ID: 1151755727

View in Genome Browser
Species Human (GRCh38)
Location 17:76074421-76074443
Sequence CAGGCTGCAGGGAAGCGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 432}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151755709_1151755727 18 Left 1151755709 17:76074380-76074402 CCCCAGCCCCTCGACGGTCCCGG 0: 1
1: 0
2: 1
3: 13
4: 149
Right 1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 432
1151755717_1151755727 0 Left 1151755717 17:76074398-76074420 CCCGGGATATCCTGCACCCCTGC 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 432
1151755716_1151755727 10 Left 1151755716 17:76074388-76074410 CCTCGACGGTCCCGGGATATCCT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 432
1151755713_1151755727 16 Left 1151755713 17:76074382-76074404 CCAGCCCCTCGACGGTCCCGGGA 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 432
1151755714_1151755727 12 Left 1151755714 17:76074386-76074408 CCCCTCGACGGTCCCGGGATATC 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 432
1151755720_1151755727 -10 Left 1151755720 17:76074408-76074430 CCTGCACCCCTGCCAGGCTGCAG 0: 1
1: 0
2: 10
3: 80
4: 844
Right 1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 432
1151755711_1151755727 17 Left 1151755711 17:76074381-76074403 CCCAGCCCCTCGACGGTCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 432
1151755718_1151755727 -1 Left 1151755718 17:76074399-76074421 CCGGGATATCCTGCACCCCTGCC 0: 1
1: 0
2: 1
3: 18
4: 226
Right 1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 432
1151755715_1151755727 11 Left 1151755715 17:76074387-76074409 CCCTCGACGGTCCCGGGATATCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151755727 Original CRISPR CAGGCTGCAGGGAAGCGCCG AGG Intronic
900251763 1:1674570-1674592 CAGGCTGCAGTGCAGTGGCGAGG - Intronic
900262171 1:1737426-1737448 CAGGCTGCAGTGCAGTGGCGAGG - Intronic
900531431 1:3155318-3155340 CAGGCTGCAGGGCTTGGCCGCGG + Intronic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
901583330 1:10264704-10264726 CAGGCTGGAGTGCAGCGGCGCGG + Intronic
901632163 1:10653291-10653313 CAGGCTGCAGAGCAGAGTCGGGG - Intronic
902342587 1:15793837-15793859 CAGGCTGGAGGGCAGTGGCGTGG - Intergenic
902401292 1:16158754-16158776 CAGGCTGGAGTGCAGTGCCGCGG - Intergenic
902472278 1:16657229-16657251 CCAGCTGCAGGGAAGGGCCCTGG + Intergenic
902486525 1:16750217-16750239 CCAGCTGCAGGGAAGGGCCCTGG - Intronic
902504357 1:16929827-16929849 CCAGCTGCAGGGAAGGGCCCTGG - Exonic
902533021 1:17102665-17102687 CAGGCTGCAGGGGAGAGGCAGGG + Intronic
902534282 1:17110213-17110235 GAGGCTGCAGGGAGGGGCCCAGG + Intronic
902600248 1:17535991-17536013 CAGGCTGCAGGTAGGGGCCTGGG + Intergenic
903945971 1:26962910-26962932 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
904244142 1:29174147-29174169 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
904493291 1:30873183-30873205 GAGGCTGCAGGGAGGCACTGTGG + Exonic
906010239 1:42516525-42516547 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
906220879 1:44078475-44078497 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
907245073 1:53103281-53103303 CAGGCTGCTGGGAGGGGCTGGGG + Intronic
907450346 1:54542267-54542289 CAGGCTGAAGGGAGGCGCGGAGG - Intronic
908301153 1:62761818-62761840 CAGGCTGCAGGGGAGCCCATGGG - Intergenic
908780706 1:67686607-67686629 CAGCCTGCAGGGTAGAGCCCCGG + Intronic
911527499 1:99004636-99004658 CATGCTGCTGGTGAGCGCCGCGG + Exonic
913331596 1:117672300-117672322 CAGGCAGAAGGGAAGTGCAGAGG + Intergenic
918444526 1:184603749-184603771 CAGGCTGGAGGGCAGTGGCGTGG - Intronic
919087335 1:192936163-192936185 CAGGCTTCAGGGAATAGCTGTGG - Intergenic
919727114 1:200891584-200891606 CAGGCCGCAGGGAGGCTCGGGGG + Intronic
920501858 1:206490557-206490579 CAGCCTGCAGTGCAGGGCCGGGG - Intronic
922057296 1:222053277-222053299 AGGGCTGCTGGGAAGCCCCGTGG - Intergenic
923325337 1:232875483-232875505 CAGGATGCAGGGGAGCCCAGGGG - Intergenic
924162374 1:241246057-241246079 CAGGCTGGAGGGCAGTGGCGTGG - Intronic
1062817772 10:513567-513589 CAGGCTGCAGTGTGGCGCAGTGG - Intronic
1062882132 10:987885-987907 AGGGCTGCAGGGAAGCCGCGAGG + Intergenic
1063054179 10:2485121-2485143 CAGGCTGGAGTGCAGCGGCGTGG + Intergenic
1063614586 10:7590939-7590961 CAGGCTGGAGTGCAGCGGCGCGG + Intronic
