ID: 1151744507

View in Genome Browser
Species Human (GRCh38)
Location 17:76004728-76004750
Sequence GGGTCAGTATTTTCATCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151744502_1151744507 7 Left 1151744502 17:76004698-76004720 CCTTAATCTGGTGTTGAATGAGA 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1151744507 17:76004728-76004750 GGGTCAGTATTTTCATCTTCAGG 0: 1
1: 0
2: 2
3: 11
4: 145
1151744500_1151744507 19 Left 1151744500 17:76004686-76004708 CCACATTTCTCTCCTTAATCTGG 0: 1
1: 0
2: 0
3: 32
4: 291
Right 1151744507 17:76004728-76004750 GGGTCAGTATTTTCATCTTCAGG 0: 1
1: 0
2: 2
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151744507 Original CRISPR GGGTCAGTATTTTCATCTTC AGG Intronic
900774844 1:4574903-4574925 GAGTCCATATTTACATCTTCAGG - Intergenic
902073016 1:13757928-13757950 GGGTGACTCTTTTCACCTTCTGG - Intronic
905385456 1:37600381-37600403 GGCTCAGAATATACATCTTCAGG + Intergenic
906252647 1:44322760-44322782 GGGCCAGTATTTTGAGGTTCTGG - Intronic
907952927 1:59201383-59201405 GGTTCAGTATTTCCATCCTTTGG - Intergenic
908954808 1:69610741-69610763 TGGTAAGTATATTCATCTCCAGG + Intronic
908956041 1:69628693-69628715 AGTTCAGTACTTTCATCATCTGG - Intronic
911844420 1:102732209-102732231 AGGAAAGTATTTTGATCTTCTGG - Intergenic
911960400 1:104295256-104295278 GGTTCACTATTTTCATATTAGGG - Intergenic
916194277 1:162209100-162209122 GGGTAAGATTTTTCCTCTTCTGG + Intronic
916713289 1:167430988-167431010 AGGTCAGTCTGTTCATCTTCTGG + Exonic
917064817 1:171080295-171080317 TGGTTAGTATTTCCATTTTCTGG - Intergenic
918923363 1:190745354-190745376 GGTTCTGGATTTTCAGCTTCTGG + Intergenic
921480336 1:215657875-215657897 AGGTCAGTTTTTCCTTCTTCAGG - Intronic
923994209 1:239473212-239473234 GGATCAGTATTTTCTTCTTATGG - Intronic
924351466 1:243118669-243118691 GGCTCAGTACTTTTGTCTTCCGG + Intergenic
1065633752 10:27709622-27709644 GGCACAGGATCTTCATCTTCAGG - Intronic
1068359451 10:55956903-55956925 GGCTAAGGATTTTCAGCTTCTGG + Intergenic
1068743543 10:60502243-60502265 GAGTAAGTATTTGCATCTTGTGG - Intronic
1068920460 10:62478004-62478026 GGGTGAGTATGTTCAGCTTGTGG - Intronic
1070550909 10:77489935-77489957 TGGTCAGTTGTCTCATCTTCAGG + Intronic
1074431438 10:113398282-113398304 GGGTCTGAATTCTGATCTTCTGG - Intergenic
1074681556 10:115912557-115912579 GGTTCAGTAATTTCATTTTTAGG + Intronic
1075803795 10:125170661-125170683 GGGACAGTGTATTCATTTTCTGG + Intergenic
1078579656 11:12528231-12528253 GGATCTTTATTTTCATCTTGTGG - Exonic
1079712579 11:23705033-23705055 GGGTGAGTAAGTTCTTCTTCAGG - Intergenic
1080930767 11:36807689-36807711 AGGTCACTATTTTAATCTTTAGG + Intergenic
1081760208 11:45571704-45571726 GGGTGACTATTTTCATCTGGGGG - Intergenic
1084628487 11:70328610-70328632 GGGTTGGTATTTCCATCTTTAGG + Intronic
1085989950 11:81829448-81829470 GTGTCAGTATTTTTTTTTTCAGG + Intergenic
1089601049 11:119615419-119615441 AGGATAGTATTTTCATCTTAAGG + Intergenic
1091338973 11:134795620-134795642 GGAGGAGTATTATCATCTTCTGG + Intergenic
