ID: 1151753318 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:76054919-76054941 |
| Sequence | TCATATCAATGAAGGCATAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 197 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 16, 4: 178} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151753316_1151753318 | -8 | Left | 1151753316 | 17:76054904-76054926 | CCTTTCAGTATGATGTCATATCA | 0: 1 1: 0 2: 4 3: 19 4: 266 |
||
| Right | 1151753318 | 17:76054919-76054941 | TCATATCAATGAAGGCATATAGG | 0: 1 1: 0 2: 2 3: 16 4: 178 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151753318 | Original CRISPR | TCATATCAATGAAGGCATAT AGG | Intronic | ||