ID: 1151756754

View in Genome Browser
Species Human (GRCh38)
Location 17:76079623-76079645
Sequence AGGAGACCCCAGCACTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 52, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151756754_1151756756 11 Left 1151756754 17:76079623-76079645 CCTGGATAGTGCTGGGGTCTCCT 0: 1
1: 0
2: 0
3: 52
4: 173
Right 1151756756 17:76079657-76079679 TCAACACAGCGCTCACCCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151756754 Original CRISPR AGGAGACCCCAGCACTATCC AGG (reversed) Intronic
900748317 1:4376743-4376765 AGGAGACCCCAGGCCCATCTTGG + Intergenic
901101372 1:6721551-6721573 AGGAGGCCCCAGCACGCTACTGG + Intergenic
901757930 1:11452581-11452603 AGGAGAAGCGAGCCCTATCCAGG + Intergenic
904459716 1:30669018-30669040 AGGAGGCCACAGCAGTAACCTGG - Intergenic
904809950 1:33156981-33157003 AGGAGACCACTGCATAATCCAGG - Intronic
906242105 1:44248396-44248418 CGGAGCCCCCAGCACTTTGCTGG + Intronic
913042527 1:115041250-115041272 AGGTGACACCAGCACTCTCGTGG - Intergenic
914314767 1:146499879-146499901 AGGAGTCCAGAGCACTAACCAGG - Intergenic
914379319 1:147102427-147102449 AGGAGTCCAGAGCACTAACCAGG - Intergenic
914499584 1:148233509-148233531 AGGAGTCCAGAGCACTAACCAGG + Intergenic
914673583 1:149890513-149890535 AGGGGACCCCACCACAATCCTGG + Intronic
915656053 1:157361326-157361348 AGGAGACCACTACACGATCCAGG + Intergenic
915673279 1:157508577-157508599 AGGAGACCACTACACCATCCAGG - Intergenic
915856939 1:159397943-159397965 GGCAAGCCCCAGCACTATCCTGG + Intergenic
917796821 1:178538701-178538723 AGGGGCCCCCTGCACTATGCTGG - Intronic
918047115 1:180948184-180948206 CGGAGGCCCCAGCACTCGCCAGG - Exonic
918574793 1:186044689-186044711 ATGAAACCCCATCACTATGCAGG - Intronic
920400001 1:205670532-205670554 GGGGGACCCCAGCCCCATCCCGG + Intronic
921317781 1:213908296-213908318 AAGAGACCCCAGTGCTACCCAGG - Intergenic
922323724 1:224509919-224509941 AGGAGACACCACCACTTTCTGGG - Intronic
923852579 1:237813467-237813489 GGGAGACCCCAGCAACATCCTGG + Intronic
1064850213 10:19701352-19701374 ATGATTCCCCAGAACTATCCGGG - Intronic
1065917884 10:30367683-30367705 AGGTGACCCCAGCTCCCTCCAGG - Intronic
1069715057 10:70515291-70515313 AGGAGGCCCCAGCTCTGTTCTGG - Intronic
1070945545 10:80388471-80388493 AGGAGACCTCAGCAGTAGCCTGG + Intergenic
1071809546 10:89164506-89164528 ATGAGGTCCCAGCACTGTCCTGG - Intergenic
1071952893 10:90725093-90725115 AGGAGACACCATAAATATCCAGG - Intergenic
1072785464 10:98276847-98276869 GTGTGACCCCAGCACTGTCCTGG - Intergenic
1075732679 10:124645711-124645733 AGGAGACCCCAGCATCACCCGGG + Intronic
1076869400 10:133186038-133186060 CGGGGACCCCAGCACTGACCCGG + Exonic
1077598357 11:3554191-3554213 AATAGACCCCAGGAATATCCTGG - Intergenic
1077887476 11:6396256-6396278 AGGATACCCCAGCTCTACCCTGG + Intronic
