ID: 1151746631

View in Genome Browser
Species Human (GRCh38)
Location 17:76015102-76015124
Sequence CGCTGGCGCTGCAGGAGGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 362}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151746621_1151746631 14 Left 1151746621 17:76015065-76015087 CCGCAGCACGCAGGTCTGCTGTT 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1151746631 17:76015102-76015124 CGCTGGCGCTGCAGGAGGAGGGG 0: 1
1: 0
2: 3
3: 27
4: 362
1151746623_1151746631 -9 Left 1151746623 17:76015088-76015110 CCAGCAGCTCCCTCCGCTGGCGC 0: 1
1: 0
2: 3
3: 25
4: 330
Right 1151746631 17:76015102-76015124 CGCTGGCGCTGCAGGAGGAGGGG 0: 1
1: 0
2: 3
3: 27
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151746631 Original CRISPR CGCTGGCGCTGCAGGAGGAG GGG Exonic
900217672 1:1490340-1490362 ACCTGCCGCAGCAGGAGGAGCGG + Exonic
900622793 1:3595085-3595107 TGCTGGCTCTGCCGGAGGACAGG - Intronic
900624642 1:3602654-3602676 GGCTGGGGGTGCAGGAGGGGTGG - Intronic
900642325 1:3693712-3693734 GGCTGGGATTGCAGGAGGAGGGG - Intronic
900642622 1:3694696-3694718 GGCTGGGATTGCAGGAGGAGGGG - Intronic
900642641 1:3694766-3694788 GGCTGGGATTGCAGGAGGAGGGG - Intronic
900642660 1:3694837-3694859 GGCTGGGATTGCAGGAGGAGGGG - Intronic
900642689 1:3694942-3694964 GGCTGGGATTGCAGGAGGAGGGG - Intronic
901027207 1:6284994-6285016 CGTTGGCTCTGCAGGAGTGGAGG - Intronic
901050790 1:6424966-6424988 AGCAGGCGCTGCAGGCGGCGCGG + Exonic
902920672 1:19664783-19664805 CCCTGGCCCTGCAGGAGGGCGGG - Intergenic
903179823 1:21599550-21599572 TGCTGGCACTGGACGAGGAGCGG + Exonic
903285183 1:22272636-22272658 GGCTGGGCCTGCAGGAGGGGAGG + Intergenic
903455428 1:23483999-23484021 CGCTGGCGCGGGAGGAGGTGAGG - Exonic
904937331 1:34140943-34140965 GGCTGGGGCTGCAGGAAGTGAGG - Intronic
905643794 1:39610286-39610308 GGCCCGCGCTGCAGGAGCAGAGG - Intergenic
905862632 1:41361469-41361491 AGCTGGCGCTGGAGCCGGAGCGG + Intergenic
906147596 1:43569227-43569249 TGCTGGGGCTGCAGGGGGTGGGG - Intronic
906517300 1:46447391-46447413 AGCTGGCGCTGGAGGTGGGGAGG - Intergenic
907091408 1:51729483-51729505 CGCCGGCGCTGCTGGGGGAAAGG - Intronic
907480711 1:54743918-54743940 CTCTGGCCCTGCTGGGGGAGGGG - Intergenic
907492504 1:54817131-54817153 AGCTGGAGCTGCAGGCGAAGGGG + Intronic
908563544 1:65331171-65331193 CCCTGGAGCTGAAGAAGGAGGGG - Intronic
911275457 1:95853377-95853399 CCCTGAGGCTGCAGGGGGAGGGG - Intergenic
912609127 1:111025269-111025291 TGCGGCCTCTGCAGGAGGAGTGG - Intergenic
914349803 1:146831268-146831290 CTCTGTCCCTCCAGGAGGAGAGG + Intergenic
915606398 1:156954605-156954627 AGCTGTCCCTGCAGGAGAAGGGG + Intronic
916143924 1:161723459-161723481 GGCTGGAGCTCCAGGAGCAGTGG - Exonic
917081109 1:171257865-171257887 CACTGGTGCTGCATGAGGGGCGG + Intronic
919806925 1:201385884-201385906 CCCAGGAGCTGCAGGAAGAGGGG + Intronic
920194038 1:204214135-204214157 GGCAGGCGCGGCAGGTGGAGGGG - Intergenic
920435155 1:205942603-205942625 CCTTGGAGCTGCAGGATGAGGGG + Intronic
922314844 1:224434042-224434064 CGGCGGCGGTGGAGGAGGAGGGG - Exonic
922357118 1:224786888-224786910 ATTTGGAGCTGCAGGAGGAGGGG - Intergenic
923163580 1:231338406-231338428 CACTGCGGCTTCAGGAGGAGTGG + Exonic
923318503 1:232805481-232805503 CGCTGGAGCTGCTGGTGGACTGG + Exonic
924031546 1:239890241-239890263 CGGTGAGGCTGCAGGAGGTGAGG + Intronic
1062985630 10:1766055-1766077 GGCTGGCCATGCAGGAGGACTGG - Intergenic
1063137573 10:3230496-3230518 CGCTGGAGGTGCAGGCGCAGAGG + Intergenic
1063377432 10:5562410-5562432 CACTGGGGCTCCAGGAGCAGTGG - Intergenic