1063671563 10:8103609-8103631 CAGGCTGGAGGAAAACGCTGTGG - Intergenic
1064018930 10:11793971-11793993 GAGGCTGCAGGGACAGGCCGGGG + Intergenic
1064025515 10:11845711-11845733 CAGGCTGCTGGGTCCCGCCGAGG - Intronic
1064145950 10:12826617-12826639 CAGGCTGCAGGGCTGCTCCATGG - Intronic
1065800173 10:29344718-29344740 CAGGCTGCATGGAGGACCCGGGG + Intergenic
1066074969 10:31865831-31865853 CAGGCTGGAGTGCAGCGTCGCGG - Intronic
1066308060 10:34166582-34166604 CAGGCTGGAGTGAAGCGGCATGG - Intronic
1069568444 10:69479395-69479417 CAGGCTGCAGAGGAGCCCTGTGG - Intronic
1070432918 10:76359285-76359307 CAGGTTTCAGGGAAGTGCTGTGG - Intronic
1070540245 10:77410412-77410434 CAGGCAGCAGGGAGGGGCCCTGG - Intronic
1071570830 10:86695922-86695944 CAGGCATCAGGGAAACGCAGAGG - Intronic
1072197804 10:93131586-93131608 CAGGATGCAGGGAAACGCCTGGG - Intergenic
1072578971 10:96723525-96723547 CAGGCTGCAGTGCAGTGCAGTGG - Intergenic
1072926603 10:99621430-99621452 AAGGCAGCAGGGAAGTGCGGCGG + Intergenic
1074493667 10:113960276-113960298 CAGGCCCCAGGGGAGCTCCGTGG + Intergenic
1075226584 10:120634828-120634850 GAGGATGCAGGGAAGGACCGAGG - Intergenic
1075712127 10:124536414-124536436 CAGGCTGGATGGAAGCTCCCCGG + Intronic
1077194884 11:1274534-1274556 CACCCTGCAGGGTAGCGCCCAGG + Exonic
1077575332 11:3378863-3378885 CGCTCTGCAGGGATGCGCCGGGG + Intronic
1077584903 11:3443822-3443844 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
1077898802 11:6473939-6473961 CAGGCCGGAGGGAGGGGCCGGGG + Intronic
1078365972 11:10706721-10706743 CAGGGTGCAGGGGAGCTCAGAGG - Intergenic
1078470296 11:11580973-11580995 CAGGCTTCAGGGTGGCACCGTGG - Intronic
1079429513 11:20375524-20375546 CAGGCTGGAGGGCAGTGGCGTGG - Intronic
1080790005 11:35514126-35514148 GAGGCTGTAGGGAAATGCCGTGG - Intronic
1081038338 11:38178213-38178235 CAGGCTGGAGTGCAGCGGCGTGG + Intergenic
1082773893 11:57231023-57231045 CAGGCTCCAGGCAGGCACCGTGG + Intergenic
1084524024 11:69684831-69684853 CAGGCTGCGGGGATGAGCCTCGG - Intergenic
1084681763 11:70670493-70670515 CTGGCTGCAGGGCAGCACAGAGG + Intronic
1086495540 11:87400993-87401015 CAGGCTGGAGTGAAGTGCAGTGG + Intergenic
1088272814 11:108052357-108052379 CAGGCTGGAGGGCAGTGGCGTGG + Intronic
1088908782 11:114174867-114174889 CAAGCTGCAGGGAAGAGGCAGGG + Intronic
1089318958 11:117612260-117612282 CAGGCTACAGGGAGGCGGTGGGG - Intronic
1089879704 11:121762069-121762091 CAGGCTGCAGGGGAGCTCTGTGG + Intergenic
1089993411 11:122882865-122882887 CGGTCTCCAGGGCAGCGCCGGGG + Exonic
1090052410 11:123391269-123391291 AAGGCTGCAGGTAAGCTCCTGGG - Intergenic
1090920678 11:131203648-131203670 CAAGCTGCAGGGCAGCTCCACGG + Intergenic
1091048717 11:132348904-132348926 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
1091790271 12:3268175-3268197 CAGGCTGCAGGAACGCACGGAGG - Intronic
1091790276 12:3268199-3268221 CAGGCTGCAGGAACGCACAGAGG - Intronic
1091790284 12:3268247-3268269 CAGGCTGCAGGAATGCACAGAGG - Intronic
1091790314 12:3268413-3268435 CAGGCTGCAGGAACGCACGGAGG - Intronic
1091790319 12:3268437-3268459 CAGGCTGCAGGAACGCACGGAGG - Intronic
1091790324 12:3268461-3268483 CAGGCTGCAGGAACGCACAGAGG - Intronic
1091790344 12:3268581-3268603 CAGGCTGCAGGAATGCACGGAGG - Intronic
1091790355 12:3268629-3268651 CAGGCTGCAGGAACGCACAGAGG - Intronic
1091790359 12:3268653-3268675 CAGGCTGCAGGAACGCACGGAGG - Intronic
1091790368 12:3268701-3268723 CAGGCTGCAGGAACGCACGGAGG - Intronic
1091790391 12:3268821-3268843 CAGGCTGCAGGAATGCACGGAGG - Intronic
1091790396 12:3268845-3268867 CAGGCTGCAGGAATGCACGGAGG - Intronic
1091790401 12:3268869-3268891 CAGGCTGCAGGAACGCACAGAGG - Intronic
1091790421 12:3268985-3269007 CAGGCTGCAGGAACGCACGGAGG - Intronic
1091790436 12:3269057-3269079 CAGGCTGCAGGAACGCACGGAGG - Intronic
1091790456 12:3269153-3269175 CAGGCTGCAGGAACGCACAGAGG - Intronic
1091790484 12:3269311-3269333 CAGGCTGCAGGAACGCACGGAGG - Intronic
1091790501 12:3269383-3269405 CAGGCTGCAGGAACGCACGGAGG - Intronic
1091790518 12:3269455-3269477 CAGGCTGCAGGAACGCACAGAGG - Intronic
1091790529 12:3269525-3269547 CAGGCTGCAGGAACGCACGGAGG - Intronic
1092717289 12:11403946-11403968 CAGGCTGCAGAGCAGTGGCGCGG + Intronic
1094528955 12:31254163-31254185 CAGGCTGCACTGAAACGCCCTGG - Intergenic
1096213769 12:49787140-49787162 CAGGCTGCAGTGCAGTGGCGTGG + Intergenic
1096898479 12:54849906-54849928 CAGGGTGTAGGGGAGCCCCGTGG - Intronic