1084254437 11:67930055-67930077 AAGAGACCCCAGGAATATCCTGG - Intergenic
1084818431 11:71665828-71665850 AAGAGACCCCAGGAATATCCTGG + Intergenic
1090851533 11:130575026-130575048 AGGAGAGCCTTGCACTTTCCTGG - Intergenic
1093102022 12:15038746-15038768 AGGAGACCCCACTACTGTCATGG - Intergenic
1099732873 12:86526851-86526873 AGGAGACCCCTGCACCACCATGG - Intronic
1100981445 12:100165855-100165877 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1102631677 12:114286393-114286415 GGGAGACCCCACAACTATACTGG + Intergenic
1103940585 12:124499370-124499392 AGAAGTCCCCAGCACTAGCCCGG - Intronic
1104990974 12:132623665-132623687 AGGCGGCCCCAGCAGCATCCAGG + Intergenic
1105444135 13:20437932-20437954 TGGAGACCTCAGCACTTTCTAGG - Intronic
1106591791 13:31104627-31104649 AGGAAACCCAAGCACTGGCCGGG - Intergenic
1112744635 13:102512688-102512710 AGGTGAGCCCAGTACCATCCAGG + Intergenic
1117702413 14:58426967-58426989 GGGAGACCCCGCCACTTTCCTGG + Intronic
1118444283 14:65837608-65837630 TGGAGAAGCCAGCACTATGCTGG + Intergenic
1118639677 14:67780611-67780633 AGGTGACCCCAGAACAATCTGGG - Intronic
1118732338 14:68677249-68677271 AGAGGACCCCATCAGTATCCAGG + Intronic
1119656114 14:76418315-76418337 AGGAGTCCTCTGCACTATCTTGG - Intronic
1119935512 14:78589106-78589128 TGGAGACCCCAGTCCTTTCCAGG - Intronic
1121760119 14:96437650-96437672 ACGACACCCCCGCACTATTCAGG - Intronic
1122782486 14:104149546-104149568 GGGAGGCCCCAGCCCTATCCAGG - Intronic
1122790593 14:104182691-104182713 CTCAGACCCCAGCACTGTCCTGG - Intergenic
1123108983 14:105856489-105856511 AGGAGACCCCAGGTCTGTCCAGG - Intergenic
1123473167 15:20569516-20569538 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1123644839 15:22430837-22430859 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1123733468 15:23164527-23164549 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1123751598 15:23361902-23361924 AGGTGACCCCAGCACCCTCCAGG + Intronic
1124283971 15:28385827-28385849 AGGTGACCCCAGCACCCTCCAGG + Intronic
1124298726 15:28525787-28525809 AGGTGACCCCAGCACCCTCCAGG - Intronic
1124564055 15:30798887-30798909 TGGTGACCCCAGCACCATCCAGG + Intergenic
1125980437 15:43995884-43995906 AGTAGACCCCAGCACTGGGCTGG - Intronic
1127842988 15:62846567-62846589 AGGAGCCCCCAGCACATCCCAGG - Intergenic
1128403399 15:67309308-67309330 AGGAGACCTCAGCAATATTCTGG - Intronic
1128820356 15:70646824-70646846 AGGAGAGCCCAGTACTATGAGGG + Intergenic
1129475779 15:75783797-75783819 AGCTGACCCCAGCACCCTCCAGG + Intergenic
1129728900 15:77918292-77918314 AGGTGACCCCAGCATCCTCCAGG - Intergenic
1129839613 15:78735569-78735591 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1129989817 15:79952014-79952036 AGGCGACCCCAGCACTGTGGAGG + Intergenic
