ID: 1151758650

View in Genome Browser
Species Human (GRCh38)
Location 17:76088647-76088669
Sequence ACTTCTGCTCTGAAGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 185}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151758650_1151758662 15 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758662 17:76088685-76088707 GGGTTCTCCCAGGGAGGGATGGG 0: 1
1: 0
2: 1
3: 18
4: 260
1151758650_1151758654 -7 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758654 17:76088663-76088685 CAGAAGTGTGGGACAGAGAATGG 0: 1
1: 0
2: 5
3: 57
4: 585
1151758650_1151758661 14 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758661 17:76088684-76088706 GGGGTTCTCCCAGGGAGGGATGG 0: 1
1: 0
2: 3
3: 32
4: 388
1151758650_1151758656 -5 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758656 17:76088665-76088687 GAAGTGTGGGACAGAGAATGGGG 0: 1
1: 0
2: 5
3: 50
4: 453
1151758650_1151758655 -6 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758655 17:76088664-76088686 AGAAGTGTGGGACAGAGAATGGG 0: 1
1: 0
2: 3
3: 40
4: 415
1151758650_1151758659 9 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758659 17:76088679-76088701 AGAATGGGGTTCTCCCAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 206
1151758650_1151758657 5 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758657 17:76088675-76088697 ACAGAGAATGGGGTTCTCCCAGG 0: 1
1: 0
2: 0
3: 33
4: 241
1151758650_1151758658 6 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758658 17:76088676-76088698 CAGAGAATGGGGTTCTCCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 195
1151758650_1151758663 16 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758663 17:76088686-76088708 GGTTCTCCCAGGGAGGGATGGGG 0: 1
1: 0
2: 6
3: 41
4: 370
1151758650_1151758660 10 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758660 17:76088680-76088702 GAATGGGGTTCTCCCAGGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 196
1151758650_1151758664 19 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758664 17:76088689-76088711 TCTCCCAGGGAGGGATGGGGCGG 0: 1
1: 0
2: 3
3: 52
4: 574
1151758650_1151758667 29 Left 1151758650 17:76088647-76088669 CCATGCACCTTCAGAGCAGAAGT 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1151758667 17:76088699-76088721 AGGGATGGGGCGGCCACACCCGG 0: 1
1: 0
2: 2
3: 26
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151758650 Original CRISPR ACTTCTGCTCTGAAGGTGCA TGG (reversed) Intronic
900888294 1:5430766-5430788 ACTGCAGCTCTGAAGAAGCAGGG + Intergenic
900938378 1:5781331-5781353 AATTCTGCTCTTAAGATTCAAGG - Intergenic
903861482 1:26367420-26367442 AGTTCTGGCCTGAGGGTGCAGGG - Intronic
904991627 1:34598033-34598055 ATTGCTGCTCTGCAGGTGCTGGG - Intergenic
906715264 1:47964103-47964125 ACTCCTGCTCTGATTGTCCATGG + Intronic
