTTCTTCTCAGGCCGGGCGG + Intergenic
1176389947 21:6158294-6158316 CTGTGCCTTCTGGGGCTGGGAGG - Intergenic
1178110227 21:29362902-29362924 TGGTTCCTTCTGAGGCTGTGAGG - Intronic
1178251597 21:31008616-31008638 TGGTTCCTTCTGAGGCTGTGAGG - Intergenic
1178308339 21:31509193-31509215 CCCTACCTGCTGAGACTGGGAGG + Intronic
1178627847 21:34233203-34233225 GGGTTCCTCCTGAGGCTGGGAGG + Intergenic
1178943422 21:36926245-36926267 CCTTTGCTTCTGTGGGTGGAAGG - Intronic
1179565187 21:42243157-42243179 GCTTTCCTTGTGAACCTGGGTGG + Intronic
1179733519 21:43379946-43379968 CTGTGCCTTCTGGGGCTGGGAGG + Intergenic
1179931354 21:44572998-44573020 GGGTTCCTTCTGAGGCTGCGAGG - Intronic
1180235418 21:46456605-46456627 TGGTTCCTTCTGGGGCTGGGAGG - Intergenic
1180709383 22:17829478-17829500 CCTTTCTTTATGGTGCTGGGTGG + Intronic
1182275873 22:29188302-29188324 TGGTTCCTTCTGAGGCTGAGAGG + Intergenic
1182534365 22:30989460-30989482 CCTCTCCTTCTTAGGCTGTTAGG - Intergenic
1182850267 22:33467933-33467955 CCTGTCATTCTGAGGCTTTGAGG + Intronic
1183191779 22:36326252-36326274 CCTCCCCTTCTGAGGCTGGAAGG - Intronic
1183293925 22:37019130-37019152 CCTTTCCTTCCAAGGCAGAGGGG + Exonic
1183371450 22:37434864-37434886 CCTTTGCTTCTGTGGCAGTGAGG - Intergenic
1184099280 22:42333571-42333593 CCTTTGCCTCTGAGGCAGGTGGG - Intronic
1184383236 22:44159597-44159619 ACTCTCCTTCGGAGGATGGGAGG + Intronic
1184852726 22:47130014-47130036 CCCTTCCTTCTGAGGCTCCTGGG + Intronic
1185053760 22:48567360-48567382 CATTTCCTAATAAGGCTGGGAGG - Intronic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
951269561 3:20608078-20608100 CGTTTTCTTTTGAAGCTGGGAGG + Intergenic
952326495 3:32324994-32325016 CCTTTCCTTCTGGTGCAGGGAGG + Intronic
952391396 3:32883906-32883928 ACTTCCCTTCTGAAGCTGGAAGG - Intronic
953390929 3:42533397-42533419 CCTTTCCTTCTCAGACAGGAAGG - Intronic
953540332 3:43812512-43812534 CCTTTCCTTCTTACGGTGGCAGG + Intergenic
953906954 3:46873212-46873234 CCTTCCCTTCTCTGCCTGGGTGG - Intronic
955081910 3:55665650-55665672 CACTTCCTTCTGGGGCTGTGAGG - Intronic
956060645 3:65344839-65344861 CCTTTACCTCTGAGGGTAGGGGG - Intergenic
956878019 3:73482721-73482743 CCTTTACTTTTGTTGCTGGGGGG - Intronic
957288849 3:78250667-78250689 GATTACCTTCTGTGGCTGGGTGG - Intergenic
958480830 3:94643675-94643697 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
958903856 3:99920663-99920685 GCTTTCCCACTGAGGGTGGGTGG - Intronic
959608412 3:108267098-108267120 CCCTTTATGCTGAGGCTGGGGGG + Intergenic
959997220 3:112693193-112693215 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
960207358 3:114918707-114918729 CCTATCCTACTGTGGCTGAGTGG + Intronic
961340493 3:126213911-126213933 CCTTCCCTTCTGTGCCTGGCTGG - Intergenic
963641643 3:147867695-147867717 GCTTTCTTTATGAGGCTGGGTGG + Intergenic
964188945 3:153980144-153980166 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
965216926 3:165875118-165875140 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
967863271 3:194169577-194169599 CCTTTACTTCTCAGGCAGTGAGG - Intergenic