1065771624 10:29083521-29083543 CGCTGGCTCTGCAGCTGTAGCGG + Intergenic
1068335337 10:55627660-55627682 CGCTGCTGCTGAAGGAGCAGAGG - Intronic
1070604345 10:77888331-77888353 CGCAGGGGCTGCAGGAGAGGTGG - Intronic
1070870663 10:79748698-79748720 AGCTGGCACTGAAGGGGGAGAGG + Intergenic
1070974525 10:80595739-80595761 CTCTGGTACTCCAGGAGGAGAGG - Intronic
1071416555 10:85447090-85447112 TGGTGGTGCTGCAGGAGGGGTGG - Intergenic
1071847428 10:89535364-89535386 CGTTGGAGCTGGAGGAGGACGGG - Intronic
1073429253 10:103475751-103475773 TGCTGGGGCTGTAGGAGCAGTGG + Intronic
1073850608 10:107612986-107613008 GCCTGGTGCTGCAGGAAGAGGGG - Intergenic
1074532289 10:114305802-114305824 CGTCGGGGCTGCAGGAGGGGAGG + Intronic
1075108955 10:119562286-119562308 GGCTTGCCCTACAGGAGGAGAGG - Intergenic
1076885221 10:133259018-133259040 AGCTGGCCGTGCAGGGGGAGGGG + Intergenic
1077074666 11:694939-694961 CGCGGCCGCGGCAGGAGGCGAGG - Exonic
1077375359 11:2203048-2203070 CGATGGCTCTGCAGGTGAAGGGG - Intergenic
1079304773 11:19312336-19312358 AGCTGAGGCTGCAGGAGGTGAGG - Intergenic
1080600657 11:33818585-33818607 AGGTGGCTTTGCAGGAGGAGAGG - Intergenic
1081866264 11:46362164-46362186 CTCTGGGGCTGCTGGAGGTGGGG + Intronic
1082854162 11:57791558-57791580 CCCGGGCGCTGGAGGAGGAACGG + Exonic
1083660643 11:64250490-64250512 AGCTGGCTCTGGGGGAGGAGGGG - Intergenic
1084362638 11:68678747-68678769 TTCTGGAGCTGAAGGAGGAGGGG - Intergenic
1084607800 11:70182600-70182622 CACTGACGTTGAAGGAGGAGAGG - Exonic
1084644330 11:70445874-70445896 GGCTGGCGCAGCAGAGGGAGGGG + Intergenic
1089460099 11:118647952-118647974 GGCAGGCCCTGGAGGAGGAGCGG + Exonic
1089523506 11:119081444-119081466 CACTTGAGCTGCAGGAGAAGAGG - Exonic
1090072922 11:123560066-123560088 CGCTGGGGCTGCGGGGGGGGGGG - Intronic
1091216997 11:133908199-133908221 GGCTCACGCTGCAGGAGTAGAGG - Intergenic
1091264740 11:134261808-134261830 CAGTGGCTCTGCAGGAGGAGAGG + Exonic
1091922199 12:4314083-4314105 GGCTGGAGCTGGATGAGGAGGGG + Intergenic
1091937237 12:4443699-4443721 CTCGTGCGCAGCAGGAGGAGTGG - Intronic
1092126035 12:6075544-6075566 CACAGGCCCTGCAGGAAGAGGGG + Exonic
1092181840 12:6451609-6451631 CGCCTGCGCTGCAGGAGGGCGGG + Exonic
1093547787 12:20368859-20368881 CGCTGACGCTGGAGGAGCCGGGG - Intergenic
1095955496 12:47803404-47803426 GGCAGGCGCTGCTGGGGGAGGGG + Intronic
1096409292 12:51365506-51365528 GGGTGGTGCGGCAGGAGGAGCGG - Exonic
1096683504 12:53272650-53272672 TGCTGCCTCTCCAGGAGGAGAGG + Intronic
1099925272 12:89009278-89009300 CGTTGGCTCTACAGGAGAAGAGG - Intergenic
1101436540 12:104669216-104669238 AGCTGGCGGGGCAGGAGAAGGGG - Intronic
1102261823 12:111447641-111447663 CGCAGGTGCTGTGGGAGGAGAGG - Exonic
1103614436 12:122143187-122143209 CCCAGGCCCTGCAGGAAGAGAGG - Exonic
1104803554 12:131570824-131570846 AGCTGTGGCTCCAGGAGGAGAGG - Intergenic
1105327305 13:19382321-19382343 CGCTGCCCCTGCGGAAGGAGAGG - Intergenic
1105413519 13:20191339-20191361 ATATGGGGCTGCAGGAGGAGGGG + Intronic
1107851386 13:44576466-44576488 CGCCGACGCGGCGGGAGGAGGGG - Exonic
1108280453 13:48856087-48856109 CCATGGCACTGCAGGAGGAGAGG - Intergenic
1112091861 13:96091035-96091057 CTCAGGCGCCGCCGGAGGAGTGG + Exonic
1112734472 13:102400944-102400966 CGCGGGGGCTGACGGAGGAGCGG + Intronic
1113633987 13:111907538-111907560 CCCTGGTGGTGCAGAAGGAGAGG + Intergenic
1113877280 13:113602201-113602223 CGCAGGAGCTGAGGGAGGAGCGG + Intronic
1113944491 13:114036211-114036233 CGCTGGCCCTGCATCAGGGGAGG + Intronic
1114670999 14:24411017-24411039 GGCTGGCTCTGAGGGAGGAGTGG + Intronic