1130259451 15:82344128-82344150 AGGTGACCCCAGCACCCTCCGGG - Intronic
1130269227 15:82435040-82435062 AGGTGACCCCAGCACCCTCCGGG + Intronic
1130281815 15:82525057-82525079 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130473182 15:84241220-84241242 AGGTGACCCCAGCACCCTCCGGG + Intronic
1130480597 15:84355285-84355307 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130484792 15:84392721-84392743 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1130491115 15:84432474-84432496 AGGTGACCCCAGCACCCTCCGGG - Intergenic
1130502699 15:84511274-84511296 AGGTGACCCCAGCACCCTCCGGG - Intergenic
1130595467 15:85245810-85245832 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1131188103 15:90292572-90292594 AGGTGACCCCAGCACCCTCCAGG + Intronic
1131282682 15:91033893-91033915 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1131296356 15:91153016-91153038 ATGAGAACCCAGCACCATCTTGG - Intronic
1131438269 15:92439923-92439945 AGGAGTGCCCAGCAGTATCCGGG + Intronic
1132432850 15:101774822-101774844 AGGTGACCTCAGCACCCTCCAGG - Intergenic
1132526365 16:417611-417633 TGAAGCCCTCAGCACTATCCAGG + Intergenic
1133373748 16:5266469-5266491 AAGAGACCCCAGGAATATCCTGG + Intergenic
1137590222 16:49688961-49688983 AGGAGCCACCTGCACTACCCTGG + Intronic
1138338676 16:56272844-56272866 AGCAGACCCTACCACTCTCCTGG - Intronic
1143252631 17:5534473-5534495 ATGACACCCCAGCTCTAGCCTGG - Intronic
1146689121 17:34860997-34861019 AGGAGACCACAGCATATTCCAGG - Intergenic
1148952583 17:51326866-51326888 AGGAGACCCCATCTCTATTCAGG - Intergenic
1151212765 17:72557121-72557143 GACAGACCCCAGCAATATCCAGG + Intergenic
1151756754 17:76079623-76079645 AGGAGACCCCAGCACTATCCAGG - Intronic
1152322111 17:79613435-79613457 AGGACATACCAGCACTAACCGGG + Intergenic
1153622384 18:6990986-6991008 AAGAGAAGCCAGCACTCTCCTGG + Intronic
1155388565 18:25308223-25308245 TGGATACCCCAGCCCCATCCAGG + Intronic
1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG + Intronic
1157914947 18:51655403-51655425 AGGAGAACCCAGGACAACCCAGG - Intergenic
1157929479 18:51805397-51805419 AGCAGACCCTAGCAATAGCCCGG - Intergenic
1161261415 19:3339896-3339918 AGGAGACCCCAGCCCTGCTCTGG + Intergenic
1165768978 19:38367546-38367568 AGGAGACTCCGGCAGTTTCCAGG + Exonic
1166049443 19:40249261-40249283 AGGAGACCCCGGCATCCTCCAGG + Intronic
1166960182 19:46492443-46492465 AGGAAACCCCAGCCCTGCCCTGG - Exonic
1167724650 19:51201781-51201803 AGGAGAGACCAGCACTATGGAGG - Intergenic
1168311305 19:55462161-55462183 AAGATACCCAAGCACTTTCCAGG + Intronic
1168695570 19:58402166-58402188 AGAGGACCTCAGCACTAACCAGG - Intronic
925190426 2:1877857-1877879 GGGGGACCCCAGCACTTCCCTGG - Intronic
925298803 2:2795529-2795551 AGGAGCCGCCTGCACCATCCCGG - Intergenic
925298813 2:2795558-2795580 AGGAGCCGCCCGCACCATCCCGG - Intergenic