910934548 1:92476544-92476566 ACATCTGCTCTGAGTGTTCATGG - Intronic
910938626 1:92508276-92508298 GTTTGTGCTCCGAAGGTGCAGGG - Intergenic
910971731 1:92862694-92862716 TCTACTGCTCTGAAGGTAAAAGG + Intronic
911051425 1:93674838-93674860 CCTGCTGCTCAGAAGGTCCATGG + Exonic
911252894 1:95598618-95598640 ACTTCTGCTATGCAGGAACAGGG - Intergenic
912254419 1:108044542-108044564 ACTGTTGCTCAGCAGGTGCAGGG - Intergenic
912778944 1:112526104-112526126 ATTTCTGTTTTGAAGGTGCTGGG - Exonic
913066432 1:115260107-115260129 ACTGCTGCTGTCAAGGTGGAGGG + Intergenic
913215458 1:116616338-116616360 AATTCTGCTCAGAAGGTCCCTGG + Exonic
914836484 1:151211111-151211133 GCTTCTGCTCTGAAAGTGCAGGG + Intronic
916273342 1:162967739-162967761 AGGTCTGGGCTGAAGGTGCAAGG + Intergenic
916590849 1:166188654-166188676 ACTTCTTATGTGGAGGTGCAGGG + Intergenic
918784628 1:188749993-188750015 ACTTCAGGCCTGCAGGTGCATGG + Intergenic
922314686 1:224433371-224433393 AATTAAGCTCTGAAGGTGCGTGG + Intronic
923243227 1:232106062-232106084 CCTCCTGCTCTGCAGGTGAAGGG - Intergenic
924729579 1:246698964-246698986 ACTTCGGCTCCCAAAGTGCAGGG - Intergenic
1062921737 10:1285412-1285434 ACCTCTGCTCTGAGGGTGCCAGG - Intronic
1063129307 10:3163841-3163863 AAGTCTGTTCTGAAGGTGCTGGG + Exonic
1063491556 10:6468912-6468934 AATTCTGCTCTGAAGAAGAAAGG + Intronic
1063687790 10:8255050-8255072 GCTTCAGCTCTGTAGGTGCGGGG - Intergenic
1068200382 10:53776214-53776236 ACTTGTGGTCAGAAGGTGAAAGG + Intergenic
1069824803 10:71248368-71248390 CATTCTGCTCTGGAGGTGCGGGG - Intronic
1070913927 10:80140650-80140672 ACTTCTGCTCTGAGGGTTGATGG + Intronic
1071429807 10:85598273-85598295 CCTTCTGCTCCCAAGGTGAAGGG - Intergenic
1072433792 10:95397058-95397080 TCCTGTGCTCTGAAGGTGCATGG + Intronic
1073826366 10:107327454-107327476 ACTTCTATTCTGAAGGTCCCAGG - Intergenic
1074741568 10:116489481-116489503 ACTTTTTCTCTGAAGCTGCAGGG + Intergenic
1075361216 10:121836296-121836318 CTTTCAGCTCTGAAGTTGCATGG - Intronic
1076655336 10:132019870-132019892 GCTCCTGCTCAGAAGGGGCAGGG + Intergenic
1078354726 11:10625220-10625242 CCTCCTGCTCTGAGGGTGCTGGG + Intronic
1080665903 11:34336234-34336256 AATGCTTCTCAGAAGGTGCATGG - Intronic
1081315042 11:41621717-41621739 ACTTCTTCTGTGAAGATGCTTGG - Intergenic
1081578941 11:44338842-44338864 ACGTCTGCTGTGAAGATGAATGG + Intergenic
1082096490 11:48134838-48134860 GACTCTGCTCTGAAGGTGCAGGG + Intronic
1082659421 11:55892302-55892324 ATTCATGCTCTGAAGGTGAAGGG + Intergenic
1084509553 11:69594754-69594776 ACCTCTGCTGGGAAGGTGCTGGG - Intergenic
1088981880 11:114871491-114871513 ACTTCAGCTGAAAAGGTGCAGGG - Intergenic
1089728009 11:120500046-120500068 ACTGCATCTCTGAAGGTGGAGGG - Intergenic
1090986626 11:131772547-131772569 ACTTCAGCCTTGCAGGTGCAAGG + Intronic
1091714824 12:2769358-2769380 ACTTCTATTCTGAAGGTCCCAGG - Intergenic
