ID: 1151741209

View in Genome Browser
Species Human (GRCh38)
Location 17:75983497-75983519
Sequence AAACACTGGTTGTCTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 10, 2: 14, 3: 19, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151741209_1151741213 12 Left 1151741209 17:75983497-75983519 CCTGTTTTAGACAACCAGTGTTT 0: 1
1: 10
2: 14
3: 19
4: 191
Right 1151741213 17:75983532-75983554 CCACCTCTATAACCACCTGATGG 0: 1
1: 0
2: 0
3: 4
4: 112
1151741209_1151741214 13 Left 1151741209 17:75983497-75983519 CCTGTTTTAGACAACCAGTGTTT 0: 1
1: 10
2: 14
3: 19
4: 191
Right 1151741214 17:75983533-75983555 CACCTCTATAACCACCTGATGGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151741209 Original CRISPR AAACACTGGTTGTCTAAAAC AGG (reversed) Intronic
900168550 1:1254908-1254930 AAAAACGGGTTTACTAAAACAGG + Intronic
904057062 1:27678094-27678116 AAACATTTGTTGTCTAAAATAGG + Intergenic
906445965 1:45898336-45898358 AAACATTGGTTGTCTAAAACAGG - Intronic
909075217 1:71045022-71045044 AAATACTGTATATCTAAAACTGG + Intronic
909887089 1:80955853-80955875 GAACAGTGGTTGTCTGAAGCAGG + Intergenic
911746226 1:101444700-101444722 AAACATTGGTATTCTAAAACAGG - Intergenic
912720286 1:112014388-112014410 ATACACTGGTTATACAAAACAGG + Intergenic
915798238 1:158760426-158760448 AAACAATGCTTCTCTAAAACTGG + Intergenic
916293508 1:163191494-163191516 AAACATTGGTTGTCTAAAATGGG + Intronic
916513090 1:165490593-165490615 AAACACTTGATTTCTGAAACTGG - Intergenic
919218473 1:194592520-194592542 AAACAATTGTTTTCAAAAACTGG - Intergenic
919298905 1:195735765-195735787 AATAACTGGTTGTTTAAAAAGGG + Intergenic
921309123 1:213825312-213825334 AAAAGCTGCTTGTCTAAACCTGG + Intergenic
921822719 1:219636133-219636155 AAACATTCCTTCTCTAAAACAGG - Intergenic
922302664 1:224316387-224316409 AATCAATGGTTGCCTAAAGCTGG + Intronic
923519170 1:234722711-234722733 AAAGAGTGGTTTTATAAAACCGG + Intergenic
923795060 1:237145691-237145713 AAAAACTGGTCATCTAGAACTGG - Intronic
1063820275 10:9826658-9826680 AAAAAGTGGTTGTATAAAATTGG + Intergenic
1065282927 10:24158428-24158450 AAACACATGATGTCTAACACAGG + Intronic
1065796765 10:29315135-29315157 ATGCTCTGGATGTCTAAAACTGG + Intronic
1066807297 10:39272013-39272035 AAACACTGTTTTTCTAGAATTGG - Intergenic
1068411672 10:56663363-56663385 AAAAACTGATTGTCTGAAAAGGG - Intergenic
1070084196 10:73219525-73219547 CAAAACTGGTTGTGTGAAACTGG + Intronic
1072195102 10:93110975-93110997 AAACAGTGGTTGACTAAAAGAGG - Intergenic
1073006438 10:100328943-100328965 AAACAATGGCTGCCAAAAACTGG + Intronic
1074792418 10:116903895-116903917 GAACACTGGGTGGCTTAAACAGG - Intronic
1075043692 10:119128810-119128832 AAAATCTGGTTGTTTAAAAGTGG - Intronic
1077961763 11:7083262-7083284 AAACACTGGTTGCCTAAAATGGG - Intergenic
1080852557 11:36082500-36082522 AAACACTTTTTGTCTGAGACAGG - Intronic
1083428121 11:62599877-62599899 AAACAATGGTTTTCTAAAGGGGG - Intronic