1097180998 12:57171901-57171923 CAGGCTGGAGGGCAGGGCCAGGG - Intronic
1097960807 12:65530403-65530425 CAGGCTGGAGTGAAGTGGCGTGG + Intergenic
1100761407 12:97811515-97811537 CATGCTCCAGGGAAGCCCCATGG + Intergenic
1102260258 12:111439010-111439032 CAGGCTGCAGTGCAGTGCAGTGG + Intronic
1103551686 12:121742628-121742650 CAGGCTGGAGTGAAGTGGCGTGG + Intronic
1103610506 12:122121358-122121380 CAGGCTGGAGTGCAGCGGCGAGG + Intronic
1103912743 12:124361275-124361297 CAGCCTGCCAGCAAGCGCCGGGG + Intronic
1103920051 12:124394660-124394682 AAGGCTGCAGGCAGGCGCCAGGG + Intronic
1103999152 12:124849343-124849365 GAGGCTGCAGGGGTGTGCCGTGG - Intronic
1104647724 12:130509049-130509071 CAGGCTGGTGGGGAGGGCCGGGG - Intronic
1105022816 12:132828678-132828700 CACGCTGCAGGGACGCGCCCAGG + Exonic
1105407099 13:20142127-20142149 CAGTCTGGAGGGGAGCGCCCTGG - Exonic
1105840691 13:24251561-24251583 CAGGCTGCACCGAAGCCCAGTGG - Intronic
1106319651 13:28625389-28625411 CTGGCTGCAGGGCAGCGGAGTGG - Intergenic
1108211026 13:48139897-48139919 CAGGATGCAGGGGAGCTCTGGGG - Intergenic
1108615622 13:52129088-52129110 CCGGCCGCAGGGAGGCGCAGCGG - Intergenic
1110119628 13:71865871-71865893 CAGGCTGGTGGGAAGGGGCGCGG + Intronic
1110450260 13:75632903-75632925 CAGGCTGGAGTGCAGTGCCGTGG + Intronic
1111814942 13:93140368-93140390 CAGGCTGGAGTGCAGCGGCGTGG + Intergenic
1113616110 13:111681665-111681687 CAGGCTGCAGGGCAGCGTCAGGG - Intergenic
1113621578 13:111766558-111766580 CAGGCTGCAGGGCAGCGTCAGGG - Intergenic
1114654965 14:24310545-24310567 CAGGCTGCAGGGAAGTAAGGAGG + Exonic
1114680775 14:24482129-24482151 CTGGCTGCTGGGAAGCCCCCAGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1114815592 14:25954366-25954388 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
1115058210 14:29156744-29156766 CAGGCTCCAGGGAAGAGACGGGG - Intergenic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1116905213 14:50397001-50397023 CCGGCTGCAGGGAAAGGCCTCGG + Intronic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1119253077 14:73174271-73174293 CAGGCTGGAGTGAAGTGCAGTGG + Intronic
1119725761 14:76920903-76920925 CAGGCTGCAGGGTGGTGCCCGGG + Intergenic
1120039810 14:79739602-79739624 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1120289300 14:82546372-82546394 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
1121095312 14:91214346-91214368 CAGGTTTCAGGGAAGAGCCAAGG + Intronic
1121642890 14:95497981-95498003 CAGGCTGGAGGGGAGTGCAGTGG - Intergenic
1122183451 14:99971852-99971874 CTAGCTGCGGGGAAGGGCCGCGG - Intronic
1122228295 14:100292286-100292308 CAGGCTGGAGGGCTGCGCCAGGG + Exonic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1124426958 15:29570667-29570689 CAGGCTGCGGGGCAGCGCGGCGG + Exonic
1124584294 15:30991391-30991413 GAGGCTCCACGGAAGCGCAGAGG + Intronic
1126011619 15:44308218-44308240 CAGGCTGGAGGGAAGGGCAATGG - Intronic
1126018648 15:44377413-44377435 CAGGCTGGAGTGCAGTGCCGCGG + Intronic
1127344219 15:58078411-58078433 CAGTCTCCAGGGAAGGGCCCAGG + Intronic
1127880878 15:63157591-63157613 CAGGGCGCAGGGAAGACCCGGGG + Exonic
1128017204 15:64357619-64357641 CATGCTGCAGGGCAGTGGCGCGG - Intronic
1128647428 15:69387824-69387846 CAGCCTGCAGGGAAGGGAAGAGG - Intronic
1128973745 15:72132698-72132720 CAGGCTGGAGGGCAGTGGCGAGG + Intronic
1129120560 15:73393948-73393970 CAAGCTGCAGGGAGGCACAGAGG + Intergenic
1129443514 15:75599883-75599905 CAGGCTGCAGTGGAGTGCGGTGG + Intronic
1130276704 15:82481838-82481860 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
1130531209 15:84748766-84748788 CAGGCTGCAGGGCCGGGCCCCGG - Intronic
1130646185 15:85729267-85729289 CAGGCTGAAGTGAAGTGCAGTGG - Intronic
1132019873 15:98351641-98351663 CAGGCACCAGGGAAGCCCAGAGG + Intergenic
1132104477 15:99052931-99052953 CAGGCTGCAGTGAAGTGCAATGG - Intergenic
1132381417 15:101369175-101369197 CAGGCTGCTGGGCAGTGCTGTGG + Intronic
1132381724 15:101370858-101370880 CAGGCTGCTGGGCAGTGCTGTGG + Intronic
1132410786 15:101577063-101577085 GAGGCTGCTGGGAAGGGCTGGGG - Intergenic
1132803206 16:1764089-1764111 CAGGGAGCAGGGAGGCGCCGTGG - Intronic
1132810223 16:1793666-1793688 CAGGCTGCAGGCAGGCAGCGAGG + Exonic
1132904663 16:2276403-2276425 CAGTCTGCGGGCAAGCTCCGGGG - Exonic
1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG + Intronic
