ID: 1151750192

View in Genome Browser
Species Human (GRCh38)
Location 17:76032762-76032784
Sequence CCGCCAGACTGTGCTCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151750192_1151750204 25 Left 1151750192 17:76032762-76032784 CCTAGAGGAGCACAGTCTGGCGG No data
Right 1151750204 17:76032810-76032832 CTTCCGTTGTCTACAGGTATAGG No data
1151750192_1151750198 -8 Left 1151750192 17:76032762-76032784 CCTAGAGGAGCACAGTCTGGCGG No data
Right 1151750198 17:76032777-76032799 TCTGGCGGACTGGGGGTTCAAGG No data
1151750192_1151750206 30 Left 1151750192 17:76032762-76032784 CCTAGAGGAGCACAGTCTGGCGG No data
Right 1151750206 17:76032815-76032837 GTTGTCTACAGGTATAGGATTGG No data
1151750192_1151750199 -7 Left 1151750192 17:76032762-76032784 CCTAGAGGAGCACAGTCTGGCGG No data
Right 1151750199 17:76032778-76032800 CTGGCGGACTGGGGGTTCAAGGG No data
1151750192_1151750201 19 Left 1151750192 17:76032762-76032784 CCTAGAGGAGCACAGTCTGGCGG No data
Right 1151750201 17:76032804-76032826 AGCCTCCTTCCGTTGTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151750192 Original CRISPR CCGCCAGACTGTGCTCCTCT AGG (reversed) Intergenic