968044267 3:195614974-195614996 CCTTTTCTTCTTCTGCTGGGAGG + Intergenic
968060055 3:195721037-195721059 CCTTTTCTTCTTCTGCTGGGAGG + Exonic
968384035 4:120866-120888 CCTTTCCGTCTGAGGAGTGGTGG - Intergenic
968592039 4:1464154-1464176 CCTTTCCTGCTGACGCTGTGGGG - Intergenic
968747294 4:2366731-2366753 CATCTCCTTCTGTGGGTGGGAGG - Intronic
969433857 4:7172708-7172730 CACCTCCTTCTAAGGCTGGGAGG + Intergenic
969947709 4:10801472-10801494 CCTCTCCCTGTGAGGATGGGAGG - Intergenic
969999273 4:11347559-11347581 TGGTTCCTTCTGAGGCTGTGAGG - Intergenic
970592713 4:17573453-17573475 CCTTTCTTTCTGGTGCAGGGAGG - Intergenic
971267186 4:25106023-25106045 TGGTTCCTTCTGAGGCTGTGAGG - Intergenic
975517215 4:75260055-75260077 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
980316125 4:131203064-131203086 CCTCTTCTTCTGAGGCAGGGAGG + Intergenic
982116881 4:152105435-152105457 GCTTTCTTTCTGGGGGTGGGGGG - Intergenic
982923207 4:161303195-161303217 CAGTTTCTTCTGAGGCTGGAGGG - Intergenic
984527600 4:180875681-180875703 CCTTTTCTTCTGCAGCTGGGAGG - Intergenic
984848029 4:184124264-184124286 TTTTTCCTTCTCAGGCTGTGAGG - Exonic
985006522 4:185540015-185540037 CCTTTTCTTCTGAGAATGGTTGG + Intergenic
985045174 4:185933500-185933522 TGGTTCCTTCTGAGGCTGTGCGG + Intronic
985249099 4:188005356-188005378 TGGTTCCTTCTGAGGCTGGGAGG + Intergenic
985845171 5:2339187-2339209 ACTTTCTTTCTGAGGCAGGAAGG - Intergenic
985860096 5:2464174-2464196 TCCTTCCTCCTGAGGCTGTGAGG - Intergenic
986123338 5:4863458-4863480 AGGTTCCTTCTGAGGCTGTGAGG - Intergenic
986200572 5:5574679-5574701 TGGTTCCTTCTGAGGCTGTGAGG + Intergenic
986716764 5:10530371-10530393 TGCTTCCTTCTGAGGCTGTGTGG - Intergenic
987579194 5:19766607-19766629 GCCTTCCTTCTGAGACTGTGGGG - Intronic
988344553 5:30020838-30020860 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
990559672 5:56971272-56971294 CCCTCCATTTTGAGGCTGGGAGG - Intronic
991191353 5:63878068-63878090 CCTTGCCTTGTGAGGGTGTGAGG - Intergenic
991386906 5:66100918-66100940 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
993883923 5:93395002-93395024 CCTTTACTTTTGCAGCTGGGAGG - Intergenic
994875261 5:105413715-105413737 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
996318555 5:122188635-122188657 CGTTTCTTTCTGAGGCTCTGAGG - Intergenic
998003380 5:138641625-138641647 CCTTTCTTTCTTAGGCTCAGAGG + Intronic
998466012 5:142344571-142344593 CCTCTCCTTCCAAGGCTAGGTGG - Intergenic
998601250 5:143587341-143587363 CCTTTTCTTCTGGGGGTGGGGGG + Intergenic
998629068 5:143878368-143878390 CCTTTCCATCTGAGACTTGGTGG - Intergenic
999361736 5:150991666-150991688 CCTCTCCTTCTCAGGCTGCATGG - Intergenic
1001420970 5:171586840-171586862 CCTTGCTTTCTGGGGGTGGGGGG + Intergenic
1001545020 5:172565683-172565705 TGGTTCCTTCTGAGGCTGTGAGG + Intergenic
1001570549 5:172727748-172727770 CCTTTGCTGCAGAGGCTCGGGGG - Intergenic
1002671031 5:180867529-180867551 TGGTTCCTTCTGAGGCTGTGAGG + Intergenic
1002983792 6:2168170-2168192 TCTTTCCTTCTGAGGAAGGAAGG - Intronic
1003447014 6:6194100-6194122 CCTTTCCATCTCTGGCTTGGAGG + Intronic