1133162339 16:3920421-3920443 CTGGCTGCAGGGAAGTCCAGGGG + Intergenic
1133623148 16:7545479-7545501 AAGGCTGCAGGGAAGGTCGGGGG - Intronic
1137533596 16:49300182-49300204 CAGGATGCAGGGAAGCCACCAGG + Intergenic
1137726084 16:50657663-50657685 GAGGCTGCAGGCAAGGGCAGAGG - Intergenic
1138201402 16:55091391-55091413 GAGGCTGCAGGGCAGAGCCAGGG + Intergenic
1139890575 16:70251210-70251232 CGGGCTGCTGGGCAGCGGCGAGG - Exonic
1140818044 16:78638644-78638666 CAGGCTGGAGGGAAGGGCGGGGG + Intronic
1140866748 16:79068764-79068786 CAGGCTGCAGGGCAGTGGTGAGG - Intronic
1142136687 16:88454762-88454784 CAGGCTCCGGGGAGGCGCCCCGG - Intronic
1142156442 16:88534673-88534695 CGGGCTGCGGGGAGGCGGCGGGG - Exonic
1142239937 16:88940570-88940592 TAGCCTGCGGGGCAGCGCCGGGG + Intronic
1142351728 16:89583778-89583800 CAGGCTGCAGGGGTGCGCCCGGG - Intronic
1142981410 17:3674269-3674291 CAGGCTGGATGGGAGTGCCGTGG - Intronic
1143586538 17:7853426-7853448 CAGGCTGCAGGGACGGGCTTCGG + Exonic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1143751588 17:9032139-9032161 CGGGGTGCAGGGAGGGGCCGAGG + Intronic
1146330399 17:31922235-31922257 CAGGCTGCAGTGCAGTGGCGTGG + Intergenic
1146445306 17:32928136-32928158 GAGCATGCCGGGAAGCGCCGCGG - Exonic
1147565964 17:41536604-41536626 AAGGCAGCAGGGAAGCACCCAGG - Intergenic
1147791827 17:43018520-43018542 CAGGCTGCAGGGAAGGGGCCTGG + Intronic
1148087472 17:45003011-45003033 CAGGCTGGAGGGCAGTGGCGTGG - Intergenic
1150003481 17:61456019-61456041 CAGGCTGGAGGGCAGGGCCCAGG - Intronic
1150082019 17:62248942-62248964 CAGGCTGCAGTGCAGTGGCGTGG + Intergenic
1150765398 17:67997953-67997975 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1150976007 17:70087975-70087997 CAGGCTGCAGTGCAGTGGCGTGG - Intronic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG + Intronic
1152032440 17:77852826-77852848 GAGGCGGCAGGGCAGAGCCGCGG + Intergenic
1152260186 17:79262604-79262626 CAGGCTGGTGGGAAGGGCTGTGG + Intronic
1152573491 17:81130501-81130523 CAGGCTGCGAGGAGGGGCCGAGG - Intronic
1152585494 17:81187791-81187813 GAGGCTGCAGAGAGGAGCCGAGG - Intergenic
1152942309 17:83179062-83179084 CTGGCTGCAGGGGAGCTGCGAGG + Intergenic
1154022987 18:10681787-10681809 CAGGATGCAGAGAAGAGCTGGGG - Intronic
1154212864 18:12395013-12395035 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1156403538 18:36761548-36761570 CAGCGTGCGGAGAAGCGCCGCGG - Intronic
1156830487 18:41485405-41485427 CAGGCTGGAGTGCAGTGCCGCGG + Intergenic
1156972419 18:43172481-43172503 CAGGCTGGAGGGCAGTGGCGTGG + Intergenic
1157239083 18:45992760-45992782 CAGGCTGCAGTGCAGTGCAGTGG + Intronic
1158965314 18:62617237-62617259 CAGGCTGGAGTGCAGCGCCCAGG + Intergenic
1159725605 18:71953805-71953827 CAGGCTGCAGTGCAGCGCAGTGG + Intergenic
1160007087 18:75075555-75075577 CTGGCTGCAGGGAGCCGCTGGGG - Intergenic
1161103373 19:2432226-2432248 CAGGCTCCAGGGAGGCCCAGTGG + Intronic
1161161186 19:2762641-2762663 CAGGCTGGAGGAGAGCACCGGGG + Exonic
1161389769 19:4014966-4014988 CAGGCTGGAGGGAGGAGCCTCGG - Intronic
1161408465 19:4103152-4103174 CAGGCTGTGGGGAGGGGCCGAGG - Intronic
1162018267 19:7857160-7857182 CAGGGTGCAGGGAAGGGGCCAGG - Intronic
1163091200 19:15021593-15021615 CTGGGGGCAGGGAAGCGCAGGGG - Intronic
1163447097 19:17353162-17353184 CGGGCCCCAGGGAAGAGCCGGGG - Intronic
1164320258 19:24137924-24137946 CAGGCAGCAGGGAGGCCCTGGGG - Intergenic
1164321691 19:24153792-24153814 CAGCCTGCAGTGAAGCGCAATGG - Intergenic
1164700546 19:30281225-30281247 CAGGCTGCTGGGGAGCGAGGAGG - Intronic
1165141639 19:33703352-33703374 CAGGCAGCAGGGAAGTGGTGAGG + Intronic
1165569931 19:36767190-36767212 CAGGCTGCAGTGCAGTGCCACGG - Intronic
1166318822 19:42003792-42003814 GAGGCTGCAGGGAAGACCCTGGG - Intronic
1166700214 19:44878005-44878027 CAGGCTGTAGCGAAGGGCGGAGG + Intronic
1166704827 19:44903011-44903033 GAGCCTGCAGGGAAGAGCTGAGG - Exonic
1167297751 19:48661838-48661860 CCTGCTGCTGGGCAGCGCCGTGG - Exonic
1167430410 19:49451072-49451094 CAGGCTGGAGTGCAGTGCCGAGG + Intronic
1167587628 19:50383972-50383994 CTGGCTGCTGGGCAGCGACGGGG + Intergenic
1167695005 19:51009999-51010021 CAGGCTGGAGGGATGTGCAGGGG + Intergenic
1168240075 19:55084464-55084486 CAGACTGGAGGGAAGCAACGTGG + Intronic
1168316876 19:55488407-55488429 GAGGCTGCAGGGAGGCGGCAGGG - Intronic
