ID: 1151744145

View in Genome Browser
Species Human (GRCh38)
Location 17:76002503-76002525
Sequence CCACAGTGTCACCACCTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151744145_1151744148 2 Left 1151744145 17:76002503-76002525 CCCTGCAGGTGGTGACACTGTGG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1151744148 17:76002528-76002550 TCGCGCCCCCGAGATTCTCTTGG 0: 1
1: 0
2: 0
3: 0
4: 16
1151744145_1151744149 3 Left 1151744145 17:76002503-76002525 CCCTGCAGGTGGTGACACTGTGG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1151744149 17:76002529-76002551 CGCGCCCCCGAGATTCTCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1151744145_1151744154 29 Left 1151744145 17:76002503-76002525 CCCTGCAGGTGGTGACACTGTGG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1151744154 17:76002555-76002577 CAAGTTCTATACCACAGCTGTGG 0: 1
1: 0
2: 2
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151744145 Original CRISPR CCACAGTGTCACCACCTGCA GGG (reversed) Exonic
900679219 1:3907165-3907187 CCACAGTGTCTCCTCCTGGGTGG - Intergenic
900929528 1:5727633-5727655 CCAAACTGTCTCCTCCTGCAGGG + Intergenic
902210844 1:14903388-14903410 CCCCAGTGTGCCCACCTGAAAGG - Intronic
902260304 1:15219957-15219979 CCACAGATTCACCAGCTCCAAGG - Exonic
902330273 1:15727871-15727893 GCACAGTGTCCCCAGCTTCAAGG - Intronic
903235906 1:21950727-21950749 CGTCAGTGTCACCACCAGCTTGG + Intergenic
904213872 1:28904314-28904336 CCACTGTGTCCCCACTTCCAGGG + Intronic
905279048 1:36837244-36837266 CCACAGGGCCACCATCTACAGGG + Intronic
905548300 1:38817248-38817270 CCTCAGTGTCCCCACCTCCAAGG + Intergenic
907053516 1:51345110-51345132 CTACAGTGGCAGCACCTGGACGG + Exonic
907334117 1:53689306-53689328 TCACAGAGGCACCACCTGCCTGG + Intronic
909364187 1:74800235-74800257 GCACAGTGTCATCATCTGCTTGG + Intergenic
912132249 1:106618019-106618041 CAACAGTGTATCCATCTGCAGGG + Intergenic
913073171 1:115319108-115319130 CCACAGTGTCTTCTCCAGCATGG + Intronic
915142142 1:153774512-153774534 CCACAGTGTGGCCACTTGCTGGG + Intronic
916195129 1:162215372-162215394 ACACAGTGCTGCCACCTGCAAGG - Intronic
918590990 1:186240922-186240944 CCACAGTGTGAGCAGCTACAGGG + Intergenic
919344656 1:196360450-196360472 CCATGGTGTCCCCACCTCCAGGG + Intronic
920110103 1:203581780-203581802 CACCAGGGTCCCCACCTGCAGGG + Intergenic
920379635 1:205528087-205528109 CCACAGGGTCACCACCTCATTGG - Exonic
922075683 1:222241668-222241690 ACACAGGGGCACCAGCTGCAGGG - Intergenic
922882935 1:228996268-228996290 CCACAGTGTCCCCTCCACCACGG - Intergenic
923014788 1:230118537-230118559 CATCAGTGCCACCATCTGCAGGG + Intronic
923027899 1:230220565-230220587 CCTCACTGTCACCACGTGCTGGG + Intronic
923498134 1:234542444-234542466 CCACAGTGGCACAGCGTGCAGGG - Intergenic
923783376 1:237044611-237044633 CCACTGTGTCACCTCCTTCAAGG - Intronic
924826140 1:247540865-247540887 CTAAACTGTAACCACCTGCAAGG + Intronic