925298823 2:2795587-2795609 AGGAGCCGCCCGCACCATCCCGG - Intergenic
927132911 2:20075505-20075527 ACTAAACCCCAGCACTAACCAGG - Intergenic
928224377 2:29435322-29435344 AGGAGTCTTCAGCACCATCCAGG + Intronic
934558025 2:95297606-95297628 AGGACACCCCAGCGCCAGCCAGG - Intronic
934558041 2:95297666-95297688 AGGACACCCCAACACCAGCCAGG - Intronic
934664433 2:96159718-96159740 GAGAGACCCCACCTCTATCCTGG + Intergenic
935204622 2:100887159-100887181 AGGAGGGCCCAGCACAAACCTGG - Intronic
935831980 2:107009875-107009897 AGGAGACACCTGAACCATCCAGG - Intergenic
937943638 2:127311056-127311078 AAGAGACCCCACCCCTATCACGG + Intronic
941004957 2:160238398-160238420 ATGACACCGCAGCACTGTCCTGG - Intronic
947015543 2:225615784-225615806 AGAAGGCCCCAGCACTTGCCTGG - Intronic
947015605 2:225616424-225616446 AGAAGCCCCCAGCACTTGCCTGG + Intronic
947743891 2:232497747-232497769 AGGAGCCCCCAGCCCTGCCCGGG + Intergenic
1168765984 20:381720-381742 AGGGCACCCCAGCCCTGTCCCGG - Intronic
1170569069 20:17622724-17622746 GGGAGAGCCCAGCTCTCTCCCGG - Intronic
1173708735 20:45135953-45135975 AGTAGACCGCAGCACTAGACTGG - Intergenic
1175864859 20:62169984-62170006 AGGCGGCCCCAGCACTGCCCAGG - Intronic
1177200667 21:17952053-17952075 GGGAGACCCCATCTCTAGCCAGG + Intronic
1179606444 21:42518673-42518695 AGGACACCTCAGCACTGTTCTGG - Intronic
1179919877 21:44502171-44502193 AGGAGACCTCAGCCCTGGCCCGG + Intronic
1180917108 22:19496998-19497020 AGGAGACCCCATCATTTGCCTGG - Intronic
1181507256 22:23367995-23368017 CTGAGACCCCAGAAATATCCAGG - Intergenic
1181761177 22:25059794-25059816 AGGGGACCCCTGCACTCTCAGGG + Intronic
1182675999 22:32040460-32040482 GGGAGAACCCAGCATTATGCAGG - Intergenic
1183077681 22:35437105-35437127 AGGAGAGCCCAGCATCCTCCTGG - Intergenic
1183230576 22:36579519-36579541 AGGAGACCACAGCTATCTCCAGG - Intronic
1184252257 22:43267589-43267611 AAGAGACCCCAGCACTAGCAGGG + Intronic
1184678224 22:46054708-46054730 TGGAGACCCCAGCCCTGTACCGG + Intronic
950198784 3:11028346-11028368 TGGAGACCTCAGCATTGTCCTGG + Intronic
950316729 3:12007820-12007842 TGGAGACCCCACCACTGACCAGG + Intronic
950684048 3:14603730-14603752 AGGAGCCCTCAGCTCTGTCCTGG + Intergenic
950752091 3:15137656-15137678 AAGAGACCCCAGGAATATCCTGG + Intergenic
953447876 3:42983000-42983022 AGGAGACCCGGGCCCTAGCCTGG - Intronic
954289828 3:49643741-49643763 AGGAGAGCCCAGCCCCAGCCTGG - Intronic
956996437 3:74831325-74831347 TGGAGAGCCCAGCAAAATCCAGG - Intergenic
957068516 3:75546629-75546651 AAGAGACCCCAGGAATATCCTGG - Intergenic
959174546 3:102889907-102889929 AGGAAGCCCCTGCACTTTCCTGG - Intergenic
961284898 3:125793655-125793677 AAGAGACCCCAGGAATATCCTGG + Intergenic
962393851 3:134997322-134997344 AGGAGACCCCAGACATATCCTGG - Intronic