1202704675 1_KI270713v1_random:14023-14045 CCAGCTGCAGGGAAGGGCCCTGG + Intergenic
925133547 2:1511249-1511271 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133554 2:1511278-1511300 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133561 2:1511307-1511329 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133568 2:1511336-1511358 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133575 2:1511365-1511387 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133582 2:1511394-1511416 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133589 2:1511423-1511445 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133596 2:1511452-1511474 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133603 2:1511481-1511503 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133610 2:1511510-1511532 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925210639 2:2042890-2042912 CTGCCTGCAGGGAAGAGCAGGGG - Intronic
926217065 2:10912250-10912272 CAGCCTGCGGGGGCGCGCCGCGG - Exonic
928100823 2:28436597-28436619 CAGGCTGCAGGGGAGAGCCCTGG - Intergenic
928373182 2:30756009-30756031 CAGGCTGGAAGGAAGTGACGGGG - Intronic
929780184 2:44952355-44952377 CAGGCCGCTGGGAGGCGCTGTGG + Intergenic
930166060 2:48204885-48204907 CAGGCAGCAGTGAAGCCCTGCGG + Intergenic
932967017 2:76488487-76488509 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
933738427 2:85513778-85513800 CAGGGTGCAGGGAAGCCACAGGG - Intergenic
934492528 2:94771389-94771411 CAGGCTGTAAGGAAGCACAGTGG + Intergenic
934561749 2:95317210-95317232 CTGGCTGCAGAGAAGCCCTGGGG + Intronic
935935283 2:108175727-108175749 CAGACTGCAGGGGATCGACGTGG - Intergenic
936074772 2:109394811-109394833 CATGCTGCAGGGAAGCCAGGTGG - Intronic
936139275 2:109925105-109925127 CAGGCTGGAGTGCAGCGGCGCGG - Intergenic
936205421 2:110446381-110446403 CAGGCTGGAGTGCAGCGGCGCGG + Intronic
937899401 2:127006358-127006380 CAGGCTGGAGGGCAGTGGCGCGG + Intergenic
938758482 2:134401948-134401970 CAGAGTGCAGGGAAGCCCGGAGG - Intronic
942454597 2:176129539-176129561 CAGCCGGCAGGGAGGGGCCGCGG - Intergenic
943293127 2:186101392-186101414 CAGGCTGGAGGGCAGTGCAGTGG - Intergenic
944208322 2:197180481-197180503 GAGGCTGCAGGGAATGGCGGTGG - Intronic
944228664 2:197372117-197372139 CAGGCTGCAGGGCAATGCCTGGG + Intergenic
945940499 2:215944665-215944687 CAGGCTGCATTGAAACGCCTTGG - Exonic
946352610 2:219165216-219165238 CGGGCTGCTGGGAAGCCCCATGG - Exonic
946966573 2:225042757-225042779 CAGGCTGCGGGGGAGGGCGGGGG + Intergenic
947958081 2:234212471-234212493 CAGGCTGCGGGGAGGCGAGGAGG + Intergenic
947965733 2:234279978-234280000 CAGGCTGCAGGGAAGAGGTCAGG + Intergenic
947999682 2:234557531-234557553 CAGCCTGCAGGGAAGTGGGGGGG + Intergenic
948965093 2:241373141-241373163 CAGACTGCAGGGATGCGCTTGGG + Exonic
1169208348 20:3752378-3752400 CAGGCTGAAGGGACCCGCCAAGG + Exonic
1169503936 20:6188153-6188175 CAGGCTGCAGTGAAGTGGCGCGG + Intergenic
1171349336 20:24490803-24490825 CAGGCTCCAGGGCAGCACAGAGG + Intronic
1173996211 20:47340448-47340470 CAGGCTGCAGTGTAGTGCAGTGG - Intronic
1174017726 20:47502189-47502211 CGGGCTGAGGGGAAGCGGCGCGG - Intronic
1174287627 20:49483815-49483837 CAGGCTGGAGGGGAGCGGGGTGG - Intergenic
1174343792 20:49915157-49915179 CAGGCTCCTGGGACCCGCCGAGG - Intronic
1175215281 20:57389293-57389315 CAGGCGGCAGGGCAGCCCCGGGG - Intergenic
1175399555 20:58692787-58692809 CGGGCTGCCGGGCAGGGCCGGGG + Exonic
1175903279 20:62368247-62368269 CTGCCTCCAGGGAAGCCCCGAGG + Intergenic
1175988067 20:62774035-62774057 CAGGCAGCAGGGGGGCGCCTGGG + Intergenic
1176407223 21:6427436-6427458 CAGACTGCAGTGAAGTGGCGTGG - Intergenic
1177669112 21:24202346-24202368 CAGGCTGGAGTGCAGCGGCGTGG + Intergenic
1177754396 21:25328078-25328100 CGGGCTGCAGTGCAGCGGCGCGG - Intergenic
1178506533 21:33167432-33167454 CAGGCTGCTGAGAAGCACTGGGG - Intronic
1178878396 21:36429881-36429903 CAGGCTGCCTGGAGGGGCCGAGG - Intergenic
1179682730 21:43035828-43035850 CAGACTGCAGTGAAGTGGCGTGG - Intergenic
1180339656 22:11607508-11607530 CAGGCTGGAGGGCAGTGGCGTGG - Intergenic
1181081255 22:20417310-20417332 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1181182921 22:21079751-21079773 CAGCCTCCAGGAAAGTGCCGAGG - Intergenic
1182028432 22:27138307-27138329 CAGGCTGCAGAGAGGGGCCTCGG - Intergenic