1065581505 10:27176159-27176181 CCTCAGTTTCATCACCTTCATGG + Intronic
1066428617 10:35332064-35332086 CCACAGTGTAACCAGCTACAGGG - Intronic
1066592464 10:37010345-37010367 CCACATTGTCACCTCCTGCTGGG - Intergenic
1067546463 10:47195811-47195833 CCACAGTGACCCCACGTCCAGGG - Intergenic
1068935983 10:62636265-62636287 CCACAGTGTCACACGCTTCAGGG - Intronic
1069487333 10:68832333-68832355 CCACCCTGTCACCCCCAGCAGGG + Intronic
1070262141 10:74867658-74867680 CCAGAGTCTAACCATCTGCAAGG - Intronic
1070765909 10:79056291-79056313 TCTCAGTGTCACCCCCTACAGGG + Intergenic
1070827676 10:79400727-79400749 CCCCAGGGTCCACACCTGCAGGG - Intronic
1072705696 10:97679461-97679483 ACACAGTGTCACCACTTGGTTGG - Intronic
1076120850 10:127935467-127935489 CCACAGAGTGGCCAGCTGCATGG - Intronic
1076130253 10:128009042-128009064 CTACAGTGTCACCTCCAACATGG + Intronic
1077227156 11:1443393-1443415 CCAGGGTCTCACCACCAGCAAGG - Exonic
1077373197 11:2193217-2193239 CCTCAGTGTCCCCACCTGGGTGG + Intergenic
1078107772 11:8369521-8369543 CCCCACTGCCCCCACCTGCAAGG - Intergenic
1081353583 11:42085947-42085969 CCACAATGTCCCAACCTTCAAGG - Intergenic
1083041086 11:59688167-59688189 CCACAATGGCACCCACTGCATGG + Intergenic
1084119730 11:67062138-67062160 CGAAGGTGTCACCACCTGGAAGG + Intronic
1084183426 11:67457777-67457799 CCCCAGTCCCACCGCCTGCAGGG - Intronic
1085032726 11:73282438-73282460 CCACAGCCTTACCTCCTGCAAGG + Intronic
1085391580 11:76184935-76184957 CCACAGCGTCACCAGCTGCAAGG - Intergenic
1085895889 11:80639026-80639048 CCACATTGTCACCTCCTGCTGGG + Intergenic
1088686006 11:112285018-112285040 CCACAAGCTCACCATCTGCAAGG - Intergenic
1088897411 11:114088980-114089002 CCACAGGGTGACCACGAGCAAGG + Intronic
1092743604 12:11653067-11653089 CAACAGTGCCACAACCTTCAAGG - Intronic
1094363139 12:29651584-29651606 ACACAGAGTCACCAGCTGGAAGG + Intronic
1096747926 12:53740259-53740281 CCTCAGTTTCATCACCTGTAAGG - Intergenic
1098208999 12:68142712-68142734 CCACAGTCTCACCAACCGCCAGG + Intergenic
1098618735 12:72564211-72564233 CCACACTCTCACCACCTTTAGGG + Intronic
1099526692 12:83725768-83725790 ACACAGGGGCACCAGCTGCAGGG - Intergenic
1103948590 12:124540248-124540270 CTCCAGTGTCTCCTCCTGCAGGG - Intronic
1105617348 13:22030704-22030726 CCACAGTGTCACAGCCTGACTGG + Intergenic
1108507780 13:51128368-51128390 CCTCAGTGTCATCCCTTGCATGG - Intergenic
1110706655 13:78606376-78606398 ATACACTGTCACCTCCTGCAGGG - Intergenic
1112158892 13:96848266-96848288 ACACAGGGGCACCAGCTGCAGGG + Intergenic
1112200389 13:97268791-97268813 CCACAGTGTAAACTCCTACAGGG - Intronic
1113482992 13:110635268-110635290 GCACCGTGTCAGCACCTGCTCGG + Intronic
1114388675 14:22282646-22282668 CAAAATTGTCACCACCTGCTAGG - Intergenic
1115521141 14:34234051-34234073 CCAGAGGGTCAGCACCTGGAAGG + Intronic
1116100287 14:40425114-40425136 CTACAGTGTCACCTCTTGCCTGG + Intergenic