1091338979 11:134795665-134795687 GGAGGAGTATTATCATCTTCTGG + Intergenic
1091474891 12:763041-763063 TGGTCCGTATTTTTATCTTTTGG + Intronic
1092053385 12:5489432-5489454 GAGTCAGGATTTGCACCTTCTGG - Intronic
1092175975 12:6407229-6407251 GGGACATTATTCTCATATTCTGG + Intergenic
1093451294 12:19318062-19318084 GAGTCAGGATTTTCATGTTGAGG + Intronic
1093453517 12:19341487-19341509 GTGTCAGTATTTACATCTCTGGG + Intronic
1098140064 12:67442209-67442231 GGGTAATTATTTTCATATTTTGG + Intergenic
1099543557 12:83946818-83946840 GTGCCAGTATTTTCAGTTTCTGG - Intergenic
1100267078 12:92987879-92987901 GATTCAGTCTTTTCAACTTCTGG - Intergenic
1100495491 12:95121137-95121159 GTGTCAATATTTTCATTTACAGG + Intronic
1100788093 12:98100492-98100514 AGGTCAGTATTTTCCTGTTCAGG + Intergenic
1103013418 12:117475503-117475525 GGCTCAGGATTATCATCTCCTGG + Intronic
1103156823 12:118692595-118692617 GGGTCAGTTTATACTTCTTCAGG - Intergenic
1106838149 13:33658467-33658489 TAGTTAGTATTTTCCTCTTCTGG + Intergenic
1108756280 13:53506254-53506276 TGTTCATTATTTTCAACTTCTGG + Intergenic
1109298390 13:60563352-60563374 GGGTCAGCATTTACATCTTAGGG + Intronic
1112145257 13:96692583-96692605 GTTTAATTATTTTCATCTTCAGG - Intronic
1113370876 13:109724443-109724465 AGGCCAGTGTTTTAATCTTCAGG + Intergenic
1117702751 14:58431059-58431081 GTGTCAGAATTTTCTTCTTAAGG + Intronic
1118702860 14:68451028-68451050 TGGTCAGTATTCTCAGCTTCAGG + Intronic
1119161942 14:72459931-72459953 TGGTCAGTATGTTCATCTTGGGG + Intronic
1119364355 14:74079103-74079125 TGGCCAGTATTTTCCTCTTCAGG + Intronic
1120038629 14:79727469-79727491 GGGACAGTAATTGCAACTTCAGG + Intronic
1120633772 14:86925877-86925899 GAGTCAGGATGTTCATCATCAGG - Intergenic
1125177241 15:36838452-36838474 GGGTCTTTATTTTTATCCTCAGG - Intergenic
1125351534 15:38772384-38772406 GGGTCAGTCTTGTCATGCTCTGG - Intergenic
1126627653 15:50700529-50700551 TGGTCATTGTTTTCATTTTCTGG + Intergenic
1127618752 15:60712875-60712897 GAGATAGTATTTTCATCTTCAGG - Intronic
1133042789 16:3069345-3069367 GTGTCAGTATCTTCATTTTGAGG - Exonic
1133044831 16:3081987-3082009 GTGTCAGTATCTTCATTTTGAGG - Intronic
1141783310 16:86179920-86179942 GGGGCAGTATTTTCATCTTGCGG + Intergenic
1143840731 17:9729242-9729264 GGGTCAGTATTACCAGTTTCAGG + Exonic
1148319493 17:46738530-46738552 GGGTCAGTATTTTCATGGGTGGG + Intronic
1148961049 17:51393099-51393121 GCAACAGTATTTTCATCTTTAGG + Intergenic
1149958728 17:61082845-61082867 TAATCAGTATTTTCACCTTCCGG + Intronic
1149967917 17:61185921-61185943 TAGTCAGTATTTTCAACTTGAGG - Intronic
1151464923 17:74278530-74278552 TGGTCAGTCTTTACATATTCTGG + Intronic
1151744507 17:76004728-76004750 GGGTCAGTATTTTCATCTTCAGG + Intronic
1152498054 17:80688449-80688471 GGTTCAGTATTGTCAGGTTCTGG + Intronic
1156126045 18:33906150-33906172 GGTACACTATTTTTATCTTCTGG - Intronic
1160806347 19:993831-993853 GGGTCAGGGTTGTCATCTGCAGG + Intronic
1163919371 19:20274469-20274491 GGGTCAGTTTTTTTGTCTTTTGG + Intergenic
926051174 2:9745809-9745831 GGATCATTGTTTTCTTCTTCAGG - Intergenic
928951753 2:36819487-36819509 GGGTCAAAGTTTTCATTTTCTGG - Intergenic
930152497 2:48072967-48072989 GTTTCTGTATATTCATCTTCTGG + Intergenic
931086276 2:58834161-58834183 GGCTCAGTATTTTCTACTTGAGG - Intergenic
931981064 2:67694688-67694710 GGGTCAGCACTTTCCTCTGCGGG + Intergenic
936045709 2:109186327-109186349 GCCTCAGCATTTTCATCTGCAGG - Intronic
936264211 2:110988436-110988458 GGGTCAGTATTTTTTTTTTTAGG - Intronic
937977441 2:127590151-127590173 TGGTCAGGATTTTCATCAGCTGG - Exonic
938555955 2:132424477-132424499 AGGTCAGTAATTCCATCCTCTGG - Intronic
938682897 2:133710412-133710434 TAGTCTGTATTTTCTTCTTCAGG - Intergenic
941059770 2:160833353-160833375 GGGTCAGTAACAACATCTTCAGG - Intergenic
946024446 2:216663637-216663659 GACTGAGTCTTTTCATCTTCGGG + Intronic
1169995033 20:11546817-11546839 GGGCCCGTATTTGCATCCTCAGG + Intergenic
1175567859 20:59994981-59995003 TGCTCAGCATGTTCATCTTCTGG - Intronic
1175993145 20:62799449-62799471 TTCTCAGTTTTTTCATCTTCAGG + Exonic
1177552469 21:22643363-22643385 TTTTCAGTATTTTCATTTTCAGG - Intergenic
1179052383 21:37898740-37898762 GCCTCAGTATTTCCATCTGCAGG + Intronic
1179842101 21:44083587-44083609 GGGTGTGTATTTTCATATGCAGG - Intronic
1182737852 22:32543778-32543800 GGAAGATTATTTTCATCTTCAGG - Intronic
949494481 3:4619237-4619259 GGGTCTGTATTTTCTTATGCTGG + Intronic
950879770 3:16313838-16313860 GTGTCAGTATTTTGACCTTGTGG + Intronic
952487457 3:33828831-33828853 TGGTCAGTATTTTTATTTCCAGG + Exonic
952488963 3:33847080-33847102 GGGTCTGCAGTTTCTTCTTCAGG - Intronic
952729995 3:36628674-36628696 GGGGCAGAATCTTCCTCTTCTGG + Intergenic
953700090 3:45189026-45189048 GAGTCAGTATTAAGATCTTCTGG + Intergenic
955954819 3:64277988-64278010 GTGTCAGTATTTGCATTTTCTGG + Intronic
956629114 3:71297394-71297416 GGGACTGTATTTCCATTTTCAGG + Intronic
959184407 3:103027587-103027609 GGATCAGTTTTTTAAACTTCTGG + Intergenic
959334790 3:105050422-105050444 GTGTCAGCATTTTAATCTTAGGG - Intergenic
960694101 3:120378992-120379014 TGGTCAGGTTTTTCAACTTCTGG + Intergenic
961517668 3:127448313-127448335 GGGGCTGTATTTTCACCTTGAGG - Intergenic
961986183 3:131137580-131137602 GTGTCAGTATTTTCATCCAATGG + Intronic
966212094 3:177463961-177463983 GGGCCTCTATTTTCATCTCCCGG + Intergenic
966389678 3:179438862-179438884 GGGCAAGTATTTAAATCTTCAGG - Intronic
967995036 3:195160096-195160118 GGCTCACTATTTTTTTCTTCTGG - Intronic
974345357 4:60673309-60673331 GGGTCTGTTTTATCATCATCTGG + Intergenic
975347984 4:73315682-73315704 GGGACAATATTCTCATATTCTGG - Intergenic
977419313 4:96777766-96777788 TGGTCAGTGTTTTCATCCTTGGG - Intergenic
979250473 4:118561864-118561886 GGTTCAGTACTTTTGTCTTCTGG - Intergenic
981156172 4:141438922-141438944 GGCTCATTTTCTTCATCTTCTGG + Intergenic
981581631 4:146254660-146254682 GGATCAGTATTTTAATGTTAGGG + Intronic
982596616 4:157393871-157393893 GGGTCAGCAATTTTTTCTTCTGG - Intergenic
982882673 4:160739860-160739882 GTGTCAGTAGTTTGACCTTCTGG + Intergenic