1084233564 11:67770947-67770969 AAACCCTGGTTGTTTAAAACGGG + Intergenic
1085134701 11:74075682-74075704 GAAAACTGGTTATCTAAAACAGG - Intronic
1085891387 11:80584314-80584336 AAATACTGATTGTCTACCACGGG + Intergenic
1088242323 11:107785203-107785225 AAACACTGGTTGCCTAAAGCAGG + Intergenic
1088662489 11:112061553-112061575 AAACACTGATACTCAAAAACAGG - Intronic
1089939865 11:122404861-122404883 AAAAATTGGTTGAGTAAAACAGG - Intergenic
1090417873 11:126553098-126553120 AAATATTGGTTGTCTAAAATGGG - Intronic
1092974193 12:13728348-13728370 AAACAGTGGTTCTCTAAAACTGG - Intronic
1093954476 12:25200673-25200695 AGACCCTGGATGTCTAAAAATGG - Intronic
1094249921 12:28347990-28348012 AAACCTTGGTTGTCTAAAACAGG - Intronic
1095464914 12:42480264-42480286 AAAGAATGGTTGCCTAATACCGG - Intronic
1095630153 12:44366972-44366994 ATACACTGGTTGTTTACAGCTGG - Intronic
1097254357 12:57661382-57661404 AATGACTGGTTGTTTAAAAGAGG + Intergenic
1098184230 12:67879220-67879242 AAACATTGGTTGTCTAAAATGGG + Intergenic
1099067321 12:77998705-77998727 AAATACTGTTTCTCAAAAACAGG + Intronic
1100685199 12:96979863-96979885 AAACACTGGGTGGCAAAAAACGG + Intergenic
1104098010 12:125577857-125577879 AAACATTGGTTGTTTAAAAGAGG + Intronic
1104540291 12:129657774-129657796 AGACACTGGATGTTTAACACAGG + Intronic
1104701640 12:130909161-130909183 AAACAATGGTTTTCAAAGACTGG + Intergenic
1106638994 13:31563198-31563220 AAACACAGTGTGTCTAAAGCAGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1108344687 13:49533922-49533944 AAACAAGGGTTGTTTAAAATGGG + Exonic
1108767060 13:53644219-53644241 AAAGAATGGGTGTGTAAAACTGG - Intergenic
1109240816 13:59885331-59885353 AAACACTGGTTTTCTACGATGGG - Intronic
1109299915 13:60580327-60580349 AATCAGTGGTTGTCTAAAGATGG + Intergenic
1109788284 13:67211961-67211983 AGACAGTGGTTCTCTAAAAATGG - Intronic
1109890075 13:68600025-68600047 AAACACTAGTTGAATAAATCAGG + Intergenic
1109967691 13:69723146-69723168 AAACAGTGGTTATCAAAGACTGG + Intronic
1111386957 13:87539846-87539868 AAATATCAGTTGTCTAAAACAGG + Intergenic
1117307884 14:54494181-54494203 AGACACTGATAGTCTAAAATGGG - Intergenic
1117969076 14:61234560-61234582 AAATATTGGTTGTCTAAGATGGG - Intronic
1118563346 14:67111698-67111720 AAACACTGAATTTCTAACACAGG - Intronic
1118578509 14:67269041-67269063 GATCAGTGGTTGCCTAAAACTGG - Intronic
1121630725 14:95420111-95420133 AGACACTGATTTTATAAAACAGG + Intronic
1126424904 15:48516740-48516762 AACCACTGGATGTCTTCAACGGG + Intronic
1132459698 16:45594-45616 AAACACTGTTTGTTTACAAATGG - Intergenic
1133159849 16:3903735-3903757 AAACAGTGGCTGGATAAAACTGG - Intergenic
1135975507 16:27106704-27106726 AAACTCTGGTAATATAAAACTGG - Intergenic
1136471318 16:30482601-30482623 AGACAATGGTTGTATAAACCAGG + Intronic
1138518832 16:57558609-57558631 AAGCAGAGGTTGTCAAAAACTGG - Intronic
1140159603 16:72474569-72474591 AAAGAGTGATTGTCTAAAGCTGG - Intergenic