968613551 4:1567572-1567594 AGGAGATCCCAGGACTCTGCTGG - Intergenic
969012857 4:4081180-4081202 AAGAGACCCCAGGAATATCCTGG - Intergenic
969741001 4:9026587-9026609 AAGAGACCCCAGGAATATCCTGG + Intergenic
969800342 4:9559458-9559480 AGGAGATCCCAGGAATATCCTGG + Intergenic
970142362 4:12996437-12996459 AGGAGCCCCCAGCACCACCAGGG + Intergenic
981081775 4:140644212-140644234 GGAAGCCCCCAGCACTTTCCAGG - Intronic
982659162 4:158186420-158186442 AATAGACCCCATCACTGTCCTGG + Intergenic
985704375 5:1392042-1392064 AGGAAACCCCAGGGTTATCCTGG - Intergenic
986622564 5:9691137-9691159 AGGGGCCCCCAGCATAATCCAGG - Intronic
988348694 5:30072478-30072500 AGGAATCCACAGCACTTTCCAGG - Intergenic
990566793 5:57037669-57037691 TGGAGACATCAGCACTACCCAGG + Intergenic
999083300 5:148864358-148864380 AGGAGACCACAGCCCTATCAAGG - Intergenic
1000569596 5:162895628-162895650 AGGATAACCCTGCTCTATCCAGG - Intergenic
1000642403 5:163718387-163718409 AGGAGACCCCACCACTCCCATGG + Intergenic
1004316868 6:14596594-14596616 AGGAAACCCCAGCTCCATGCTGG - Intergenic
1005142432 6:22648767-22648789 AGTACCCCCCAGAACTATCCTGG - Intergenic
1011557556 6:88586439-88586461 AGGAGAGCCCAGCTCCTTCCTGG + Intergenic
1015683442 6:135833443-135833465 AGGAGAGCTCTACACTATCCTGG + Intergenic
1016588473 6:145716564-145716586 AGAAGACCCTACCCCTATCCTGG + Intronic
1024629894 7:51238362-51238384 AGGAGACCCCTGCCCTTCCCTGG + Intronic
1024670375 7:51588671-51588693 AGCAGACCCCTGCACTCTCCTGG - Intergenic
1024801686 7:53087148-53087170 AGGAGCCCCCAGGTCTTTCCTGG - Intergenic
1024837496 7:53539514-53539536 AGGAGCCGCCAACACTGTCCAGG + Intergenic
1026513857 7:71049805-71049827 TGTAGACCCCAGCACTAAACTGG + Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1029071506 7:97902807-97902829 AAGAGACCCCAGGAATATCCTGG - Intergenic
1029444076 7:100603252-100603274 GGGACACCCCAGCCCTGTCCTGG + Intronic
1034362021 7:150508225-150508247 AGGAGACCAAACCACGATCCTGG - Intergenic
1035099170 7:156382361-156382383 AGGGGACCCCAGCACCAACTCGG - Intergenic
1035595340 8:853386-853408 AGCAGACCCCAGCACAACCCTGG - Intergenic
1035637401 8:1156767-1156789 AGGAGACGTCAGCACCAGCCGGG - Intergenic
1036246202 8:7119178-7119200 AAGAGACCCCAGGAACATCCTGG + Intergenic
1036254597 8:7195251-7195273 AAAAGACCCCAGGAATATCCTGG - Intergenic
1036362894 8:8092237-8092259 AAAAGACCCCAGGAATATCCTGG + Intergenic
1036888065 8:12574836-12574858 AAGAGACCCCAGGAATATCCTGG - Intergenic
1036895668 8:12632951-12632973 AAGAGACCCCAGGAATATCCTGG - Intergenic
1038252619 8:25919807-25919829 AGGAGAACCCAGCAACCTCCTGG + Intronic
1040293857 8:46139176-46139198 AGAAGAGCCCAGATCTATCCCGG - Intergenic
1040295239 8:46145589-46145611 AGAAGACCCCAGAGCTGTCCTGG - Intergenic
1040300386 8:46184931-46184953 AGAAGTCCCCAGGACTGTCCTGG - Intergenic