1115028604 14:28768338-28768360 CGTTGGCGGTGGAGAAGGAGTGG - Exonic
1116886989 14:50231480-50231502 TGCGGGCGCTGCGGGAGGCGAGG - Exonic
1117305556 14:54470013-54470035 CTCTGGGGTTGGAGGAGGAGGGG - Intergenic
1118259503 14:64234304-64234326 CCCTGGAGCTGGAGGAGGGGAGG - Intronic
1118352296 14:64981710-64981732 CTCTGAGGCTGCAGCAGGAGAGG + Intronic
1118723016 14:68607817-68607839 GGCTGGCAATGTAGGAGGAGGGG + Intronic
1118973737 14:70659525-70659547 AGCAGCCGCAGCAGGAGGAGGGG + Intronic
1120499606 14:85278689-85278711 GGCAGGTGCTGCGGGAGGAGTGG + Intergenic
1121310394 14:92932532-92932554 AGCTGGAGCAGGAGGAGGAGCGG + Exonic
1121634297 14:95443272-95443294 TGCAGGGGCTGCAGGAAGAGGGG - Exonic
1121847058 14:97181020-97181042 GGCTGGCTCTGCGGGAGGAAGGG - Intergenic
1121988108 14:98528138-98528160 CGCCTGCCCTGTAGGAGGAGTGG - Intergenic
1122205294 14:100145258-100145280 CTCAGGCACAGCAGGAGGAGCGG + Exonic
1122996692 14:105268995-105269017 AGCTGGGGCTGCAGGAGGCGAGG + Intronic
1124372034 15:29109535-29109557 CGCTGGCACTGCAGGAAGAGAGG + Intronic
1124881460 15:33646473-33646495 GGCTGTGGCTGAAGGAGGAGTGG - Exonic
1124971136 15:34490520-34490542 CGGTGGCGGTGGAGGAGGCGGGG - Intergenic
1127867262 15:63042789-63042811 CCCTGGGGCTGCAGCAGGAGCGG - Exonic
1129321107 15:74775487-74775509 CTCAGACCCTGCAGGAGGAGAGG - Intergenic
1131054198 15:89365928-89365950 TCCTGGAGCTGCAGGAGGAGGGG + Intergenic
1132549709 16:549299-549321 CCCTGGCGGTGCTGGCGGAGCGG + Exonic
1132652721 16:1028881-1028903 CCCAGGCTCTGCAGGAAGAGGGG - Intergenic
1132777901 16:1606088-1606110 CGCTGGCTCTGAAGGCTGAGGGG - Intronic
1132866281 16:2094159-2094181 CGCTGGCGCTGCAGAGGCTGGGG - Exonic
1133236949 16:4391913-4391935 CGCAGGGGGTGCAGGAGGGGAGG + Intronic
1133810042 16:9154658-9154680 TGCTTGTGATGCAGGAGGAGGGG + Intergenic
1134588654 16:15434510-15434532 CGCTGGCGGCGGCGGAGGAGAGG + Exonic
1136139249 16:28278176-28278198 CGGAGGAGCTGCAGGAGAAGCGG - Intergenic
1136402182 16:30024950-30024972 CCCTTGCGCTGGAGGAGGGGAGG - Exonic
1136429166 16:30186941-30186963 TGCAGGTGCTGCGGGAGGAGGGG + Exonic
1137531585 16:49281810-49281832 AGCCGGCGCTGCAGCCGGAGCGG + Exonic
1137580594 16:49631432-49631454 GGCTGAAGCTGCAGGAGGAGGGG - Intronic
1137665302 16:50246110-50246132 CGCGGGCGGGGAAGGAGGAGCGG - Intergenic
1138693532 16:58790721-58790743 CACCGGGGCTGCAGGTGGAGTGG + Intergenic
1139593881 16:67947354-67947376 CGCTGTTGCGGCTGGAGGAGGGG - Exonic
1139984233 16:70884263-70884285 CTCTGTCCCTCCAGGAGGAGAGG - Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141734030 16:85840396-85840418 TGCTGGGACTGCAGGAAGAGGGG + Intergenic
1142255798 16:89013301-89013323 AGCTGGGGCTGCAGGAGGCGGGG + Intergenic
1142259293 16:89035073-89035095 CTTTGTTGCTGCAGGAGGAGAGG - Intergenic
1142387433 16:89774768-89774790 CCCTGGCCCTGCAGGTGGAAGGG + Intronic
1142410245 16:89912346-89912368 TGCTGCAGCTGCAGGAGGGGCGG + Intronic
1142596322 17:1031667-1031689 CCCTGGCGCTGGAGGAGTCGGGG - Intronic
1142756428 17:2019064-2019086 GGCTAGGGCTGCAGGAGCAGAGG - Intronic
1142779871 17:2173278-2173300 GGCTGTGGCTGGAGGAGGAGAGG - Intronic
1142903244 17:3026389-3026411 TGCTGGTGCTGGAGGAGGAGCGG - Exonic
1143078727 17:4366186-4366208 CGCTGGCCCGGGAGGAGAAGAGG + Intronic
1143471227 17:7177319-7177341 AGGTGGCCCTGCAAGAGGAGGGG + Exonic
1143618540 17:8067953-8067975 CGCTGGTGCAGCAGGATCAGGGG - Intergenic
1144788607 17:17845349-17845371 CGCTGGCGCTGGAGCTGGAGCGG + Intronic
1144955502 17:19017020-19017042 AGCTGGCGCAGCAGGAGGCCAGG - Intronic