1144452400 17:15391816-15391838 AAAATCTGGTTGTTTAAAAGAGG + Intergenic
1151252824 17:72850556-72850578 CAACATTGCTTGTCTTAAACAGG - Intronic
1151741209 17:75983497-75983519 AAACACTGGTTGTCTAAAACAGG - Intronic
1153938478 18:9953761-9953783 TAACACTGATTTTTTAAAACTGG - Intronic
1155258224 18:24016419-24016441 ACAAACTGGTAGTCTAAAAAAGG - Intronic
1156807124 18:41198052-41198074 AAACACTGGTTGATTAAATAAGG + Intergenic
1157338895 18:46761405-46761427 AAAAACTGGCTTTTTAAAACTGG - Intergenic
1164054275 19:21608719-21608741 AAACACTGTTTGTTTACAAATGG - Intergenic
1164362258 19:27526828-27526850 AAACACTTGTTGTGTAGAATTGG + Intergenic
1165380694 19:35477581-35477603 AAACAATGGATGTGTAAAATAGG - Intergenic
1167737545 19:51305384-51305406 AAACTTTGGTTGTCAAAAACAGG - Intergenic
928358698 2:30645428-30645450 AAACACTTGTTATCAAGAACAGG + Intergenic
928646760 2:33362267-33362289 AAACACTAGTTTTCCAAAAATGG - Intronic
928931576 2:36630546-36630568 AAAGACTGGTGGTCTAAAGTGGG - Intronic
929769007 2:44875935-44875957 AGACATTGGTTGCCAAAAACAGG + Intergenic
931162917 2:59714088-59714110 ACAAAGTGTTTGTCTAAAACAGG + Intergenic
932657373 2:73621777-73621799 AAACCCTGGCTGTTTAAAAGGGG + Intergenic
933019526 2:77173838-77173860 AAACACTGGTTTTCTAGGATAGG - Intronic
933361987 2:81298429-81298451 GAACCCTTGTTGTCTAAAATTGG - Intergenic
934497051 2:94812567-94812589 AGACAGTGGTTGCCTACAACAGG + Intergenic
937574214 2:123399482-123399504 CAACACAGGTTGCTTAAAACAGG - Intergenic
939046478 2:137256321-137256343 AAACACATGTTTTCTATAACAGG + Intronic
939366046 2:141232426-141232448 AAAAAATGGCTGTCTAAATCTGG - Intronic
941137823 2:161739352-161739374 AAACATTGGTTGGCCAAAATAGG - Intronic
941232435 2:162927721-162927743 TAACACTGCTTATCCAAAACTGG + Intergenic
941505372 2:166337325-166337347 AAACACAGGATGTCCAAAATTGG - Intronic
942042114 2:172077499-172077521 ACTCACTTGTTGTCTAAAAGTGG + Intronic
942210980 2:173669852-173669874 AAACACTCGTGTTCAAAAACAGG + Intergenic
942902160 2:181134045-181134067 AAAAATTGTTTGTCTAAACCAGG + Intergenic
943808779 2:192157981-192158003 TACCACTGGTAGACTAAAACAGG - Intronic
944703956 2:202270190-202270212 GAACAGTGGTTGTCTAGAGCAGG - Intronic
945296469 2:208176029-208176051 GATCACTGGTTGTCCAAAAGAGG + Intronic
946556612 2:220865596-220865618 AAATACTGGTTGTCAAAGAATGG + Intergenic
947481917 2:230508714-230508736 AAACACTGGTTGTTTTTCACTGG + Intronic
948455312 2:238101981-238102003 CAGCACTGGGTGTCCAAAACGGG - Exonic
1169825619 20:9765567-9765589 TAACACTGGTAGCTTAAAACTGG + Intronic
1170350140 20:15430677-15430699 AAAGACTGGCTGTCAAAAAAGGG + Intronic
1171418489 20:25000158-25000180 AAACACTGGTTGACTGGACCAGG + Intergenic
1173945109 20:46944216-46944238 GAGCACTGGTTGGCCAAAACAGG - Intronic
1174339277 20:49886023-49886045 AAGCAGTGGTTGTCAAACACTGG - Intronic
1180629353 22:17217007-17217029 AAACATTGTGTGTGTAAAACAGG + Intronic