1092305713 12:7298655-7298677 GCTGCTGATTTGAAGGTGCAGGG - Intergenic
1098594988 12:72262056-72262078 GCTTCTGCTCTGCAGATGGATGG - Intronic
1100590374 12:96022596-96022618 AACTCTGCTCTTAATGTGCATGG - Intronic
1100700357 12:97140764-97140786 AATTCTGCTTTGAGGGTGAAAGG - Intergenic
1101455079 12:104823780-104823802 ACTTCTGCTCTTAAAATACATGG + Intronic
1106030508 13:25998123-25998145 GCTCCTGCTCTCCAGGTGCAGGG + Intronic
1106659315 13:31781965-31781987 AGTTCAGCTGAGAAGGTGCACGG - Intronic
1110248924 13:73359268-73359290 ACTTCTGATTTGAAGCTGCTTGG - Intergenic
1110531065 13:76599074-76599096 ACTTCTGCTTTAAATGTGCCAGG + Intergenic
1111087632 13:83396638-83396660 ACTTGTGCTATGAAGTTGCAGGG - Intergenic
1113421101 13:110172029-110172051 ACTTCAGCTGAGAAGGAGCAGGG - Intronic
1117180545 14:53186970-53186992 ACTTCTGTTCTGAGGGTTCAAGG + Intergenic
1118112403 14:62736306-62736328 ATTTCTGCTCTGAATGTGATAGG - Intronic
1119169144 14:72519674-72519696 CATTCTGCTTTGAAGCTGCAAGG - Intronic
1120301232 14:82710052-82710074 TCTTCTGCGGTGAAGGTGGAGGG - Intergenic
1120567836 14:86081461-86081483 ACTTCTGCTCTGATAGTCCAAGG + Intergenic
1120799102 14:88669389-88669411 ATTTCTCCTCTGATGGTGCCTGG + Intronic
1121919934 14:97871381-97871403 ATTTCTGCTCTTAAGGTAGATGG + Intergenic
1121948200 14:98143736-98143758 CCCTCTGCTCTGATGGTGTAGGG + Intergenic
1124903686 15:33848188-33848210 ATTGCTGCTCTGAAGTTGGAAGG + Intronic
1125881971 15:43203025-43203047 TCATCTGCTCTGAAGGGGCCTGG + Intronic
1126360349 15:47839319-47839341 AATTCTGCTCTGAAAGAGGAAGG - Intergenic
1127891367 15:63254327-63254349 ACAACTGCTATGAAGATGCATGG - Intronic
1127974680 15:63988348-63988370 ACCTCAGCTCTTAAGGTTCATGG + Intronic
1128361592 15:66965415-66965437 ACTTGGGCTATGACGGTGCAGGG + Intergenic
1128973159 15:72126919-72126941 ATTTCTGCTCTGAAAGAGAAAGG - Intronic
1129159842 15:73741080-73741102 ATTTCCTCTCTGAGGGTGCATGG - Intronic
1129702298 15:77774896-77774918 ACTGAGGCTGTGAAGGTGCAGGG - Intronic
1129776171 15:78237811-78237833 ACTTCTGACCTGAAGGAGCTGGG - Intronic
1132084559 15:98896836-98896858 ACTTCTGCTCAGATGCTCCAAGG + Exonic
1134251521 16:12577599-12577621 AAATCTGCTATGAAGGGGCAGGG + Intergenic
1141277861 16:82604437-82604459 GCTTCTGTTCTGAGGGTCCATGG + Intergenic
1142221851 16:88859054-88859076 ACTTCTGCTTTGTACCTGCAAGG + Intronic
1143611580 17:8020815-8020837 TCTCCTGCTCTGAAGCTCCAGGG - Intergenic
1143786193 17:9257532-9257554 ACTTCTGCCCTGTAGCTGCAGGG + Intronic
1143979438 17:10855452-10855474 AATCCTGCTCAGAAGGTGCCTGG - Intergenic
1145208972 17:20999301-20999323 GCTTCAGGTCTGAAGGTCCATGG + Intergenic
1146578466 17:34014628-34014650 GCTTCTGTTCTGAAGCTGCTTGG - Intronic
1146642813 17:34553916-34553938 ACTTCTGTTCTGCTGGTGCTTGG - Intergenic
1147851818 17:43449554-43449576 GCTGCTGCTCTGAGGCTGCAGGG + Intergenic