1145190577 17:20840697-20840719 CGGTGGCGGTGCAGGAGGCCGGG + Intronic
1147378600 17:40038377-40038399 AGCTGTCTCTGCTGGAGGAGTGG + Intronic
1147763671 17:42818325-42818347 AGCTGGCACTAGAGGAGGAGAGG - Exonic
1147969255 17:44210864-44210886 GGCGGCAGCTGCAGGAGGAGCGG - Exonic
1148148067 17:45378586-45378608 CTCAGGCACTGGAGGAGGAGAGG - Intergenic
1148454888 17:47805879-47805901 CGCTGTTGCTGCAGGTGGTGGGG + Intergenic
1148909229 17:50931650-50931672 CGCGGGGGCCGCAGGAGGTGGGG + Intergenic
1148910650 17:50940609-50940631 TGCTTGGGCTGCTGGAGGAGCGG - Intergenic
1149660795 17:58333071-58333093 GGCTGAGGCTGCAGGAGGGGTGG - Intergenic
1149939746 17:60851274-60851296 AGCTCGGGCTGCAGGAGGAGTGG + Intronic
1150131558 17:62671977-62671999 CTCTGGGGGTGCAGCAGGAGAGG - Exonic
1151323597 17:73365867-73365889 CCCTGGAGCCCCAGGAGGAGAGG - Intronic
1151383962 17:73743980-73744002 AGCTGTCGCTGCAGTGGGAGGGG - Intergenic
1151712211 17:75813285-75813307 CACTGGCTCTCCGGGAGGAGGGG + Intronic
1151746631 17:76015102-76015124 CGCTGGCGCTGCAGGAGGAGGGG + Exonic
1152550087 17:81025175-81025197 GGCTGGAGGTGCTGGAGGAGAGG - Intergenic
1152923981 17:83079405-83079427 GGGGGGCGCTGCAGGAGGAGGGG - Intergenic
1153631025 18:7069801-7069823 CTCTGGGGCAGCTGGAGGAGGGG - Intronic
1154049028 18:10935794-10935816 TGCTGGCGAGGCAGGAGCAGGGG - Intronic
1155231434 18:23778776-23778798 CCGTGGCGCTGCAGGAGGAGGGG - Intronic
1157516692 18:48316347-48316369 GGCTGGGGGTGGAGGAGGAGTGG - Intronic
1158894603 18:61901175-61901197 AGCTGGAGCAGCAGGAGGGGAGG - Intergenic
1160074115 18:75655584-75655606 AGCTGCCTCTGGAGGAGGAGCGG + Intergenic
1160354546 18:78216022-78216044 CACTGACACTGGAGGAGGAGAGG - Intergenic
1160510024 18:79448245-79448267 CCCTGCCTCTGCAGGAGGAGAGG + Intronic
1160526188 18:79539531-79539553 AGCTGCAGCTGCTGGAGGAGGGG - Intergenic
1160688706 19:450161-450183 AGCCGGCGCTACAGGAGGGGGGG + Intronic
1160996738 19:1885441-1885463 CGGTGGCGGTGCAGGAGGCCGGG - Intronic
1161156236 19:2733114-2733136 CCCTGGGCCTGCAGGAGGAGGGG - Exonic
1161199284 19:3005657-3005679 CGCTCTCGGTGCAGGGGGAGTGG - Intronic
1161252152 19:3285995-3286017 TGCTGCTGCTGCAGGAGGGGCGG - Exonic
1161252153 19:3285998-3286020 CGCTGCTGCTGCTGCAGGAGGGG - Exonic
1161307688 19:3577009-3577031 AGCTGGCGCTGGAGGAGCGGAGG + Exonic
1161317362 19:3623880-3623902 GGCTGCGGCTGCGGGAGGAGCGG - Exonic
1161422636 19:4184291-4184313 CACTGGAGCTGCAGGAGGTAGGG + Intronic
1161477393 19:4494151-4494173 CGCTGTCACTGGAGGCGGAGGGG - Exonic
1162744540 19:12791276-12791298 CGGCGGGGCTGCAGGGGGAGGGG - Intronic
1163766269 19:19165124-19165146 TGCTGGGGATGCAGGAGCAGGGG + Intronic
1164400042 19:27896065-27896087 CCCAGGAGCTGCAGGAGAAGGGG + Intergenic
1165992999 19:39826687-39826709 AGCTGGCGGTGCTGGAAGAGGGG + Exonic
1166201263 19:41239198-41239220 CCCTGGAGCTGCAGGGGGACGGG + Exonic
1166297149 19:41894902-41894924 CCCTGGCTCTGAGGGAGGAGGGG + Intronic
1166373820 19:42316184-42316206 CCCTGGGTCTGAAGGAGGAGGGG + Intronic
1166703986 19:44898192-44898214 CTCTGGAGCTGCAGGAATAGGGG - Intronic
1166951675 19:46432617-46432639 CGCTAGGGTTGCTGGAGGAGGGG - Intergenic
1167327647 19:48835494-48835516 CCCTGGGTCTGAAGGAGGAGGGG + Intronic
1167561058 19:50226505-50226527 CCCTGGGTCTGAAGGAGGAGGGG + Intronic
1167561073 19:50226542-50226564 CCCTGGGTCTGAAGGAGGAGGGG + Intronic
1167571601 19:50292373-50292395 TGCTGCGGCTGCAGGAGGTGAGG + Exonic
1167603761 19:50469154-50469176 GGCTGGAGGTGCAGGAGGTGAGG - Intronic