1003450828 6:6230158-6230180 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1004427070 6:15513752-15513774 CCATTCTTTCTGAGGCAGTGAGG + Intronic
1005081808 6:21964096-21964118 CCTTTTCTTCTGGGGCTGGGCGG + Intergenic
1006573175 6:35022131-35022153 CCTGACTTTCTCAGGCTGGGTGG - Intronic
1007188529 6:39994073-39994095 CTCTTCCTTCTGAGGCCAGGAGG + Intergenic
1007744461 6:44034829-44034851 CCTGTCCTTCTGTGGCTCAGGGG + Intergenic
1009453124 6:63824971-63824993 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1010772226 6:79845037-79845059 CCTTTCCTGCTTTGTCTGGGAGG - Intergenic
1010790942 6:80064602-80064624 CCTTTCCATCTCAGACTGGCTGG - Intergenic
1010828261 6:80498844-80498866 CCTTTCCTTCTGTGCCTGTGTGG + Intergenic
1011168581 6:84479227-84479249 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1012808598 6:103928230-103928252 CCTTTCCATCTGAGCCAGGCTGG + Intergenic
1015414667 6:132934689-132934711 TGGTTCCTTCTGAAGCTGGGAGG - Intergenic
1015568187 6:134595269-134595291 CCTTGCCTGAGGAGGCTGGGCGG + Intergenic
1015663348 6:135600664-135600686 CCTTTTCTTCTGCAGCTTGGAGG - Intergenic
1016190742 6:141261395-141261417 CCTTTCCCTCTCAGACTGGTGGG - Intergenic
1016370800 6:143372008-143372030 TCTTTTCATCTGAGGCTGTGAGG + Intergenic
1016693415 6:146965274-146965296 CCTTCCCATCACAGGCTGGGAGG + Intergenic
1017724818 6:157269562-157269584 CCTTTTCTTCTGAAGCTGCAGGG + Intergenic
1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG + Intronic
1018446424 6:163863038-163863060 TGGTTCCTTCTGAGGCTGCGAGG - Intergenic
1018702289 6:166436691-166436713 CCTGTGCCTCAGAGGCTGGGAGG - Intronic
1018787673 6:167121085-167121107 CCTTCCCCTCTGGGGCAGGGAGG + Intergenic
1019366351 7:635411-635433 CCGATCCTTCTGAGGCTCTGTGG - Intronic
1019647603 7:2139402-2139424 CCTTCACTGCTGAGGGTGGGGGG - Intronic
1024456851 7:49618132-49618154 GCTCTCCTTCTGAGTGTGGGTGG + Intergenic
1024563079 7:50660669-50660691 CCTTTCCTTCTGCTACTGCGTGG - Intronic
1026879778 7:73901111-73901133 CCACGCCTTCAGAGGCTGGGAGG - Intergenic
1027350501 7:77306613-77306635 CCTTTTCTTTTGCAGCTGGGAGG - Intronic
1028269154 7:88766531-88766553 TCTTTTCTTCTTTGGCTGGGAGG + Intronic
1028817007 7:95157494-95157516 CTTCTCCTTCTGAGGTGGGGTGG - Intronic
1029274911 7:99398229-99398251 CCTTTCCCTCTGAGGCTTTCTGG - Intronic
1029328823 7:99834091-99834113 CTCTTCCTTCTGAGGCTAAGAGG + Intronic
1029484137 7:100828934-100828956 CCTTTCCTTCTGCCCCTTGGAGG - Intronic
1030050157 7:105530751-105530773 CCTTTTTTTCTGGGGCGGGGCGG - Intergenic
1030093493 7:105877282-105877304 CCTTCCCATCTCAGGCTGCGGGG + Intronic
1030325161 7:108211449-108211471 CCTTTTCTTTTGCCGCTGGGAGG + Intronic
1030527438 7:110671631-110671653 CCTTTCCTTCAGATGCCAGGGGG + Intronic
1031997768 7:128243891-128243913 CCTCTCCTTCTGAGTCTTGCTGG + Intronic
1032783223 7:135181034-135181056 CTCCTCCTTCTGAGGCTAGGAGG - Intergenic
1033123874 7:138690084-138690106 GGGTTCTTTCTGAGGCTGGGAGG - Intronic
1033369104 7:140693228-140693250 GCTTTCATTCTGAAGCTGGGTGG - Intronic
1033792577 7:144809000-144809022 ACTTTTCTTCTGATTCTGGGTGG - Intronic