951188015 3:19736347-19736369 AAATACTGGTTGACTTAAAAGGG + Intergenic
951889740 3:27557267-27557289 AAACACAGGTTTTCTGAATCTGG + Intergenic
952401757 3:32969832-32969854 AAACACTGTTTGTTTACAAACGG - Intergenic
952812299 3:37415170-37415192 CAAAACTCATTGTCTAAAACTGG - Intronic
952812856 3:37420578-37420600 CAAAACTCATTGTCTAAAACTGG - Intronic
953051595 3:39349274-39349296 AAACACTGCTTGTTTACAAATGG - Intergenic
953055270 3:39382957-39382979 ACACGCTGGATGTCTAAGACTGG - Intergenic
953918816 3:46937807-46937829 GAACATTGGTTGCCTAACACAGG - Intronic
955689383 3:61575942-61575964 AAACACTGGCTATTAAAAACAGG - Intronic
957050861 3:75410868-75410890 AAACGCTGGTTGTCTAAAACGGG + Intergenic
957924987 3:86797534-86797556 ATAAACTGGTTAGCTAAAACAGG - Intergenic
958953343 3:100439969-100439991 ACACACTGGGTGGCTTAAACAGG + Intronic
959781642 3:110241010-110241032 AAACTTTGGTTTTCTAAAATTGG - Intergenic
960119452 3:113932440-113932462 AAACACTGCTTTTCCTAAACAGG - Intronic
960583880 3:119303216-119303238 AAACACTGGTTTTCTGAAGAAGG - Intronic
960894762 3:122491545-122491567 AAACACTGGTTTGATAAAAGTGG + Intronic
961883146 3:130077303-130077325 AAACACTGATTGTCTAAAACGGG + Intergenic
962326899 3:134441897-134441919 AAACATTGGTTGCCTAAAGCAGG - Intergenic
962665149 3:137647056-137647078 AAACAATGGTTTTTTAAAAAGGG + Intergenic
964777291 3:160292358-160292380 AAACAGTGGTTTTCTAAAACAGG + Intronic
969821582 4:9724825-9724847 AAACGCTGGTTGTCTAAAACGGG - Intergenic
973981598 4:56312847-56312869 AAACTCTGATTCTCCAAAACAGG + Intronic
974934681 4:68398252-68398274 AAACATTGATTGTGTAAAACAGG + Intergenic
974995437 4:69152372-69152394 TAAAACTGGTTGTATAAAACTGG - Intronic
975349128 4:73326749-73326771 AAACACTGGTTGTCTAAATCAGG - Intergenic
976946918 4:90781714-90781736 AAACAATGGCTATATAAAACTGG - Intronic
978950959 4:114558742-114558764 AATAACTGGTTGTTTAAAAGAGG - Intergenic
979737781 4:124109125-124109147 GAACACTGATTGTATAATACTGG + Intergenic
980334399 4:131451883-131451905 AAACACTGGTAGGCAAAAATGGG - Intergenic
981584240 4:146284062-146284084 AAACCCTTATTATCTAAAACAGG - Intronic
983122582 4:163905656-163905678 TAACACAGGTTGCCTAAATCTGG - Intronic
984126235 4:175814600-175814622 ATTCACTTTTTGTCTAAAACAGG + Intronic
985382994 4:189414989-189415011 ATACAATGGTTGTGCAAAACAGG - Intergenic
985497205 5:216037-216059 CATCACTGGTTTTCCAAAACTGG + Intronic
985738374 5:1598916-1598938 CATCACTGGTTTTCCAAAACTGG - Intergenic
987111359 5:14690287-14690309 ACACACTGGTGGTCTTGAACAGG + Exonic
988796033 5:34654649-34654671 AAACAATGATTGTCTAAGGCAGG - Intergenic
989916623 5:49738416-49738438 AAACACTGTTTGTGTAGAATAGG + Intergenic
989928541 5:49914569-49914591 AAACACTGTTTGTGTAGAATCGG + Intergenic
989932085 5:49967539-49967561 AAACACTGTTTGTGTAGAATCGG + Intergenic
989938245 5:50058354-50058376 AAACACTGTTTGTGTAGAATCGG + Intergenic
994812258 5:104535278-104535300 AATCACTGGTTTTCACAAACTGG + Intergenic