1167678716 19:50906480-50906502 CGCTGGGTCTGAGGGAGGAGGGG + Exonic
1168092618 19:54095758-54095780 CCCTGGGTCTGAAGGAGGAGAGG + Exonic
1168245913 19:55113172-55113194 TCCTGGCTCTGAAGGAGGAGGGG - Intronic
1168298271 19:55388496-55388518 GGCTGGCCATGCAGGAGGGGTGG + Intronic
925928177 2:8685367-8685389 CGCTGGCGCTGGAGGAGGGCGGG + Intergenic
928815797 2:35293112-35293134 CCCTGGCTTTGCAGGAGGACTGG - Intergenic
929150949 2:38748585-38748607 CGCTCACGCAGCAGGAGCAGGGG - Exonic
931289554 2:60860544-60860566 GGCTGGGGGAGCAGGAGGAGTGG - Intergenic
932283400 2:70513627-70513649 TGGTGGGGCTGCAGGAGCAGTGG + Intronic
935190434 2:100773722-100773744 CACTGGGGCTGCAGGAGGGATGG - Intergenic
935946260 2:108289347-108289369 AGCTGGCCCTGGAGGAGGATGGG - Intronic
937055065 2:118927676-118927698 TGCTGCCTATGCAGGAGGAGTGG + Intergenic
937217143 2:120319986-120320008 TGCTTGGGCTGCAGGAGTAGTGG + Intergenic
937596917 2:123684184-123684206 CACCGGGGCTGCAGGTGGAGCGG - Intergenic
941818794 2:169825015-169825037 CGCAGGCTTTGCAGGCGGAGGGG - Intergenic
942446606 2:176082503-176082525 CGCTGGCGCTGCGCGCGGATCGG + Intronic
943360131 2:186909358-186909380 CGCTGGAACTGCAACAGGAGAGG - Intergenic
944154216 2:196593502-196593524 CGCCGGCGCGGCTGGAGGTGAGG - Intronic
945043712 2:205763809-205763831 GGGTGGCGCTGCAGGTGGTGCGG + Exonic
946441934 2:219704148-219704170 AGCTGGTGCTGGCGGAGGAGAGG + Intergenic
948119534 2:235518874-235518896 CTCTTCCGCTGCAGGAGCAGCGG - Intronic
948213902 2:236214839-236214861 CGCAGGCGCTGCTGGAGCACGGG - Exonic
948408254 2:237739267-237739289 AGCTGGCCCTGGAGGAGGCGCGG - Intronic
948526818 2:238575935-238575957 CGCAGTGGCTGAAGGAGGAGGGG - Intergenic
948723567 2:239918579-239918601 GGCTGCCACTGCAGGAGGGGAGG - Intronic
948835114 2:240622682-240622704 AGCTGGAGAAGCAGGAGGAGGGG + Intronic
948914957 2:241029894-241029916 GGCTGGGGCCGCAGGAGGCGAGG - Intronic
1169206819 20:3745303-3745325 AGCTGGGGTTGCAGGAGGGGTGG + Intronic
1170698126 20:18678762-18678784 TGCTGGCAATGCAGGAGGAAGGG - Intronic
1171255916 20:23688994-23689016 AGCTGGAGCTGCAGGAGAGGAGG + Exonic
1171263264 20:23750891-23750913 AGCTGGAGCTGCAGGAGAGGAGG + Exonic
1171266545 20:23776194-23776216 AGCTGGAGCTGCAGGAGATGAGG + Intergenic
1171272332 20:23826685-23826707 AGCTGGAGCTGCAGGAGAGGAGG + Exonic
1172511352 20:35503345-35503367 AGCTGATGCTGCAGAAGGAGAGG + Exonic
1173101371 20:40091815-40091837 AGCTGGAGCTGGAGGAGCAGGGG + Intergenic
1174834366 20:53842114-53842136 GGCTGGCAGGGCAGGAGGAGTGG + Intergenic
1174904586 20:54537040-54537062 CACTGGTTCTGCAGTAGGAGTGG - Intronic
1175381758 20:58568602-58568624 TGCTGGTGCTGCTGCAGGAGGGG + Intergenic
1176020249 20:62959009-62959031 TGCAGGAGCTGGAGGAGGAGGGG + Intronic
1176073794 20:63239436-63239458 TGCGGCGGCTGCAGGAGGAGAGG + Exonic
1176238596 20:64065577-64065599 CGGTGGAGCTGCAGGTGCAGAGG + Intronic
1176376912 21:6091408-6091430 CGGTGGCGCGGCGGGAGGCGTGG + Intergenic
1179558388 21:42195086-42195108 GGCAGGCGCTGCAGGAGCATGGG + Intergenic
1179746563 21:43446836-43446858 CGGTGGCGCGGCGGGAGGCGTGG - Intergenic
1179798564 21:43799703-43799725 CGCTTGCTCTGGAAGAGGAGGGG + Intronic
1179911806 21:44454922-44454944 CGCTGGAGCTGGAGCAGAAGGGG + Intergenic
1179993099 21:44958760-44958782 CGCTGCTCCTGCAGGAGGAGAGG - Intronic
1180225527 21:46389900-46389922 CTCTGGCGCTGGAGGAGATGTGG + Intronic
1180614710 22:17119962-17119984 CGCTGGGGCTGCAGCAGCAGGGG + Exonic
1180875840 22:19174984-19175006 CCCTGGGGCAGCAGGAGGTGGGG - Intergenic
