ID: 1151749546

View in Genome Browser
Species Human (GRCh38)
Location 17:76028735-76028757
Sequence CCCTGAACTCGGCCGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151749536_1151749546 28 Left 1151749536 17:76028684-76028706 CCATGGGATAGAAAAGTCCTGCG No data
Right 1151749546 17:76028735-76028757 CCCTGAACTCGGCCGTGGAGAGG No data
1151749534_1151749546 30 Left 1151749534 17:76028682-76028704 CCCCATGGGATAGAAAAGTCCTG No data
Right 1151749546 17:76028735-76028757 CCCTGAACTCGGCCGTGGAGAGG No data
1151749541_1151749546 4 Left 1151749541 17:76028708-76028730 CCTTTTTGGCTGAATTTCATGGG No data
Right 1151749546 17:76028735-76028757 CCCTGAACTCGGCCGTGGAGAGG No data
1151749539_1151749546 5 Left 1151749539 17:76028707-76028729 CCCTTTTTGGCTGAATTTCATGG No data
Right 1151749546 17:76028735-76028757 CCCTGAACTCGGCCGTGGAGAGG No data
1151749538_1151749546 11 Left 1151749538 17:76028701-76028723 CCTGCGCCCTTTTTGGCTGAATT No data
Right 1151749546 17:76028735-76028757 CCCTGAACTCGGCCGTGGAGAGG No data
1151749535_1151749546 29 Left 1151749535 17:76028683-76028705 CCCATGGGATAGAAAAGTCCTGC No data
Right 1151749546 17:76028735-76028757 CCCTGAACTCGGCCGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151749546 Original CRISPR CCCTGAACTCGGCCGTGGAG AGG Intergenic
No off target data available for this crispr