1116974409 14:51099666-51099688 TCACAGGGGCACCACCTTCATGG - Intergenic
1118302077 14:64625110-64625132 CCACAGCGTCAGCCCCTGGAAGG - Intergenic
1118667389 14:68085807-68085829 CCACTGTGGCACGCCCTGCAAGG - Intronic
1119309403 14:73633865-73633887 CCACAGGGCCACGACCTGCCAGG + Intergenic
1122235214 14:100327436-100327458 CCTCAGTTTCCCCACCTGCCAGG - Intronic
1122598581 14:102909614-102909636 CCACAGGCCCACCACCTGCCAGG + Exonic
1122651046 14:103227277-103227299 CAGCAGTGACACCTCCTGCAGGG + Intergenic
1123995635 15:25716199-25716221 CCAATGTGTCTCCAGCTGCATGG + Intronic
1124440875 15:29685532-29685554 CCATGCTGTCACCACGTGCAGGG - Intergenic
1124619928 15:31267879-31267901 CCACAGGGCCACCACCCTCAGGG - Intergenic
1126455856 15:48861365-48861387 GCCCAGTCTCACCACCTTCAGGG + Intronic
1126893616 15:53234255-53234277 CCACAGTGTGAAAAGCTGCATGG - Intergenic
1126937998 15:53733117-53733139 CCAGAGTGCCACTGCCTGCAGGG + Exonic
1128306684 15:66603571-66603593 CCACACTGTTCCCACCTCCAGGG + Intronic
1128308472 15:66615527-66615549 GCACAGTGGCACCCCCTGGATGG + Intronic
1128475739 15:67995618-67995640 CCTCAGTGTCACTACCAGCAAGG - Intergenic
1128509326 15:68303775-68303797 CCACAGTGCCAGGACCAGCAGGG + Exonic
1132290900 15:100703292-100703314 ACACATTGTCAGCAGCTGCAAGG - Intergenic
1136270259 16:29144312-29144334 CCACACTGTCTCCCTCTGCAGGG - Intergenic
1137506245 16:49056351-49056373 CCACAGCCTCACCCTCTGCAGGG - Intergenic
1137605830 16:49786290-49786312 CCACAGGGTCCCCACTGGCAGGG + Intronic
1138530432 16:57631569-57631591 CCACAGGGCCACCCCCAGCATGG - Intronic
1138736551 16:59257656-59257678 CCACATTGTCACCATATGAAAGG + Intergenic
1139311991 16:66035164-66035186 CCACAGTGTCACTGCCATCAAGG + Intergenic
1141476932 16:84280356-84280378 CCCCACTGTCACGACCTGCATGG - Intergenic
1142073849 16:88106146-88106168 CCACACTGTCTCCCTCTGCAGGG - Intronic
1142187792 16:88702640-88702662 CCACAGAGCCACCACCTGGCTGG + Intronic
1142210396 16:88805793-88805815 GCGCAGTGTCCCCACCTTCAAGG + Exonic
1142402781 16:89869695-89869717 CCACAGTGACATCAGCAGCAAGG - Intronic
1144755174 17:17675726-17675748 CCACCGTGCCACCAACAGCACGG - Intergenic
1146674525 17:34764197-34764219 CCACAGTTTCCACAGCTGCAGGG + Intergenic
1147155782 17:38543925-38543947 CCCCGGAGTCACCACCTTCATGG + Exonic
1147877754 17:43633388-43633410 ACACAGTGTCAGCACAAGCATGG - Intergenic
1151091872 17:71449500-71449522 CCACAGTGTCCACACCTTCTGGG + Intergenic
1151744145 17:76002503-76002525 CCACAGTGTCACCACCTGCAGGG - Exonic
1153696224 18:7645749-7645771 CTACAGTGTCACTCCCTGGATGG - Intronic
1154023510 18:10685660-10685682 ACCCAGTGTGACCATCTGCACGG - Intronic
1154383862 18:13875995-13876017 CCACAGGGTTACCACGAGCAGGG - Intergenic
1157371493 18:47116948-47116970 CCACAGTTTCACCTCTTCCAGGG - Intronic
1157544711 18:48539533-48539555 CCACAGTGTCGCCCCCTCCCTGG + Intronic