1148232273 17:45943949-45943971 ACTTCTGCCCTGATGGTGGTGGG - Intronic
1149386568 17:56148483-56148505 AATTGTGCTATGAAGGTGGAAGG + Intronic
1151758650 17:76088647-76088669 ACTTCTGCTCTGAAGGTGCATGG - Intronic
1152598607 17:81250321-81250343 CCTTCCGCGCTGCAGGTGCAAGG + Intronic
1152670125 17:81598625-81598647 ACTGCTACACTGAACGTGCAGGG - Intronic
1152762792 17:82118186-82118208 ACTTCTGTTCTGAGGGTGGCTGG + Intronic
1153582769 18:6591764-6591786 ACTTCTCCTCTGAGTGTTCAGGG - Intergenic
1157283855 18:46363785-46363807 AATTCTGCTCAGAAAGTCCAAGG - Intronic
1164146848 19:22517769-22517791 ACTTCAGTGCTGGAGGTGCAGGG + Intronic
1166328350 19:42065002-42065024 AGTTCTGCTCTGGAGGAGCACGG - Intronic
1168283799 19:55320700-55320722 ACTCCTGGTCTGAGGGTGGAGGG - Intronic
1168651609 19:58095833-58095855 GCTTCTGCTTTGCAGGTGAATGG - Intronic
925266007 2:2566810-2566832 ACGTCCGGCCTGAAGGTGCACGG + Intergenic
925394123 2:3519802-3519824 AAGATTGCTCTGAAGGTGCAGGG - Intergenic
925702314 2:6651022-6651044 AGTTATGCTCTGCAGGTTCATGG - Intergenic
927995250 2:27480814-27480836 AATTCTGCTGTGGAAGTGCAGGG + Intronic
929143123 2:38683941-38683963 ACTTCAGGTTTGAAGGTGGATGG + Intronic
932420766 2:71599991-71600013 CCTCCTGCTCCGAAGGTGCCAGG - Intronic
932697800 2:73971110-73971132 ACTTCTGCTCAGAAGGTGGAGGG + Intergenic
932702046 2:73998768-73998790 ACATAGGCTCTGAAGGTGGAGGG + Intronic
933813929 2:86050879-86050901 ACTTCTGGGCTCAAGGTCCAAGG - Intronic
935518903 2:104078981-104079003 ACTTCAACTCAGAAGGAGCAGGG + Intergenic
936400729 2:112162548-112162570 ACTTCACCTCGGAAGGCGCAGGG + Intronic
936601353 2:113898663-113898685 AGTTGTGCTCTGTAGGTGCCAGG + Intronic
937231957 2:120403384-120403406 ACTTCTCCTGAGAAGGGGCATGG - Intergenic
938144253 2:128820901-128820923 TCTCCTGCTGTGAAGATGCAAGG + Intergenic
938265699 2:129926675-129926697 ACTTCTGTTGTGAAGGTTGATGG - Intergenic
938329068 2:130436237-130436259 GCGTGTGCCCTGAAGGTGCAGGG - Intergenic
938360877 2:130685256-130685278 GCGTGTGCCCTGAAGGTGCAGGG + Intergenic
938437281 2:131291949-131291971 GCGTGTGCCCTGAAGGTGCAGGG + Intronic
943333271 2:186585856-186585878 ACTTCTGCTCTTTGGGTGAATGG - Intergenic
944125283 2:196285868-196285890 ACTGCAGCTCTAAAGGTGCTAGG + Intronic
944429433 2:199617193-199617215 ATTTCTGCTCTGTGGCTGCAGGG + Intergenic
944495376 2:200302568-200302590 ACTTCTGCTTTGAAGTCTCAGGG + Intergenic
946469672 2:219947026-219947048 ACTTGTGCTCTAAGGATGCATGG - Intergenic
947616301 2:231559210-231559232 GTTTCTGCTCTGAAGGGGCACGG - Intergenic
1169840535 20:9930894-9930916 TCTTCATCTCTGAAGATGCAGGG - Intergenic
1170812141 20:19682390-19682412 ACTTCTGCTCTCTCGGGGCAGGG - Intronic
1171288526 20:23965753-23965775 AGTTCTGGTCTGATGGAGCAAGG - Intergenic
1172842708 20:37911642-37911664 ACTTCAGCTCTTAAAGTGCCAGG + Intronic