986405096 5:7417929-7417951 ATGACTGTATTTTCATCTTCAGG + Intronic
991503980 5:67305458-67305480 GCGGCAGTATTGTCATCTCCTGG - Intergenic
993221098 5:85098146-85098168 GGGTCATTATTTTCATCTGATGG + Intergenic
996146022 5:119977442-119977464 TGGTCAGGTTTTTCATCTTTTGG - Intergenic
996188290 5:120506932-120506954 GGGTCAGTATTTTAGCTTTCTGG + Intronic
996446304 5:123555779-123555801 GGGTCAGTATTTTTATCCTAAGG + Intronic
999151564 5:149429741-149429763 AGGCCAGAATTTTTATCTTCAGG - Intergenic
999983496 5:156980555-156980577 AGGAAAGTATTTTCCTCTTCAGG - Intergenic
1002431249 5:179205424-179205446 GGGCCAGTGTTTTCATCGTGGGG - Intronic
1003334997 6:5162399-5162421 GGGTCAGTAGTGTCATCCTTCGG - Intronic
1012613085 6:101240262-101240284 GGGACAGTGTTTTTCTCTTCAGG + Intergenic
1013495176 6:110690557-110690579 GGGTGACTATTTTAAGCTTCAGG - Intronic
1013748562 6:113374459-113374481 TGATCAGCATTTTCATCTTTGGG + Intergenic
1015512873 6:134057032-134057054 AGGTTAGTATTGTCATATTCTGG - Intergenic
1016328623 6:142932166-142932188 GAGTCACTATTCTCATCATCAGG - Intronic
1021524936 7:21576434-21576456 GAGTCAGTATTAAGATCTTCTGG - Intronic
1024111519 7:46152091-46152113 AATTCAGTATTATCATCTTCTGG + Intergenic
1024974770 7:55103122-55103144 GTTTCAGTATTTTCTTCCTCAGG + Intronic
1026100331 7:67378891-67378913 GGTTCAGTGTTGTCCTCTTCAGG + Intergenic
1027805534 7:82816868-82816890 AGGTCAGTGAATTCATCTTCAGG + Intronic
1031060262 7:117043879-117043901 AGATCATTATCTTCATCTTCAGG - Intronic
1038447873 8:27616178-27616200 GGGACATTTTTTTCTTCTTCTGG - Intergenic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1041778885 8:61555807-61555829 TGCTGAGTATTTTCATCCTCAGG - Intronic
1044056246 8:87572897-87572919 GTGTCAGACTTTTCATCCTCAGG - Intronic
1044693985 8:94904897-94904919 GGGTTAAAATTTTCTTCTTCTGG + Intronic
1046750395 8:117920707-117920729 GGGTCAGCATTATCATCTTCGGG + Intronic
1049452225 8:142668331-142668353 GGGTGAGTACTGTCCTCTTCCGG + Intronic
1055748846 9:79481680-79481702 AGGCCAGAATTCTCATCTTCTGG - Intergenic
1057244863 9:93446326-93446348 GGGCTAGTGTTTTCATATTCTGG + Intergenic
1057383220 9:94587255-94587277 GGCTCAGTATCATCATCTACTGG + Intronic
1057435979 9:95040841-95040863 GGATCAATATTTTTATCTTTGGG - Intronic
1058405604 9:104669929-104669951 GGGTCAGGAATGACATCTTCAGG - Intergenic
1059031493 9:110702423-110702445 GGGCCAGAAATTCCATCTTCAGG + Intronic
1187601752 X:20839205-20839227 GGGTCCGTGGCTTCATCTTCTGG + Intergenic
1187744722 X:22396237-22396259 AAGTCAGCATTTTTATCTTCAGG - Intergenic
1189625017 X:42887803-42887825 GATTCAGTAATTTCATGTTCTGG - Intergenic
1190404620 X:50074306-50074328 GGGACAGCATTTTATTCTTCAGG + Intronic
1194047921 X:89032843-89032865 GGCTCAGTATTTTGTTTTTCTGG + Intergenic
1196644866 X:118107012-118107034 GCTTCAGTATTTTCTTCTTTGGG + Intronic
1199656912 X:150005543-150005565 GTGTCAGAATATTCATCTTTGGG + Intergenic
1200433958 Y:3124219-3124241 TGGTCATTTTTTTCATCCTCGGG - Intergenic