1159851890 18:73534790-73534812 CCTCAGTGTCACCAAGTCCAGGG - Intergenic
1160773992 19:846481-846503 CCTCAGTCTCCCCACCTGGAAGG + Intronic
1161395744 19:4044061-4044083 CCTCAGTGTCACCACCTGTGAGG + Intergenic
1161993473 19:7698511-7698533 CCACACTTTCAGCACCTCCATGG - Intronic
1162016981 19:7851347-7851369 CCTCAGTGTCCCCGCCTCCAGGG - Intronic
1162682187 19:12353951-12353973 CGACAGAGTCTCCACCAGCAAGG + Intronic
1163353703 19:16795882-16795904 CCACAGTGTCACAGCCTTCCTGG + Intronic
1163758274 19:19119831-19119853 CCCCCGTGTCCCCAGCTGCAAGG - Exonic
1164833818 19:31344201-31344223 ACACAGAGTGAACACCTGCAAGG + Intronic
1166419791 19:42627482-42627504 CCACATGGTCCTCACCTGCAGGG - Intronic
1166719135 19:44987535-44987557 CCACAGTTTCACAACCTCCCAGG + Intronic
1166915329 19:46191575-46191597 TCTCAATCTCACCACCTGCAAGG + Intergenic
1168102908 19:54150425-54150447 AGACAGTGCCACCAGCTGCAGGG + Intronic
925309892 2:2875023-2875045 CCACAGTGTCACCCGCAGCCCGG + Intergenic
925422672 2:3725276-3725298 CCACAGCCTCTCCACCTCCAGGG - Intronic
927554287 2:24021584-24021606 CTCCGGTGTCACCACCTCCAGGG + Intronic
927719446 2:25373369-25373391 CCACACTGTCTCCACCACCATGG - Intergenic
928938048 2:36701124-36701146 CTACGGTGTCTCTACCTGCAAGG - Intronic
932803645 2:74764757-74764779 GCACAGGGTCACTTCCTGCAGGG - Intergenic
937080878 2:119138682-119138704 CCACAGTGTCAGGAACTGCCAGG + Intergenic
941616195 2:167722872-167722894 CTCCACTGTCACCACCTCCAAGG + Intergenic
942201476 2:173575876-173575898 CCACAGTGAGCCCACCAGCAGGG - Intergenic
943002267 2:182343171-182343193 TTACAATGTCACCACCTGCAAGG + Intronic
945180541 2:207086945-207086967 ACAGAGAGTCACCATCTGCAGGG + Intronic
948060173 2:235037273-235037295 CCCCAGTGTCCCCAGCTGCTTGG + Intronic
948148057 2:235723458-235723480 CCACACTCTCCCCACCTGCAGGG - Intronic
948516813 2:238509374-238509396 CCTCAGTGTCACCCTCTCCAGGG + Intergenic
949070387 2:242020919-242020941 CCCCAGGGTCTCCAGCTGCACGG - Intergenic
949070675 2:242022348-242022370 CCCCAGGGTCTCCAGCTGCATGG - Intergenic
949070770 2:242022750-242022772 CCCCAGAGTCTCCAGCTGCAAGG - Intergenic
1170942141 20:20857154-20857176 CCTCAGTGGCACCTCCTGCATGG - Intergenic
1175420234 20:58827382-58827404 CCAGTGTGTCCCCACCAGCAGGG - Intergenic
1175976844 20:62715187-62715209 CCTCAGAGTCACCATCTGAACGG - Intronic
1178620175 21:34167376-34167398 CCACTGTGGCACCAGCTACATGG - Intergenic
1178704891 21:34864902-34864924 CCACTGTGTTTCCACCTTCATGG - Intronic
1179186226 21:39087199-39087221 CCTGACTGTCCCCACCTGCAAGG - Intergenic
1179414369 21:41186328-41186350 ACTCAGTTTCACCACCTGCCAGG + Intronic
1180092044 21:45538211-45538233 CCAGGCTGTCACCACCTCCAGGG + Intronic
1181042561 22:20199121-20199143 CCACAGGGCCACCTTCTGCATGG - Intergenic
1181881098 22:25980799-25980821 ACAAAGTGCCACCAACTGCATGG + Intronic
1182015846 22:27038973-27038995 CCACAGTCACACCACAAGCAAGG - Intergenic