1174415494 20:50363619-50363641 GCTCATGCTCTGAAGCTGCAGGG + Intergenic
1178058482 21:28825798-28825820 ACTTCAGCACTGAAAGTGCAGGG + Intergenic
1178377316 21:32077128-32077150 TCTGCTGCCCTGAAGGTGCCTGG - Intergenic
1178945837 21:36946996-36947018 ACTTCTGGGATGAAGGTGCGTGG + Intronic
1179682443 21:43033109-43033131 ACTCCTGCTCCACAGGTGCAGGG - Exonic
1181011039 22:20040777-20040799 ACTTCTGCCCAGAAGGGACATGG + Intronic
1182926109 22:34126756-34126778 AGTTCTCCTCTGAAGGTCCCAGG + Intergenic
1183359428 22:37375790-37375812 TCTCCTGCTAGGAAGGTGCAAGG + Exonic
1184468189 22:44681090-44681112 ACCTCAGCTCTGCAGATGCAGGG - Intronic
1184735683 22:46396560-46396582 ACATGGACTCTGAAGGTGCAGGG + Intronic
1184800106 22:46753874-46753896 ACTTCTGCTGGGATTGTGCACGG - Intergenic
1184850500 22:47116929-47116951 GGTTCTGCTCTCAAGGGGCAGGG + Intronic
949284161 3:2381865-2381887 AATTTTTCTATGAAGGTGCAAGG + Intronic
949514133 3:4792081-4792103 AATGCTGCTTTGAAGGTGGAGGG - Intronic
949776599 3:7639438-7639460 ACAACTGCCCTGAAAGTGCAAGG + Intronic
951703115 3:25516061-25516083 ACTTCAGCTTTGAATGTGTAAGG + Intronic
952056394 3:29452025-29452047 ACAACTGCTCTGAAAGTCCATGG - Intronic
954144129 3:48625942-48625964 ACTGCACCTCTGGAGGTGCAGGG - Exonic
960648165 3:119913366-119913388 ATTTCTGCCCTGAAGTTGAAGGG - Intronic
961032298 3:123617107-123617129 ACTTTTGCACTGAGGGTGCAGGG - Intronic
963324151 3:143842744-143842766 GCTTCTGCTCTGATTTTGCAAGG - Intronic
966144802 3:176798610-176798632 ACTTCTCCTCACAAGGTGAAAGG + Intergenic
968067047 3:195764515-195764537 ACTGCTGCTCTCAACGTGCTGGG + Intronic
970315437 4:14824632-14824654 CCTATTGCTCTGAAGGTGCCTGG - Intergenic
971824392 4:31602435-31602457 ATTTTTGCTCTGAAGTTGTAGGG - Intergenic
972525075 4:39901720-39901742 AATTCTGATCTGAAGATGGAAGG - Intronic
973896792 4:55421736-55421758 GCTACTGCTCTGAAGGAGAAGGG - Intronic
977289031 4:95143388-95143410 TCTTCTCCTCTGAAGGTGCCAGG - Intronic
978799008 4:112737016-112737038 CCTTGGGCTCTGAAGTTGCATGG + Intergenic
985488436 5:164984-165006 ACTAATGCTCTGACGGGGCAGGG + Intronic
985488629 5:166020-166042 ACTAATGCTCTGACGGGGCAGGG + Intronic
985495853 5:205140-205162 ACTTCTGCTCAGACGGTGGCGGG + Exonic
988686894 5:33534236-33534258 ACTTGTGCTCTGGAGCTGCCTGG + Intronic
990373207 5:55142090-55142112 GCTTCTGTTCTGTGGGTGCAGGG + Intronic
991640324 5:68745409-68745431 AGTTCTGCTCTGAAAGTGAGAGG - Intergenic
995418596 5:111937096-111937118 CCCTCTCCTCTGAAGGTGAAAGG - Intronic
997742917 5:136273364-136273386 AATTCTGATCTGAAAGTGCCTGG + Intronic
997781502 5:136663881-136663903 GTTTCTGCTCTGAAGGAACAAGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999871744 5:155758587-155758609 ACTGCTGATCTGAAGGAGCCTGG - Intergenic
1001576579 5:172768698-172768720 ATTTCTCCTCTCAAGGAGCATGG + Exonic
