ID: 1151750186

View in Genome Browser
Species Human (GRCh38)
Location 17:76032746-76032768
Sequence CTCTAGGCCCAGCTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151750186_1151750193 -7 Left 1151750186 17:76032746-76032768 CCCTCCTCCAGCTGGGCCTAGAG No data
Right 1151750193 17:76032762-76032784 CCTAGAGGAGCACAGTCTGGCGG No data
1151750186_1151750191 -10 Left 1151750186 17:76032746-76032768 CCCTCCTCCAGCTGGGCCTAGAG No data
Right 1151750191 17:76032759-76032781 GGGCCTAGAGGAGCACAGTCTGG No data
1151750186_1151750196 0 Left 1151750186 17:76032746-76032768 CCCTCCTCCAGCTGGGCCTAGAG No data
Right 1151750196 17:76032769-76032791 GAGCACAGTCTGGCGGACTGGGG No data
1151750186_1151750199 9 Left 1151750186 17:76032746-76032768 CCCTCCTCCAGCTGGGCCTAGAG No data
Right 1151750199 17:76032778-76032800 CTGGCGGACTGGGGGTTCAAGGG No data
1151750186_1151750197 1 Left 1151750186 17:76032746-76032768 CCCTCCTCCAGCTGGGCCTAGAG No data
Right 1151750197 17:76032770-76032792 AGCACAGTCTGGCGGACTGGGGG No data
1151750186_1151750194 -2 Left 1151750186 17:76032746-76032768 CCCTCCTCCAGCTGGGCCTAGAG No data
Right 1151750194 17:76032767-76032789 AGGAGCACAGTCTGGCGGACTGG No data
1151750186_1151750198 8 Left 1151750186 17:76032746-76032768 CCCTCCTCCAGCTGGGCCTAGAG No data
Right 1151750198 17:76032777-76032799 TCTGGCGGACTGGGGGTTCAAGG No data
1151750186_1151750195 -1 Left 1151750186 17:76032746-76032768 CCCTCCTCCAGCTGGGCCTAGAG No data
Right 1151750195 17:76032768-76032790 GGAGCACAGTCTGGCGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151750186 Original CRISPR CTCTAGGCCCAGCTGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr