ID: 1151753318

View in Genome Browser
Species Human (GRCh38)
Location 17:76054919-76054941
Sequence TCATATCAATGAAGGCATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151753316_1151753318 -8 Left 1151753316 17:76054904-76054926 CCTTTCAGTATGATGTCATATCA 0: 1
1: 0
2: 4
3: 19
4: 266
Right 1151753318 17:76054919-76054941 TCATATCAATGAAGGCATATAGG 0: 1
1: 0
2: 2
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151753318 Original CRISPR TCATATCAATGAAGGCATAT AGG Intronic