1182419694 22:30242915-30242937 CAGGCTGCAGGGAAGATCACGGG + Exonic
1183829548 22:40410489-40410511 CTGGCTGCAGTGAGGCGGCGGGG + Exonic
1184103547 22:42354273-42354295 GTGGCTGCAGGGAAGTGGCGGGG - Intergenic
1184211505 22:43038503-43038525 TTTGCTACAGGGAAGCGCCGTGG - Intergenic
1184334838 22:43847076-43847098 CAGGCTGGAGAGAAGGGCCACGG - Intronic
1184364206 22:44039127-44039149 CAGGCTGGAGGGATGTGCAGTGG + Intronic
949103032 3:169088-169110 CAGGCTGGAGTGCAGCGCAGTGG + Intergenic
949581584 3:5393815-5393837 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
950158611 3:10742488-10742510 CAGGGTTCAGGGAAGCTCTGGGG + Intergenic
951878699 3:27458948-27458970 CAGGCTGGAGTGCAGTGCCGTGG - Intronic
952864622 3:37845121-37845143 CAGGCTGGAGGGCAGTGGCGTGG - Intergenic
952880639 3:37984243-37984265 CAGTCTGCAGAGAAGCTCCTGGG - Exonic
953062573 3:39439409-39439431 CAGGCTGCAGGGTAGAGCAAAGG + Intergenic
953889805 3:46743363-46743385 GAGTCTGCAGGGAAGCAGCGCGG - Intronic
954778929 3:53045540-53045562 CCGGCTGCAGGGGCGCGCCTGGG - Intronic
954808356 3:53233021-53233043 CAGGCTCCAGGGAAGGGGAGCGG - Intronic
957074052 3:75587828-75587850 CAGCTGGCAGGGAAGCGCCGGGG - Intergenic
959069331 3:101688015-101688037 CAGGCTGGAGTGAAGTGGCGCGG + Intergenic
960923459 3:122772901-122772923 CAGGCTGGAGGGCAGTGGCGTGG + Intronic
961340352 3:126213196-126213218 CTGGCTGCGGCGAAGGGCCGCGG - Intergenic
961815377 3:129547492-129547514 CAGGCTGGGGAGCAGCGCCGGGG + Exonic
963167438 3:142219922-142219944 CAGGCTGCAGTGCAGTGGCGTGG - Intronic
963919354 3:150891040-150891062 CAGGATGCCAGCAAGCGCCGCGG + Exonic
968074202 3:195807421-195807443 CAGGCTGCAGTGCAGTGGCGTGG - Intronic
968114998 3:196082341-196082363 CAGGGTGGAGGAAGGCGCCGAGG - Intergenic
968232465 3:197011869-197011891 CAGGCCCCAGGGCAGCCCCGTGG + Intronic
968549816 4:1216465-1216487 CAGGCTGCAGGGGAGTGGTGTGG - Intronic
968564089 4:1300572-1300594 CCGGCAGCACGGAAGAGCCGGGG - Intronic
968576041 4:1366656-1366678 CAGGCTGCAGGGAGGGCCCCAGG - Intronic
968645823 4:1740059-1740081 CAGGGTGCAGGGCAGGGCCAGGG - Intronic
969000098 4:3973665-3973687 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
969056998 4:4408289-4408311 CAGGCTGCTGGGAGGGGCGGTGG + Intronic
969534501 4:7747537-7747559 CAGGCTGCAGAGAAGCTGAGTGG + Intergenic
969694768 4:8728367-8728389 CCGGCAGGAGGGAAGCGCTGAGG - Intergenic
969928913 4:10611531-10611553 CAGTCTGCAGGGAAGCTGGGAGG + Intronic
970456190 4:16226479-16226501 GAGGCTGGAGGGAGGCGGCGGGG - Exonic
972404811 4:38735548-38735570 CTGGCAGCAGGGAAGAGCCTGGG + Intergenic
974006155 4:56559259-56559281 CAGGCTGGAGTGGAGCGCAGTGG - Intronic
977221087 4:94338378-94338400 CAGGCTGGAGTGAAGTGTCGCGG - Intronic
977567775 4:98598507-98598529 CAGGCTGCAGTGCAGTGGCGCGG + Intronic
983142960 4:164175761-164175783 CAAGCTGCAGGGCAGCGTGGTGG - Intronic
983162864 4:164438532-164438554 CAGGCTGGAGTGCAGTGCCGTGG - Intergenic
983834200 4:172369545-172369567 CAGGCTGCATGGGAGCACCCTGG + Intronic
983881198 4:172935158-172935180 CAGTCTGCAGGGCAGCGCTCTGG - Intronic
984019571 4:174468610-174468632 GAGGCTGCAGGGAGGCACCCAGG + Intergenic
984123784 4:175780085-175780107 CAGGCTGGAGTGAAGTGGCGTGG + Intronic
984126471 4:175816902-175816924 CAGGCTGGAGTGCAGCGGCGCGG + Intronic
984996356 4:185434177-185434199 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
986325507 5:6670286-6670308 CAAGCTGCAGGGAAGCCAGGGGG + Intergenic
987085098 5:14460922-14460944 CAGGCTGCAGGGAAGCCAGTGGG - Intronic
987784251 5:22478371-22478393 CAGGCTGGAGGGCAGTGGCGCGG - Intronic
990414815 5:55575859-55575881 CAGACTGGAGGGCAGCGGCGTGG + Intergenic
990816743 5:59794441-59794463 CAGGCTGCCGGGAAGCACCAGGG - Intronic
992377866 5:76206961-76206983 CAGGCTGCAAGGAAGTGCTAAGG - Intronic
993901983 5:93590376-93590398 CAGGCTGCAGGGAAACACTGTGG + Intronic
997261154 5:132466480-132466502 CAGGCTGCACCGAAGCGGTGTGG + Intronic
997512975 5:134465951-134465973 CCGGCCGCAAGGAAGCTCCGCGG - Intergenic
997599091 5:135127287-135127309 CTGCCTGCAGGGAAGGGCCTGGG + Intronic
999209577 5:149876393-149876415 CAGGCTGGAGGGCAGTGCAGTGG + Intronic
999693944 5:154171749-154171771 CAGCCTGCAGGGAAGCCACCAGG - Intronic
1000330316 5:160200362-160200384 GAGGCTGCAGGGAACAGCAGAGG + Intronic
1000637667 5:163662207-163662229 CAGGCTGGAGTGAAGTGCAGTGG - Intergenic