1182062184 22:27406188-27406210 CCTCAGTTTCCCCACCTGGAAGG - Intergenic
1182679616 22:32068488-32068510 TGGCATTGTCACCACCTGCATGG - Exonic
1183374505 22:37455227-37455249 CCACACTGTGACCACGTGCGGGG + Intergenic
1183379600 22:37484322-37484344 CCGCAGTTTCCCCATCTGCACGG - Intronic
1183737320 22:39651114-39651136 CCTCAGGGTCACCAGCTGCTAGG - Intronic
1184194628 22:42918724-42918746 CCAGAGTCCCACCACCTGCCAGG + Intronic
1184735569 22:46395743-46395765 CCACAGGGGCATCACCTCCACGG + Intronic
949545526 3:5069046-5069068 CCACTGTGGGACCTCCTGCACGG - Intergenic
951642306 3:24849794-24849816 CCACAGAATTTCCACCTGCAAGG - Intergenic
954386416 3:50246339-50246361 CCACAGTGTCTCCGGCTGCCGGG + Intronic
959811316 3:110622945-110622967 CCAAAGTGTTCCCACCTGCATGG - Intergenic
960144817 3:114189784-114189806 CCACAGTGTCACCTTCTTCCAGG - Intronic
960947527 3:122977065-122977087 GCACAGTGTAACCATCTGGAGGG - Intronic
961448163 3:126990815-126990837 CCTCAGTGTCTCCATCTGTATGG - Intronic
961549478 3:127660828-127660850 CCACAGTGCTGCCAGCTGCAGGG + Exonic
961851785 3:129827118-129827140 ACTCATTGTCACTACCTGCATGG + Intronic
963422630 3:145079777-145079799 CCACAGTGTCCTTACTTGCAGGG - Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
968049823 3:195646965-195646987 CCGCAGTGCCTCCAGCTGCATGG + Intergenic
968049872 3:195647200-195647222 CCACCGGGTCTCCAGCTGCACGG + Intergenic
968049883 3:195647247-195647269 CCACTGGGTCTCCAGCTGCACGG + Intergenic
968050058 3:195648076-195648098 CCACAGGGTCTCCAGCTGCACGG - Intergenic
968050065 3:195648123-195648145 CCACAGGGTCTCCAGCTGCACGG - Intergenic
968050167 3:195648623-195648645 CCACCGGGTCTCCAGCTGCATGG - Intergenic
968097132 3:195940044-195940066 CCACCGGGTCTCCAGCTGCACGG + Intergenic
968097141 3:195940091-195940113 CCACAGGGTCTCCAGCTGCACGG + Intergenic
968097149 3:195940138-195940160 CCACAGGGTCTCCAGCTGCACGG + Intergenic
968097470 3:195941624-195941646 CCGCAGTGCCTCCAGCTGCATGG - Intergenic
968105717 3:195999918-195999940 CCACAGGGTCTCCAGCTGCATGG + Intergenic
968105737 3:196000020-196000042 CCACAGGGTCTCCAGCTGCATGG + Intergenic
968105829 3:196000449-196000471 CCACAGGGTCTCCAGCTGCACGG + Intergenic
968303940 3:197637218-197637240 CCACCGGGTCTCCAGCTGCATGG + Intergenic
968304051 3:197637765-197637787 CCACAGGATCTCCAGCTGCACGG + Intergenic
968304065 3:197637859-197637881 CCACAGGATCTCCAGCTGCACGG + Intergenic
968304073 3:197637906-197637928 CCACAGGGTCTCCAGCTGCACGG + Intergenic
968304204 3:197638548-197638570 CCACCGGGTCTCCAGCTGCACGG - Intergenic
968304248 3:197638736-197638758 CCACCGGGTCTCCAGCTGCATGG - Intergenic
968304312 3:197639017-197639039 CCGCAGTGCCTCCAGCTGCATGG - Intergenic
973386297 4:49516354-49516376 CAACAGTGTCACCGCCAGGAAGG - Intergenic
974204268 4:58680074-58680096 CTACAATGTCACCTCCTGGATGG + Intergenic
