ID: 1151760714

View in Genome Browser
Species Human (GRCh38)
Location 17:76101205-76101227
Sequence TCTCTGCCCTGGTCTCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151760714_1151760720 11 Left 1151760714 17:76101205-76101227 CCCTCATGAGACCAGGGCAGAGA 0: 1
1: 0
2: 1
3: 17
4: 196
Right 1151760720 17:76101239-76101261 AAGCTTCTCACGTTATTCTGCGG 0: 1
1: 1
2: 0
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151760714 Original CRISPR TCTCTGCCCTGGTCTCATGA GGG (reversed) Intronic