1002589660 5:180281389-180281411 ACTGCTGCTCTGCAGGAGCCTGG + Intronic
1005736071 6:28747774-28747796 ACTTTTAATCTGACGGTGCAGGG + Intergenic
1005807734 6:29490760-29490782 AGTGCTGCTCTGAAGGGGCCTGG - Intergenic
1006542631 6:34753019-34753041 ACTTTTTCTCTGAATGTCCAAGG - Intergenic
1014014535 6:116514949-116514971 ACTTCTGCTTTTAAGATCCAGGG + Intronic
1017294990 6:152783161-152783183 AATTCTGCTCTCAAAGTGCTAGG - Intergenic
1019606312 7:1911957-1911979 ACTTCTGCCCTGCAGCTGCATGG - Intronic
1020572634 7:9884924-9884946 AATTCTGCTCTTAAGGGCCATGG - Intergenic
1020612600 7:10419132-10419154 ACTTGTGCTCTCAAGGTCCTGGG - Intergenic
1021179320 7:17487753-17487775 ACTCCAGCCCTGAGGGTGCATGG - Intergenic
1023315591 7:38932817-38932839 ACTTTTGCATTGAAAGTGCAAGG - Intergenic
1024676756 7:51644446-51644468 CCATGTGCTCTGAAGGTGCCAGG + Intergenic
1025835290 7:65087353-65087375 ACCTCTGCTCTCAAAGTGCTAGG + Intergenic
1025905066 7:65776829-65776851 ACCTCTGCTCTCAAAGTGCTAGG + Intergenic
1026440377 7:70438660-70438682 ACTTCTGCTCTGTCGGAGCCTGG + Intronic
1029616438 7:101661282-101661304 CCTTCTGCTCTAAAAGTGAAGGG + Intergenic
1031068870 7:117139897-117139919 ACTTTGGCTCTGAAGGAGCTGGG + Intronic
1035064738 7:156096370-156096392 ACTTCTGCTCTGCAGGGGCTGGG + Intergenic
1035122300 7:156578870-156578892 GCTTCTGTGCTGAAGGGGCACGG + Intergenic
1035370007 7:158373765-158373787 GCTGCTACTCTGCAGGTGCATGG - Intronic
1038207416 8:25479966-25479988 ACTTCTGCTGTGAACGTGTCAGG - Exonic
1039019393 8:33188166-33188188 ACTCCTGCTGTGAAAGTGCTAGG - Intergenic
1039455962 8:37706775-37706797 ACCTCTGCTCTGAATGGGCAGGG + Intergenic
1043454277 8:80398410-80398432 GCTTCTGCACTGAGGGTCCATGG + Intergenic
1044759727 8:95505459-95505481 ACTTCCACTCTGAATCTGCAGGG + Intergenic
1045861628 8:106820246-106820268 ACTTCTGCTCTGAAGTGATAAGG - Intergenic
1048627597 8:136202792-136202814 ATTTCTGCCCTGAATGTGAATGG + Intergenic
1056789923 9:89618625-89618647 ACTTCTGTTCTGATGATGGATGG - Intergenic
1061825083 9:133252831-133252853 GCTTCTGCTGGGAAGGAGCATGG + Intronic
1187940306 X:24374682-24374704 TCTGCTTCTCTGAAGCTGCAGGG + Intergenic
1188632113 X:32376360-32376382 AGTACCTCTCTGAAGGTGCATGG + Intronic
1189249700 X:39590954-39590976 ACATCTGCTTTGAATATGCAGGG - Intergenic
1189379827 X:40494683-40494705 AGTGTTGCTCTGAAGGTGCCAGG - Intergenic
1192447444 X:71221659-71221681 ACTTCTGCCATTAAGTTGCAAGG - Intronic
1193262339 X:79423645-79423667 ACTTTGGCTCTGAAAGTGAAGGG + Intergenic
1193827621 X:86245458-86245480 CCTTCTGCTCTAAAGGGGCAAGG - Intronic
1195670618 X:107466723-107466745 ATTCCTGCTCTGAGGGTCCAGGG - Intergenic
1197631430 X:128864963-128864985 TCTTCTGCTTTGCAGTTGCATGG + Intergenic
1199787242 X:151116466-151116488 GCGTATGCTCTGAAGGAGCAAGG - Intergenic
1200967731 Y:9113905-9113927 ACTGCTGCTCTTTAGGGGCATGG + Intergenic