978761377 4:112358497-112358519 CCTCAGGGTCACCAGCTGCTGGG + Intronic
979222454 4:118244079-118244101 ACACAGTATCTCCACCTGCAGGG - Intronic
980485633 4:133454416-133454438 CCACAGTCACACCACCTCCCAGG + Intergenic
985506523 5:284732-284754 CCGCGGTGTCTCCAGCTGCACGG - Intronic
985741159 5:1618222-1618244 CCACCGGGTCTCCAGCTGCATGG + Intergenic
985741174 5:1618296-1618318 CCACAGGGTCTCCAGCTGCACGG + Intergenic
985741370 5:1619215-1619237 CCACAGGGTCTCCAGCTGCACGG + Intergenic
985741574 5:1620192-1620214 CCACTGAGTCTCCAGCTGCATGG - Intergenic
985741593 5:1620285-1620307 CCGCAGTGCCTCCAGCTGCATGG - Intergenic
986295794 5:6437384-6437406 CCACAGTGGCTTCACCTCCATGG - Intergenic
990237884 5:53787505-53787527 CCACAAGGTCACCACATTCATGG + Intergenic
990817030 5:59797363-59797385 CAAGAGTGCCACCACATGCATGG + Intronic
993153749 5:84195093-84195115 TCACAATGTCACCATCTGAATGG + Intronic
994117985 5:96082240-96082262 CCTCTGTGTCAGCACTTGCAAGG - Intergenic
995571993 5:113490346-113490368 GCACAGAGTCCCCACCAGCAGGG + Intergenic
995759643 5:115549748-115549770 CCAATCTGTCACCACCAGCAAGG + Intergenic
996688796 5:126314953-126314975 CAACAGTGTCACTAAGTGCAGGG - Intergenic
999327992 5:150655339-150655361 CCACAGTGTCACCCTGAGCAGGG - Intronic
999435805 5:151562460-151562482 CCTCATTGACACCACCTGCCTGG - Intronic
1000786546 5:165551531-165551553 CCTCAGTAACACCACCTACAGGG + Intergenic
1002490408 5:179572226-179572248 CCACAGCTTCACCTCCTGGAAGG - Intronic
1003311815 6:4975346-4975368 CAACAGTGGAACCACCTGGATGG - Intergenic
1003570107 6:7250458-7250480 CCTCACTGTCTCCGCCTGCAGGG + Exonic
1003838873 6:10099544-10099566 CCAGACTGTGACCACCTCCAGGG + Intronic
1006639781 6:35484062-35484084 CCCGAGTGTCACCTCCTCCAGGG + Intronic
1008487299 6:52050194-52050216 CTACAGTGTCACCTCCTGGCTGG - Exonic
1013408700 6:109865356-109865378 CCACAATGCCACCACCGGAAAGG - Intergenic
1017637144 6:156454739-156454761 GTACAGTGTCACCATCTGCTTGG + Intergenic
1017901523 6:158722098-158722120 CCTCAGTGTAGCCACTTGCAAGG - Intronic
1017981165 6:159402064-159402086 CCACAGAGACACCACATTCAGGG + Intergenic
1019067928 6:169318047-169318069 CCACAGTGGCACCAACAGCTGGG + Intergenic
1019266030 7:117850-117872 CCACAGTGGCCCCGCCGGCAGGG + Intergenic
1019277323 7:182510-182532 CCACAGTGGCCCCGCCGGCAGGG + Intergenic
1019298259 7:290308-290330 GGACAGTGACACCCCCTGCAAGG + Intergenic
1020078414 7:5273769-5273791 CCACTGTGTGACCAGCTGCTTGG + Intergenic
1021982339 7:26067025-26067047 TCACTGTATCACCTCCTGCAAGG + Intergenic
1022511377 7:30936954-30936976 CCTCAGTCTCCCCACCTGTAAGG + Intergenic
1024229707 7:47354741-47354763 CCACAGAGACCCCAGCTGCATGG - Intronic
1025200480 7:56958424-56958446 CCACTGTGTGACCAGCTGCTTGG - Intergenic
1025671464 7:63618508-63618530 CCACTGTGTGACCAGCTGCTTGG + Intergenic
1026744930 7:73004371-73004393 CCCCAGGGTCACCACCTCCCAGG - Intergenic