1034542444 7:151767213-151767235 CGGCTCCTTCTGAGGCTGTGAGG - Intronic
1035961552 8:4143983-4144005 CCTTTCCATCTGAGACACGGTGG + Intronic
1036421890 8:8604232-8604254 ACTTTCCATCTGTGGCTGGTGGG - Intergenic
1036583663 8:10102243-10102265 CCTTTCCTTCCAAGACTTGGAGG + Intronic
1037491807 8:19403327-19403349 CCCATCCTTCTTACGCTGGGAGG + Intergenic
1037563237 8:20093879-20093901 CCTTTCCTTCTTAGGATGCGAGG - Intergenic
1037567653 8:20130905-20130927 CCCATCCTCCAGAGGCTGGGAGG - Intergenic
1038251822 8:25911974-25911996 TCTCTGCTTCTGAGGCAGGGAGG + Intronic
1038709333 8:29927164-29927186 CCTTTCCTCCTCTTGCTGGGGGG - Intergenic
1038844565 8:31216748-31216770 CTTTTCCTTCTCAAGCTGGAGGG + Intergenic
1039120633 8:34142386-34142408 CCCTTCCTTTTGAATCTGGGTGG - Intergenic
1039123519 8:34175397-34175419 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1039268451 8:35854456-35854478 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1039398318 8:37246638-37246660 TCTCTCCTCCTGAGGCTGGGAGG - Intergenic
1039509881 8:38082765-38082787 CTCCTCCTTCTGAGGCTAGGAGG + Intergenic
1039577321 8:38633875-38633897 CCCTGCCTTCTGAGGCTGTGGGG + Intergenic
1039663650 8:39495679-39495701 CCTATCCTGCTGTGGCTGAGCGG - Intergenic
1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG + Intergenic
1039843865 8:41311866-41311888 CCTTTCCAGCTGGGTCTGGGAGG - Intergenic
1039896672 8:41721348-41721370 TGATTCCTTCTGAGGCTGTGAGG - Intronic
1039976916 8:42374691-42374713 CCTATCCTTAAGAGGCTGGGAGG + Intronic
1040366595 8:46723789-46723811 GCTATCTTTCTGAGGGTGGGAGG - Intergenic
1040683115 8:49837711-49837733 CCTTTCCATCTGAGACCTGGTGG - Intergenic
1040791299 8:51232897-51232919 ACTTACCTTCTAATGCTGGGGGG - Intergenic
1041296532 8:56362738-56362760 CTTTTCCTTCCTTGGCTGGGTGG + Intergenic
1041404042 8:57477497-57477519 TCTTTCCTTCTAAGGGAGGGAGG + Intergenic
1041570606 8:59333359-59333381 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1041632493 8:60103820-60103842 CCTTCTCTTCTGAGGATGTGGGG + Intergenic
1042775795 8:72429473-72429495 CAGTTCCTTCTGAGGCTGTGAGG - Intergenic
1045529397 8:102970175-102970197 CCTTTCCACCTGCAGCTGGGGGG + Intronic
1049014602 8:139910745-139910767 CATTTCCTTCTCAGGCCAGGTGG + Intronic
1049407254 8:142457283-142457305 CCTTGCCTTCTGCAGGTGGGGGG + Intronic
1049790507 8:144470206-144470228 CCTGTCCCTGTGAGGCTGGCAGG - Intronic
1052835233 9:33245425-33245447 CCTGTCCTGCTAAGCCTGGGTGG - Intronic
1054867813 9:70020555-70020577 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1055287038 9:74739774-74739796 CCTTTCTTCCTGAGGTTGTGCGG - Exonic
1056699771 9:88892531-88892553 CGGTTCCTTCTGAGGCTGTGAGG - Intergenic
1057226095 9:93294022-93294044 TCTGTCCTGCTGCGGCTGGGGGG + Intronic
1057309035 9:93930136-93930158 TGGTTCCTTCTGAGGCTGTGAGG - Intergenic
1057566997 9:96173634-96173656 CCTTTCCCCCAGAGTCTGGGTGG + Intergenic
1057741048 9:97711428-97711450 CCTTTCTTTGTCAGGCTGGGTGG - Intergenic
1059049973 9:110913769-110913791 GCTTTCCTTCTTAGGCAGTGGGG + Intronic
1060876640 9:127088830-127088852 CAGTTCATCCTGAGGCTGGGAGG - Exonic