1000759462 5:165204297-165204319 CAGGCTGGAGGGCAGTGGCGCGG - Intergenic
1002081280 5:176739066-176739088 CAGGTTGCAGGGAATCGCCAGGG - Intergenic
1002456028 5:179345700-179345722 GCGGCGGCAGAGAAGCGCCGCGG + Intergenic
1002781971 6:373915-373937 CAGGAAGCAGGGACACGCCGTGG - Intergenic
1002890162 6:1325082-1325104 CAGGGTGCAGGGAAGGGTCATGG - Intergenic
1003256844 6:4482553-4482575 GATGCTGCTGGGAGGCGCCGGGG + Intergenic
1003854518 6:10259382-10259404 GAGGCTGCAGGGAAGGGCAGAGG + Intergenic
1004497818 6:16181098-16181120 CAGCCTGCAGGGAAGTGTGGCGG - Intergenic
1004897456 6:20162353-20162375 CAGGCAGATGGGAAGCTCCGAGG - Intronic
1005374151 6:25164982-25165004 CAGGCTGGAGGGCAGTGGCGTGG + Intergenic
1005596307 6:27381691-27381713 CAGGCTGCAGGGCAGTGGCACGG - Intronic
1006289035 6:33120195-33120217 CAGGCGGCAGGGAAGCCTCAAGG - Intergenic
1007018679 6:38496607-38496629 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1011256410 6:85426343-85426365 CAGGCTGCAGTGCAGTGCCTCGG + Intergenic
1011390584 6:86848159-86848181 CAGGCCGCAGGGAAGCACTCAGG + Intergenic
1011492480 6:87906658-87906680 GTGGCTGCAGGGAAGCACCTTGG + Intergenic
1011557603 6:88586796-88586818 CAGGCAGCTGGGAAGGGCGGGGG - Intergenic
1013194509 6:107833401-107833423 GAGGCTGCAGGCAAGCACTGGGG + Intergenic
1013256948 6:108397071-108397093 CAGGCTGGAGGGCAGTGGCGTGG + Intronic
1013311208 6:108895437-108895459 CAGGCTGGAGTGCAGCGGCGTGG - Intronic
1013314942 6:108932571-108932593 CAGGCTGGAGGGCAGTGGCGCGG + Intronic
1013604310 6:111733716-111733738 CAGGCTGCTGAGTAGCCCCGTGG + Intronic
1013619299 6:111872940-111872962 CAGGCGGCGGGGATGCGTCGCGG - Intronic
1014508079 6:122283777-122283799 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
1015465256 6:133542081-133542103 CAGGATGCAGGGGATCGCTGGGG + Intergenic
1015863395 6:137703414-137703436 CAGACTGCAGGGAATGGCAGTGG - Intergenic
1016481271 6:144484485-144484507 CAGGCTGGAGGGCAGTGGCGTGG + Intronic
1016485175 6:144529289-144529311 CATGCTGCATGGGAGAGCCGAGG - Intronic
1017114553 6:150964886-150964908 CAGGCTGGAGAGAAGTGCCAAGG + Intronic
1017426706 6:154329544-154329566 CAGGCTGGAGGGCAGTGGCGCGG - Intronic
1018435670 6:163756582-163756604 CAGGCTGGAGTGAAGTGCCAAGG + Intergenic
1018877375 6:167834940-167834962 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1019005064 6:168789945-168789967 CAGGCTGCAAGCAAGGGCAGTGG - Intergenic
1019648715 7:2144694-2144716 GAGGCTACAGGGCAGCCCCGGGG + Intronic
1019679224 7:2335756-2335778 CAGGCTGGAGTGCAGTGCCGCGG - Intronic
1019776954 7:2917514-2917536 AAGGCTGCAGGCAAGGGGCGGGG + Intronic
1020151127 7:5682450-5682472 CAGGCTGCAGTGCAGTGGCGCGG + Intronic
1022729052 7:33005842-33005864 CAGGCTGCTGGGAAGAGCCATGG - Exonic
1024223084 7:47303356-47303378 CTGGCTGCTGGGAGGCGCCAGGG + Exonic
1024863088 7:53868757-53868779 CAGGCTGCAGTGCAGTGCCGCGG - Intergenic
1025044599 7:55682136-55682158 CAGGCTGCTGGGAAGAGCCATGG + Intergenic
1025086325 7:56026442-56026464 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1026534696 7:71230025-71230047 GAGGCTGCAAGGAAGAGCCAAGG + Intronic
1026648754 7:72196155-72196177 CAGGCTCCAGTGGAGCGCAGTGG + Intronic
1027162599 7:75813544-75813566 GGGGCTGGAGGGAAGCGCTGGGG - Intronic
1029222334 7:99000485-99000507 CAGGCTGGAGGGAAACACTGTGG - Intronic
1029506052 7:100964851-100964873 CAGGCTGGAGGGAGGGGCCAGGG + Intronic
1029747463 7:102524326-102524348 CAGGCTGGAGTGCAGCGGCGTGG + Intergenic
1029765416 7:102623416-102623438 CAGGCTGGAGTGCAGCGGCGTGG + Intronic
1030494969 7:110287644-110287666 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1032222330 7:130004014-130004036 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
1032265604 7:130368040-130368062 CTGGCTGCAGGGCAGTGCCAAGG + Intronic
1032466624 7:132150012-132150034 CAGGCAGCAGGGAAGCCCCAGGG - Intronic
1032506042 7:132435444-132435466 CAGGCTGCTTGGGAGCCCCGTGG - Intronic
1033477732 7:141706884-141706906 GAGGCTGTAGGGAAGGGCCAAGG + Intergenic
1034490134 7:151388726-151388748 CAGGCTTCAGGGAAGCAGGGAGG + Intronic
1034522817 7:151633045-151633067 CACTCTGCAGGGATGGGCCGTGG - Intronic
1034590139 7:152131641-152131663 CAGGCTGCAGGGTCGTGCCAGGG + Intergenic
1035362388 7:158322180-158322202 CAGGATGCAGGGCAGAGCTGTGG - Intronic