1027031035 7:74889038-74889060 CCCCAGGGTCACCACCTCCTAGG - Intergenic
1027098810 7:75360711-75360733 CCCCAGGGTCACCACCTCCCAGG + Intergenic
1027688004 7:81302010-81302032 CGCCCATGTCACCACCTGCATGG - Intergenic
1029160049 7:98545054-98545076 CCTCAGTGTCACCCCCAGCAAGG + Intergenic
1029399909 7:100337514-100337536 CCCCAGGGTCACCACCTCCCAGG + Intronic
1029716948 7:102333988-102334010 CCCCAGGGTCACCACCTCCCAGG - Intergenic
1030041959 7:105459686-105459708 CCACAGTCTCCCCAACTGCTGGG + Intronic
1030107027 7:105996093-105996115 CCACAGTCTCAGGGCCTGCAGGG - Intronic
1030619737 7:111775818-111775840 CCACAGAGAGACCAACTGCAGGG + Intronic
1031472331 7:122182092-122182114 CCACAGTGCCAAGACTTGCAAGG - Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037854113 8:22357889-22357911 CCAGAGTGTGTCCACTTGCAAGG + Intergenic
1038472541 8:27837651-27837673 CCAGAGTCTCACCGCCTGGAAGG + Intronic
1039775684 8:40733886-40733908 CCAAGGTGTCAGCACCTTCAGGG - Intronic
1040997583 8:53417691-53417713 CCAAAATGTAACCACCTGAATGG + Intergenic
1043013860 8:74913385-74913407 CCACACACTCACCACCTCCACGG + Intergenic
1046337246 8:112806369-112806391 CAACAGTGCCACTACCTCCAAGG - Intronic
1047266401 8:123313712-123313734 CCACTTTGTACCCACCTGCATGG + Intergenic
1047948744 8:129910041-129910063 CCATGCTGTAACCACCTGCATGG + Intronic
1049408897 8:142463770-142463792 CACCAATGTGACCACCTGCAGGG - Intronic
1049689837 8:143953609-143953631 CCACAGTGTCACCCCAGGGATGG + Intronic
1050561094 9:6834934-6834956 CCACAGTGTGCCCATCTGCGAGG + Intronic
1051910992 9:22154319-22154341 CCCCAGTGTCACCACAACCAGGG + Intergenic
1052735159 9:32334297-32334319 CCACAGCGACACCACCTGCCAGG + Intergenic
1052833499 9:33233928-33233950 CCAAAGTGCCCCCACCTGCCTGG - Intronic
1057105020 9:92406716-92406738 CCACAGTTTCACATTCTGCAAGG - Intronic
1060107389 9:120881720-120881742 GCACAGTGTCCCCTCATGCATGG + Intronic
1060212296 9:121717993-121718015 CCACAGGGAGACCACCAGCAAGG - Intronic
1060224753 9:121784002-121784024 CCACAGAGGCCCCACCTGAAGGG + Exonic
1061231197 9:129316815-129316837 CCTCAGTTTCTCCAACTGCACGG + Intergenic
1061807411 9:133144181-133144203 CCGCAGTGTCATCAGCCGCACGG + Intronic
1061919820 9:133776591-133776613 CCTCAGTTTCCCCATCTGCATGG - Intronic
1185777008 X:2811372-2811394 CAGCAGTGTCACCACCACCACGG - Exonic
1186815733 X:13236015-13236037 CCAAACTGTCATCACCAGCATGG + Intergenic
1189890542 X:45597555-45597577 CTTCAGTGTTACCACCTTCAGGG - Intergenic
1190063744 X:47226622-47226644 CCACAGTGTCACCACCTCATTGG - Exonic
1191977973 X:66894715-66894737 CCACATTGTGACCTCCTGAAGGG + Intergenic
1195070186 X:101271732-101271754 CCACAGTGTCACCAGGTGACAGG + Intronic
1195112752 X:101664126-101664148 CCACAGTCACACCACCTTTAAGG - Intergenic
1200060830 X:153483034-153483056 CCACAGTGGGACCTCCTGGATGG + Intronic
1201293000 Y:12440104-12440126 CATCAGTGTCACCACCACCATGG + Intergenic