995265969 5:110161082-110161104 AAACTCAAGTTGTCTAAAATTGG + Intergenic
995802595 5:116014666-116014688 AAACACTGGTTTTTTAAAAAAGG - Intronic
997384426 5:133461459-133461481 AAACATTGGTGAACTAAAACTGG - Intronic
997713346 5:136024373-136024395 AAACACTGGCTTTCTTAATCAGG - Intergenic
997922695 5:137997762-137997784 AACCACTGGTTCTCAAAAAGAGG + Intronic
998313783 5:141160323-141160345 AAAAACTGGATATCTAAAACTGG - Intergenic
998523779 5:142824369-142824391 ACACCCTGGTTCTCTAAGACAGG + Intronic
998599301 5:143568867-143568889 AAACACTGGGTGATTTAAACAGG + Intergenic
999762522 5:154713441-154713463 AAACACTGATTGGCTATTACAGG - Intronic
999813985 5:155157340-155157362 GAACACTGATTGTCTATAAGAGG + Intergenic
1000186953 5:158868220-158868242 AAACTCTGGGTTTATAAAACAGG - Intronic
1001866058 5:175106516-175106538 AAATATTGAATGTCTAAAACAGG - Intergenic
1003102589 6:3188395-3188417 AAACATGCGTTGTCTAAAACAGG + Intergenic
1008025442 6:46630670-46630692 AAACAGATGTTGTCTACAACTGG + Intronic
1010122900 6:72399750-72399772 CAACTCTGCTTGTGTAAAACAGG + Intronic
1014570451 6:123000834-123000856 ACACACTGTTTCTTTAAAACAGG - Intronic
1015822401 6:137278563-137278585 AATCACAGTTTGTTTAAAACAGG - Intergenic
1016854509 6:148653237-148653259 AATGACTGGTTGTTTAAAAGAGG + Intergenic
1016935151 6:149444155-149444177 ACACACTGGCTGACTAACACTGG - Intergenic
1016935163 6:149444271-149444293 ACACACTGGCTGACTAACACTGG - Intergenic
1016935175 6:149444397-149444419 ACACACTGGCTGACTAACACTGG - Intergenic
1016935187 6:149444523-149444545 ACACACTGGCTGACTAACACTGG - Intergenic
1016935205 6:149444707-149444729 AAACACTGGGTGGCTGACACTGG - Intergenic
1018082162 6:160268401-160268423 AAACATTAGTTGTCCTAAACGGG + Intronic
1020317168 7:6914035-6914057 AAACGCTGGTTGTCTAAAACGGG + Intergenic
1021026560 7:15674925-15674947 AATCAATGGTTTTCTAAAACTGG + Intronic
1026365467 7:69644107-69644129 AAAGACTGGGTGACTTAAACAGG - Intronic
1028601015 7:92600515-92600537 ATTCACTGGATGTCTACAACTGG - Intergenic
1030747380 7:113183629-113183651 AAACACTGAATGTCTCAAATTGG - Intergenic
1037961188 8:23099454-23099476 AAACATTGATTGTCTAAAATGGG - Intronic
1037970489 8:23168403-23168425 AAACATTGATTGTCTAAAATGGG + Intergenic
1038747847 8:30269698-30269720 AAAAACTGGATGTCTAAGGCAGG + Intergenic
1039291347 8:36097270-36097292 AAACACTGGAAGTATAAAAGTGG + Intergenic
1040396541 8:47006186-47006208 AATAACTGGTTGTTTAAAAAAGG - Intergenic
1041461711 8:58118812-58118834 GAACACTGTTTGCCTGAAACAGG + Intronic
1043251145 8:78074753-78074775 AGACACTGGCTGTCTACAGCAGG + Intergenic
1044624070 8:94218858-94218880 GAACCCTGTTTGTCTAAAAACGG + Intergenic
1045260578 8:100569927-100569949 AAACATTGGTTGTCTAGAACAGG - Intergenic
1045580112 8:103469436-103469458 AAACACTGGAGGACAAAAACTGG + Intergenic
1046315928 8:112501534-112501556 AAGCACTGGTTTTTAAAAACTGG + Intronic