1181040978 22:20192499-20192521 TGCTGGAGGTGCAGGGGGAGGGG + Intergenic
1181044506 22:20208158-20208180 AGCTGGCACTGGAGGACGAGTGG - Intergenic
1181121706 22:20671293-20671315 CGGTGGCGGTGCAGGAGGCCGGG - Intergenic
1181334674 22:22118333-22118355 CGGTGGCGGTGCAGGAGGCCGGG - Intergenic
1182067323 22:27439819-27439841 CTCTGGGGCTGCAGGGAGAGCGG - Intergenic
1182526984 22:30926738-30926760 CCCTGTAGCTGCAGGGGGAGGGG - Exonic
1182669562 22:31984307-31984329 CCCTGGCTCTGGAGAAGGAGGGG + Intergenic
1183300673 22:37057562-37057584 GGCTGGGGCTGCAGGAAGGGAGG - Intronic
1183746492 22:39694877-39694899 CGCAGGGGATGCAGGAGGTGAGG - Intergenic
1183953985 22:41368422-41368444 TGCTGGCACAGCAGGATGAGAGG - Intronic
1184037456 22:41925547-41925569 CTCTGGGGCTGCAGGCAGAGGGG + Exonic
1184337367 22:43861922-43861944 GGCCGGCGCTGCAGGAGGATGGG - Intronic
1184676085 22:46044274-46044296 CCCTGGTGCTCCAGGAGAAGGGG - Intergenic
1185126139 22:49011861-49011883 GCCTGGGGCTGCAGGAGGACGGG - Intergenic
1185126177 22:49011976-49011998 GCCTGGGGCTGCAGGAGGATGGG - Intergenic
1185294046 22:50044676-50044698 TGTTGGCGGTGCAGGAGGCGCGG + Intronic
1185347588 22:50317166-50317188 AGGTGGGGCTGCAGGAGGGGTGG + Intronic
949970248 3:9397678-9397700 CGCCGCCGCTGCCGGGGGAGGGG + Intronic
950080261 3:10216831-10216853 TGGTGGCGTTGGAGGAGGAGAGG + Intronic
950290452 3:11779856-11779878 AGCTGGGGATCCAGGAGGAGGGG - Intergenic
950387734 3:12673307-12673329 AGCTGTGGCTGCAGCAGGAGTGG - Intergenic
950428194 3:12935945-12935967 CGCTGGAGCGGCAGGAGCAGCGG - Exonic
952884291 3:38003126-38003148 CTCAGGCCCTGCATGAGGAGGGG - Intronic
953908613 3:46881289-46881311 CGCTGGAGCTCTAAGAGGAGGGG - Intronic
954172029 3:48811949-48811971 GGCTGGGGCTGCAGGGGGAATGG + Intronic
954678915 3:52330993-52331015 CCCTGGCTCTGCTGGAGCAGAGG + Intronic
956324812 3:68040300-68040322 GGCTGGCTCAGCAGGAGGGGAGG - Intronic
956844133 3:73166715-73166737 GACTGGGGCTGGAGGAGGAGGGG + Intergenic
958779381 3:98522851-98522873 AGCTGGCGGAGCAGGAGGATGGG - Intronic
961386609 3:126526529-126526551 CTCTGGCTCTGGAGAAGGAGGGG - Intronic
961469583 3:127102899-127102921 TGCTGGTGCTGCAGCAAGAGAGG - Intergenic
962329526 3:134464987-134465009 TGCTGCCTCTGCAGGAAGAGGGG + Intergenic
963236291 3:142960521-142960543 TACTGGCTCAGCAGGAGGAGTGG - Intronic
966872337 3:184299158-184299180 GGCGGGCTCTGGAGGAGGAGGGG + Exonic
968442896 4:633531-633553 CGGTGGCCCTGCAGCAGCAGAGG - Intronic
968463534 4:737854-737876 AGCTGGCGCTGTGGGATGAGGGG - Intronic
968584212 4:1408492-1408514 CGCTGGCGCTGGCGGGGAAGAGG - Intergenic
968668556 4:1834974-1834996 CTCTGCCCTTGCAGGAGGAGAGG - Exonic
968755897 4:2416647-2416669 CGAAGGCGCCGCAGGAGGAGAGG + Intronic
968994194 4:3935495-3935517 AGCTGGCGCTGCAGGTCCAGAGG - Intergenic
969052014 4:4379914-4379936 CCCTGGGCCAGCAGGAGGAGGGG + Intronic
969625004 4:8297888-8297910 AGGTGGGGCTGCAGGAGCAGGGG - Intronic
972475653 4:39446942-39446964 CGCTGTCGCTGCACGCGGACTGG + Exonic
973673653 4:53241754-53241776 TGGTGGTGCAGCAGGAGGAGGGG - Intronic
975830558 4:78363912-78363934 GGCAGGTTCTGCAGGAGGAGTGG - Exonic
977292325 4:95177461-95177483 CACTGGCACTGCAGGCGGTGAGG + Intronic
981558727 4:146023879-146023901 TGCTGGGGCTGGGGGAGGAGAGG + Intergenic
985900743 5:2788527-2788549 CGATGGGGCAGCAGGAGGTGGGG - Intergenic
987091099 5:14508253-14508275 CGCTGGCCCTCCAGGAGCAGTGG + Exonic
987362521 5:17120143-17120165 CGCTGGCTCTTCTGGAGGGGAGG - Intronic
988688666 5:33550003-33550025 TGATGGTGCTGCAGGAGGAATGG - Intronic
991707131 5:69369286-69369308 CGCGGGCGTTGCGGGAGGCGAGG - Intronic