1035389606 7:158496406-158496428 GAGGCTGCAGGGAAGGGGAGGGG - Intronic
1036200890 8:6770983-6771005 CAGGCTGCAGTGCAGTGGCGTGG - Intergenic
1036377140 8:8210291-8210313 CAGGCTGCCTGGAAGGGACGCGG - Intergenic
1036852409 8:12212858-12212880 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
1036873777 8:12455381-12455403 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
1037023207 8:13999733-13999755 CAGGCTGGAGGGCAGTGGCGCGG + Intergenic
1037703643 8:21297049-21297071 CAGGCTGGAGTGCAGTGCCGTGG + Intergenic
1038152974 8:24958864-24958886 AAGGCTTCAGGGAGGAGCCGCGG - Intergenic
1038419397 8:27422617-27422639 CAGCCTGCAGGCAAGAGCAGTGG - Intronic
1038575904 8:28702580-28702602 CAGGTTGCGGGGAAGGGCGGGGG - Intronic
1038888649 8:31693880-31693902 CAGGCTGGAGGGCAGTGGCGAGG + Intronic
1040324252 8:46333686-46333708 CAGGCTGCAGGGACTCACAGGGG + Intergenic
1042284416 8:67092480-67092502 CAGGCTGGAGGGCAGTGGCGGGG + Intronic
1042962684 8:74320829-74320851 CCGGCTGCGGGGAAGCGGGGAGG - Intronic
1043769743 8:84183416-84183438 CAGGCAGCGGGGAAGGACCGAGG - Intronic
1045500164 8:102738668-102738690 CAGGCGCCCGGGAAGAGCCGGGG + Intergenic
1045850283 8:106687667-106687689 CAGGCTGAAGGGCAGTGGCGTGG - Intronic
1045856809 8:106773694-106773716 CAGGCTGAAGTGAAGTGCCATGG + Intergenic
1046451550 8:114398273-114398295 CAGGCTGGAGTGCAGCGCAGTGG + Intergenic
1047329853 8:123876983-123877005 CAGGATGCAGAGAAGCACAGAGG - Intronic
1048054254 8:130848350-130848372 CAGGCTGCAGAGAAGCAGCCAGG - Intronic
1048881708 8:138877247-138877269 TGGGCTGCTGGGAAGAGCCGAGG + Intronic
1049022908 8:139970149-139970171 AAGGCTGAAGGGAAGCACCTCGG + Intronic
1049368937 8:142254319-142254341 CAGGCAGCAGGGAGAGGCCGGGG - Intronic
1049428789 8:142549736-142549758 CAGGCTGCAGAGCAGGGCTGTGG - Intergenic
1049451802 8:142666024-142666046 CCGGCTGCCGGGAAGAGCAGAGG - Exonic
1049591875 8:143466384-143466406 CTGGCTGCAGGCCAGCACCGTGG + Intronic
1049710399 8:144060602-144060624 GAGGCAGCGGGGAAGGGCCGCGG + Intronic
1049807144 8:144546241-144546263 AAGGCTGGAGGGAAGGGCCTGGG - Intronic
1050444070 9:5699384-5699406 CAAGCTGCTGGGATGGGCCGTGG + Intronic
1050767379 9:9151434-9151456 CAGGCTGCAGGCAGGCGTCTGGG + Intronic
1052913097 9:33901956-33901978 CAGGCTGGAATGAAGCGGCGCGG + Intronic
1055207191 9:73746599-73746621 AAGGCTGCAGGGCAGTGGCGTGG + Intergenic
1056986246 9:91365879-91365901 CAGGCTGGAGGGCAGTGGCGTGG + Intergenic
1057484443 9:95471664-95471686 CAGGCTGCAGAGCAGCTCAGTGG + Intronic
1061202722 9:129146855-129146877 CAGGCTGCTGGGAATTGCCCAGG + Intronic
1061213690 9:129208094-129208116 CAGGCTGGAGGGGAGTGCAGTGG + Intergenic
1061491333 9:130946268-130946290 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1061675798 9:132214914-132214936 CAGGCTGAAGGGCAGTGCAGTGG + Intronic
1061817419 9:133205441-133205463 GAGGCTGCAGGGTAGGGCAGAGG + Exonic
1062074195 9:134575605-134575627 GAGGCTGCAGGGAGGCACCCAGG - Intergenic
1062242984 9:135549785-135549807 GAGGCTGCAGGGTAGGGCAGAGG - Exonic
1062291450 9:135797064-135797086 CAGGCTGCAGGGGAGCCACAGGG + Intergenic
1062312777 9:135948228-135948250 CAGGCTGCAGCTGAGCCCCGAGG + Intronic
1062443030 9:136579543-136579565 GAGGCTGCAGGTGAGCGCAGGGG - Intergenic
1062726333 9:138076119-138076141 CAGGCTGAAGGGAAGCCCTGAGG + Intronic
1185555532 X:1018332-1018354 CAGGCTGGAGGGCAGTGGCGCGG + Intergenic
1185583853 X:1230683-1230705 CAGGCTGGAGTGCAGTGCCGCGG - Intergenic
1186168834 X:6856040-6856062 CAGGCTTCTGGGAAGCCCTGTGG + Intergenic
1187055424 X:15738004-15738026 CAGGCTAGAGGGAAGAGCCCAGG + Intronic
1187226305 X:17377191-17377213 CGGGCTGCAGGGAAACGACGAGG + Intronic
1188270660 X:28136437-28136459 CAGGCTGGAGTGAAGCAGCGTGG + Intergenic
1190272473 X:48876682-48876704 CAGGCTGGAGTGAAGTGCAGTGG - Intergenic
1190879900 X:54484637-54484659 AAGGCTGCAGGGCATAGCCGGGG - Intronic
1192125817 X:68499680-68499702 CAGGCTGGAGGGCAGTGGCGCGG + Intronic
1194593245 X:95826973-95826995 CAGGCTGCAGTGCAGTGGCGCGG + Intergenic
1194673650 X:96767026-96767048 CAGGCTTCATGGAAGAGCTGTGG - Intronic
1195285384 X:103377582-103377604 CAGCCTGCAGGAAATCGACGGGG + Exonic
1196394969 X:115249662-115249684 CAGGCTGCAGTGCAGCGGCACGG - Intergenic
1196804936 X:119575104-119575126 CAGGCTCCGGGGAGGCGCCTAGG - Intronic
1200773181 Y:7146121-7146143 CAGCCTGCAGGGAAGCCCTGGGG - Intergenic