1040303477 8:46200156-46200178 AGAAGCCCCCAGGACTGTCCTGG + Intergenic
1040305421 8:46209391-46209413 AGAAGCCCCCAGGACTGTCCCGG + Intergenic
1040307032 8:46217444-46217466 AGAAGTCCCCAGGACTGTCCTGG + Intergenic
1040308303 8:46223625-46223647 AGAAGACCCCAGAAGTGTCCAGG + Intergenic
1040308573 8:46224916-46224938 AGAAGTCCCCAGGACTGTCCTGG + Intergenic
1040309315 8:46228566-46228588 AGAAGCCCCCAGGACTGTCCCGG + Intergenic
1040310825 8:46235986-46236008 AGGAGCCCCCAGGTCTGTCCAGG + Intergenic
1040310912 8:46236419-46236441 AGAAGACCCCAGGGCTGTCCAGG + Intergenic
1040313105 8:46246983-46247005 AGAAGCCCCCAGAACTGTCCAGG + Intergenic
1040316003 8:46261245-46261267 AGGAGCCCCCAGGACTGCCCCGG + Intergenic
1040316403 8:46263202-46263224 AGGAGCCCCCAGGGCTGTCCTGG + Intergenic
1040325320 8:46338688-46338710 AGAAGCCACCAGCACTCTCCCGG + Intergenic
1040325374 8:46338905-46338927 AGGAGATCCCAGGGCTGTCCTGG + Intergenic
1040335325 8:46413103-46413125 AGAAGCCCCCAGGACTGTCCTGG + Intergenic
1040337328 8:46422725-46422747 AGAAGTCCCCAGGGCTATCCGGG + Intergenic
1040341172 8:46441859-46441881 AGAAGACCCCAGGGCTGTCCCGG - Intergenic
1045299518 8:100899218-100899240 AGGAGACACCAGCTCTACCTGGG - Intergenic
1048058488 8:130892592-130892614 AGGATATCCAAGCACAATCCTGG + Intronic
1051837214 9:21353699-21353721 ATAAGTCCCCAGCACAATCCAGG - Intergenic
1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG + Intergenic
1057830721 9:98404490-98404512 AGCAGATCCCAGCGCCATCCAGG - Intronic
1058869499 9:109190194-109190216 CTGAGGCCCCACCACTATCCTGG - Intronic
1060875828 9:127083011-127083033 TGCTGACCCCTGCACTATCCCGG - Intronic
1061062966 9:128259960-128259982 AGGTGACCCCAGCACCCTCCAGG - Intronic
1061238403 9:129355179-129355201 AGGAGACCCCCCCACTCTCGGGG + Intergenic
1061494174 9:130962317-130962339 TGGAGACCCCAGAAATATCAGGG + Intergenic
1062510300 9:136901739-136901761 AGGAGATCCCAGCTCTGGCCCGG - Intronic
1062611236 9:137374623-137374645 AGGAGACCTCAGCGCTGTCCAGG + Intronic
1186472777 X:9834265-9834287 AGGCTTCCCCAGCACTCTCCTGG - Intronic
1187245004 X:17546101-17546123 CTGAGACACCAGCACTAGCCAGG - Intronic
1191834180 X:65446318-65446340 AGGTGACACAAGCACTATCTTGG + Intronic
1191987816 X:67001249-67001271 AGTAGACCCCATCACTAGACTGG + Intergenic
1192788243 X:74354899-74354921 AGTAGACCCCTGCACTAGCATGG + Intergenic
1195724317 X:107898661-107898683 AGGGAAACCCAGCACTATGCTGG + Intronic
1195732297 X:107979781-107979803 AGAAGACACCAGCACCATGCAGG - Intergenic
1199032178 X:143013545-143013567 AGGAGATCCCAGCACTCCCTTGG - Intergenic
1202114146 Y:21453968-21453990 TGGAGGCCCAGGCACTATCCAGG - Intergenic
1202373306 Y:24212566-24212588 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1202497476 Y:25457554-25457576 AGGTGACCCCAGCACCCTCCAGG + Intergenic