993672904 5:90783868-90783890 CACTGGAGCTACTGGAGGAGCGG + Exonic
995284231 5:110368557-110368579 TTCTGGGGCTTCAGGAGGAGTGG - Intronic
995734906 5:115289422-115289444 CGCTGGGGTGGCGGGAGGAGCGG - Intronic
996366122 5:122703231-122703253 CACTGGGGATGGAGGAGGAGTGG - Intergenic
997703983 5:135930172-135930194 CGCCGCCCCTGCGGGAGGAGCGG + Intronic
998396187 5:141819851-141819873 GGCTGGGGCCCCAGGAGGAGAGG - Intergenic
998458103 5:142289380-142289402 CGCTGGCACTCCAGGAAGTGAGG - Intergenic
999087875 5:148909494-148909516 GCCTGTGGCTGCAGGAGGAGTGG + Intergenic
999370446 5:151052110-151052132 AGTGGGGGCTGCAGGAGGAGGGG - Intronic
999376337 5:151088963-151088985 TGCAGCCTCTGCAGGAGGAGAGG + Intronic
1002134208 5:177098008-177098030 CGCTGGGGCAGCAGCAGCAGGGG - Exonic
1002795883 6:470890-470912 CCCTGGCGGGGCAGGGGGAGAGG - Intergenic
1003139468 6:3457928-3457950 GGTTGGCGCTGGAGCAGGAGAGG - Intergenic
1003639125 6:7861954-7861976 CTCTGATGCTGCAGGAGGAGTGG - Intronic
1004295645 6:14407417-14407439 GGCTGGTGCTGGAGGTGGAGTGG - Intergenic
1004457275 6:15802744-15802766 AGCTGGCGCTGTTGGAGGAGGGG + Intergenic
1005847148 6:29790970-29790992 GGCTGGAGATGCAGGAGGTGAGG + Intergenic
1006188025 6:32191496-32191518 CGCTGGCACTGGAGGAGTGGAGG + Exonic
1006361743 6:33590692-33590714 CGCTGTCCCTGGAGCAGGAGGGG + Intergenic
1006442124 6:34059356-34059378 CGCTGGGCCTGCAGCAGGCGTGG - Intronic
1007595466 6:43048413-43048435 CGCTGCAGCTGCAGCAGGAGTGG + Exonic
1008092774 6:47309460-47309482 CGATGCGGCTGCAGGAGGCGAGG + Exonic
1008530571 6:52454236-52454258 CGCTGGCGGTTCATTAGGAGTGG - Exonic
1010556890 6:77293279-77293301 CTCTGGAGCTGCTGGAGCAGTGG - Intergenic
1014205512 6:118651596-118651618 CTCTGGCTCTGCCGGCGGAGGGG - Intronic
1015785952 6:136921966-136921988 CGCTGGCTCTGTGGGGGGAGAGG + Intergenic
1016384009 6:143513561-143513583 CGCTGTCACTGCAGGTGTAGGGG + Intergenic
1016836127 6:148478721-148478743 CGCTGGGGCAGCTGGTGGAGTGG + Intronic
1017311611 6:152982899-152982921 GGCTGGCGCTGCAGGAGCAGCGG + Exonic
1017907991 6:158769898-158769920 CCCTGCAGCTGGAGGAGGAGAGG - Exonic
1018397349 6:163388463-163388485 AGCTTTCTCTGCAGGAGGAGTGG - Intergenic
1018589573 6:165404337-165404359 CCCTGTGGCTGCATGAGGAGAGG + Intronic
1018700600 6:166423177-166423199 CGGTGGCTCTGCAGTGGGAGGGG + Intronic
1019437199 7:1028335-1028357 CGCTGAGGCTGCTGGAGGCGCGG - Intronic
1019527099 7:1485284-1485306 CCCTGGCCCTGCAGCAGGTGAGG - Exonic
1019717535 7:2546848-2546870 CGCTGGAGGTGCAGGATGTGCGG + Intronic
1020657154 7:10941132-10941154 CACTAGCTCTGAAGGAGGAGCGG + Intergenic
1021203715 7:17754072-17754094 TGCTGGCAATGAAGGAGGAGAGG + Intergenic
1023638532 7:42236906-42236928 CGCGGGCGCGGCCGCAGGAGCGG + Intronic
1024553502 7:50583491-50583513 TGCGGGCGCTGCAGGAGGCCAGG - Intergenic
1025227898 7:57179863-57179885 CGCGGCCACTGCAGGAGGTGAGG - Intergenic
1025957403 7:66193456-66193478 GGATGGAGCTGCAGGAGGAAAGG + Intergenic
1026017391 7:66682098-66682120 CGCTGGCGGTGCCGGGGGGGCGG + Intronic
1026025437 7:66740666-66740688 CGCTGGCGGTGCCGGGGGCGGGG + Intronic
1028841585 7:95434892-95434914 CGCTGGCGCTCCTGGGCGAGAGG - Exonic
1028987400 7:97018849-97018871 CGCTGGGGGTGCCGGAGGAGGGG + Intergenic
1029535885 7:101157386-101157408 CGATGGCGCAGCAGAAGTAGAGG - Exonic
1029588982 7:101494737-101494759 AGCTGGGACTGGAGGAGGAGCGG - Intronic
1029715066 7:102321308-102321330 CGCGGGCGCGGCAGGGGGCGTGG - Exonic
1032392311 7:131563498-131563520 CCCTGGCGCAGCAGGAAGAGAGG + Intergenic