1062072844 9:134567320-134567342 TCTTTCCCTCTGAATCTGGGCGG - Intergenic
1062392127 9:136338062-136338084 CCTTGCCTTCTGGGGAGGGGAGG - Intronic
1062526336 9:136979413-136979435 CCTTTGCCTCTGACGCTGGTGGG - Intronic
1185795321 X:2959625-2959647 CAATTCCTTCTGAGGCTGCCTGG + Intronic
1186054335 X:5632790-5632812 CCTTTCCATCTGAGACATGGTGG + Intergenic
1188045956 X:25426369-25426391 CCTTTCCTTTCGCAGCTGGGAGG - Intergenic
1189496533 X:41513714-41513736 CCCTTCCTTTAGTGGCTGGGTGG + Intergenic
1190344169 X:49322273-49322295 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190345264 X:49331818-49331840 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190346358 X:49341384-49341406 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190347609 X:49532413-49532435 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190348710 X:49541969-49541991 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190349810 X:49551525-49551547 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190350915 X:49561078-49561100 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190352016 X:49570636-49570658 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190353117 X:49580185-49580207 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190354218 X:49589732-49589754 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190355320 X:49599256-49599278 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1191067663 X:56367398-56367420 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1191903620 X:66064603-66064625 CCTTTTCTTTTGTAGCTGGGAGG - Intergenic
1192014758 X:67317454-67317476 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1192608022 X:72539998-72540020 TCTTTCCTTCTCAGGAGGGGTGG - Intronic
1192790016 X:74372330-74372352 GGTTTGCTTCTGAGGCAGGGAGG + Intergenic
1193076963 X:77364733-77364755 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1193154549 X:78158639-78158661 CCTTTTCTTCGGCGGATGGGAGG + Intergenic
1193211590 X:78812132-78812154 CCTTTCTTTCTTAGCCTGTGAGG - Intergenic
1193578464 X:83232463-83232485 CCTTTTCTTTAGCGGCTGGGAGG + Intergenic
1194605650 X:95975006-95975028 CCTTTTCTTCTGGAGTTGGGAGG + Intergenic
1194926968 X:99836777-99836799 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1195394309 X:104394561-104394583 CCCTTCCTTTTGAGCTTGGGTGG + Intergenic
1196218858 X:113088127-113088149 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1197671708 X:129284660-129284682 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1198843190 X:140880772-140880794 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1199496588 X:148458979-148459001 ACTTTCTATCTGAGGCTGGGAGG + Intergenic
1199937644 X:152591186-152591208 CCTTTCCTCCTGAGGCTTTCGGG - Intergenic
1200779765 Y:7203970-7203992 CACATCCTTCTGAGGCTAGGAGG - Intergenic
1200885206 Y:8260672-8260694 CATTTCATCCTGAGGCTTGGAGG + Intergenic
1200900256 Y:8424390-8424412 CCTTTCATTGTTAGGCTTGGAGG - Intergenic
1201331945 Y:12833674-12833696 CCTTTCCTTCTTAGGCTTTGGGG + Exonic