1046362919 8:113185560-113185582 AAACATTGGTTGTCTAAAACAGG - Intronic
1047716996 8:127604733-127604755 AAACATTGGTTGTCTAAAACGGG - Intergenic
1048076130 8:131073358-131073380 AAACAGTGGAGGTCTGAAACAGG + Intergenic
1049417315 8:142501023-142501045 AAACACTTGTTGTCGAATGCTGG + Intronic
1049589635 8:143451305-143451327 AAAAGCTGGTTGTCTGAAAAGGG + Intronic
1050183250 9:2942948-2942970 AAACAATGGTGGTTTAAAACTGG + Intergenic
1051931993 9:22396823-22396845 GAACACTGGTTGTCTTTAAGAGG + Intergenic
1052404570 9:28043282-28043304 ACACAATGGCTGTCTGAAACAGG - Intronic
1057174222 9:92984255-92984277 AATAACTGGTTGTTTAAAAGAGG - Intronic
1058557077 9:106180994-106181016 AGACAATGGTTGCCTAAAAGGGG - Intergenic
1059605114 9:115825697-115825719 AAAATCTGGTTGTTTAAAAGTGG + Intergenic
1060460731 9:123852073-123852095 AGACACTGATTGTTTAAAAGGGG - Intronic
1203743720 Un_GL000218v1:25512-25534 AAACACTGTCTGAGTAAAACAGG - Intergenic
1186765668 X:12768263-12768285 AAACACCGATGGTTTAAAACAGG - Intergenic
1188199130 X:27278077-27278099 AAACATTGGTTGTCTAAAATTGG + Intergenic
1188292946 X:28411115-28411137 AAACTCTGGTAGTCTATAATAGG - Intergenic
1189510458 X:41656582-41656604 AAACATTGGTTGTCTAAAACAGG + Intronic
1190570016 X:51771188-51771210 AAACACTGTTTGGCTCCAACTGG + Intergenic
1192381251 X:70618880-70618902 AAACATTGGTTGTCTAAAATGGG + Intronic
1192938256 X:75883967-75883989 AATCACTGGTTCTCAAAAGCAGG + Intergenic
1193103870 X:77646197-77646219 AAATACTGGTTATCTAAAAAAGG + Intronic
1193394613 X:80968897-80968919 AAACAGTGTTTTTCTGAAACGGG + Intergenic
1193769971 X:85576733-85576755 AAACATTGGTTGTCTAAAACAGG + Intergenic
1194149872 X:90310371-90310393 AAAAACAGATTGTCTGAAACTGG - Intergenic
1195383514 X:104292350-104292372 AAACATTGGTTGTCTAAAGCAGG + Intergenic
1195526134 X:105891587-105891609 AAACAGTGGTTCTCTAAATTTGG + Intronic
1195619367 X:106937699-106937721 ATACAGTGGTTGGCAAAAACAGG + Intronic
1196029171 X:111076408-111076430 AAGATCTGGTTGTTTAAAACAGG + Intronic
1196054339 X:111339111-111339133 AAATACTGGAAGTCTAAAAAAGG - Intronic
1196400893 X:115315064-115315086 AATAACTGGTTGTTTAAAAGAGG - Intergenic
1197111389 X:122779165-122779187 AAACACTGGTTATTTAAGATGGG + Intergenic
1197608752 X:128615167-128615189 TAATACTGGTTGTCTAAGAGTGG - Intergenic
1198479566 X:137029191-137029213 AAATACTGTTTGACTAAAAAAGG + Intergenic
1198747088 X:139901799-139901821 AAACCTTGGTTGTCTAAAACGGG + Intronic
1199249161 X:145639307-145639329 AAAGACTGGTTCTCTGAAATAGG + Intergenic
1200932593 Y:8710648-8710670 AAACACTGGTGGGCTATACCAGG + Intergenic
1201157044 Y:11140489-11140511 AAACACTGTCTGAGTAAAACAGG - Intergenic
1201451528 Y:14120799-14120821 AAAAACTGATTGTTTAAAAGTGG + Intergenic
1201927552 Y:19304763-19304785 ACACACTGGTTGTCAAGAAAGGG + Intergenic
1202071208 Y:20993422-20993444 AAACACTGTTTGTTTACAAATGG - Intergenic
1202085783 Y:21135335-21135357 AAACACTGATTGTCTAAAATGGG - Intergenic