1033118804 7:138648960-138648982 CACTGGACCAGCAGGAGGAGGGG + Intronic
1035228235 7:157445331-157445353 GGCTGGGGCTGCAGGGGGTGGGG + Intergenic
1035720312 8:1786214-1786236 GGGAGGGGCTGCAGGAGGAGGGG + Exonic
1035911016 8:3566454-3566476 TGGTGGAGGTGCAGGAGGAGCGG - Intronic
1036723693 8:11200968-11200990 CGCCGCCGCCGCAGGTGGAGCGG - Exonic
1037483967 8:19330246-19330268 CCCTGAAGCTGTAGGAGGAGGGG - Intronic
1037547570 8:19939549-19939571 CGCCGGGTCTGCAGGTGGAGGGG - Intronic
1037876648 8:22551925-22551947 CGCGGGCGCTCGAGGAGGAAGGG - Exonic
1038455906 8:27671869-27671891 CCCTGGCTGGGCAGGAGGAGAGG + Exonic
1041011385 8:53547263-53547285 CGCTGGTGATGCTGGAGGACAGG + Intergenic
1041107838 8:54459073-54459095 CGCTGACGCTGGCGGAGAAGCGG + Exonic
1041673632 8:60516908-60516930 CGCCGGCGCCGCCGGAGGAAAGG - Exonic
1042155427 8:65840931-65840953 CGCGGGAGCTGGGGGAGGAGAGG + Intronic
1046545762 8:115648279-115648301 CGCTGGAGAGGGAGGAGGAGAGG + Intronic
1046743077 8:117848742-117848764 CGCTTGAGCTGAAGGAGGAATGG - Intronic
1048370721 8:133773930-133773952 CACTGGGGCAGCAGGAAGAGCGG + Intergenic
1048771767 8:137902891-137902913 CGCTGGCTGTTGAGGAGGAGAGG + Intergenic
1049162310 8:141105235-141105257 CCCTGGGGCTGCAGGAGATGAGG - Intergenic
1049220384 8:141426247-141426269 CCAGGGCGCTGCAGTAGGAGTGG - Intronic
1049326050 8:142022154-142022176 GGCTGGCCTTGCAGGTGGAGGGG - Intergenic
1049682118 8:143923986-143924008 AGCTGGCGGCGGAGGAGGAGCGG - Exonic
1049742322 8:144247113-144247135 CGCCCACGCTGCAGCAGGAGGGG + Intronic
1049807406 8:144547241-144547263 CGCTGGCCCAGCAGGAGAACAGG - Exonic
1051206363 9:14693286-14693308 AGGTGGCGCGGCAGGAGGAGGGG - Exonic
1051894598 9:21974723-21974745 TGCGGGCGCTGCTGGAGGCGGGG - Exonic
1052716134 9:32119789-32119811 GGCTGGAGCTGCATGAGAAGGGG + Intergenic
1053009414 9:34624801-34624823 CGCTCCAGCTGCAGGGGGAGGGG - Intronic
1055505101 9:76939976-76939998 TGCTGGGGCAGAAGGAGGAGTGG - Intergenic
1056456534 9:86766164-86766186 AGCAGCAGCTGCAGGAGGAGGGG + Intergenic
1056676891 9:88683464-88683486 CCCCGGCGCCGCGGGAGGAGAGG - Intergenic
1057934014 9:99221763-99221785 CGCTGGCGCTGCAGGCGCGCGGG - Exonic
1059461328 9:114432318-114432340 CGCAGGAGCCCCAGGAGGAGAGG + Intronic
1061620908 9:131810677-131810699 AGCTGGAGCTGCCGGAGGTGTGG + Intergenic
1061880947 9:133568582-133568604 CACTGGGGCGGCAGGGGGAGGGG - Exonic
1061882641 9:133575739-133575761 CTCAGGCGCTGGAGTAGGAGTGG + Intergenic
1062116819 9:134814044-134814066 AGCGGGCGCTGCGGGAGGGGTGG + Intronic
1062131843 9:134899984-134900006 CACTGACACTGCAGGAGTAGAGG - Intergenic
1062190650 9:135246279-135246301 CGCTGAGGCAGCAGGAGGACAGG + Intergenic
1062504603 9:136866508-136866530 CGCTGGGGCTGCAGGTCGGGAGG + Intronic
1062566481 9:137166027-137166049 CGGGGGCCCTGCAGGAGGTGTGG + Intronic
1062567870 9:137171295-137171317 TGCTGTCCCTGGAGGAGGAGGGG - Intronic
1062568542 9:137173940-137173962 GGAAGGCGCTGCAGCAGGAGCGG + Intergenic
1186406000 X:9303555-9303577 CACTCGAGCAGCAGGAGGAGAGG + Intergenic
1189249039 X:39585832-39585854 CTCTGGGGCAGGAGGAGGAGTGG + Intergenic
1189655385 X:43239557-43239579 CGCTTCCGCTGCAGGAGGTAAGG - Intergenic
1192157797 X:68759272-68759294 GGCTGGCTCTGCAGCTGGAGGGG + Intergenic
1192757426 X:74061075-74061097 CGCTGGAGGTGGAGAAGGAGAGG - Intergenic
1193475210 X:81955643-81955665 GGCTGGAGCTGAAGGAAGAGTGG + Intergenic
1195840299 X:109168573-109168595 AGCTGCCACTGCTGGAGGAGAGG - Intergenic
1201900714 Y:19044296-19044318 CACTGGAGCTGCAGGAGGTAGGG + Intergenic