ID: 1151763468

View in Genome Browser
Species Human (GRCh38)
Location 17:76120590-76120612
Sequence AGTGACATGGCGCATATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151763465_1151763468 -1 Left 1151763465 17:76120568-76120590 CCCTTGGATTTGAGGTAAATTAA 0: 1
1: 0
2: 0
3: 20
4: 256
Right 1151763468 17:76120590-76120612 AGTGACATGGCGCATATAAAAGG 0: 1
1: 0
2: 0
3: 1
4: 81
1151763464_1151763468 0 Left 1151763464 17:76120567-76120589 CCCCTTGGATTTGAGGTAAATTA 0: 1
1: 0
2: 0
3: 11
4: 186
Right 1151763468 17:76120590-76120612 AGTGACATGGCGCATATAAAAGG 0: 1
1: 0
2: 0
3: 1
4: 81
1151763462_1151763468 9 Left 1151763462 17:76120558-76120580 CCACAAAGGCCCCTTGGATTTGA 0: 1
1: 0
2: 0
3: 19
4: 122
Right 1151763468 17:76120590-76120612 AGTGACATGGCGCATATAAAAGG 0: 1
1: 0
2: 0
3: 1
4: 81
1151763466_1151763468 -2 Left 1151763466 17:76120569-76120591 CCTTGGATTTGAGGTAAATTAAG 0: 1
1: 0
2: 2
3: 23
4: 438
Right 1151763468 17:76120590-76120612 AGTGACATGGCGCATATAAAAGG 0: 1
1: 0
2: 0
3: 1
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151763468 Original CRISPR AGTGACATGGCGCATATAAA AGG Intronic
904901029 1:33857217-33857239 AGTGAGGTGATGCATATAAAAGG + Intronic
906572490 1:46855675-46855697 AGGGACATGGCCCAAAAAAATGG - Intergenic
906599280 1:47110212-47110234 AGGGACATGGCCCAAAAAAATGG + Intronic
916170210 1:161996137-161996159 AGTGAAATAGCCCATAGAAATGG - Intronic
917668533 1:177249353-177249375 ATTCACATTGCACATATAAAGGG - Intronic
918069026 1:181121586-181121608 AGTGACATAACACATGTAAAGGG - Intergenic
918609925 1:186477561-186477583 AGTGAAATGCAGCATGTAAAAGG - Intergenic
921352591 1:214251402-214251424 AGTGACTTGGCTCATATTTAAGG + Intergenic
1064812770 10:19220157-19220179 AGTGAGATGTCCTATATAAAAGG - Intronic
1069819600 10:71219146-71219168 AGTGAGACTGCACATATAAAAGG - Intronic
1071441388 10:85700164-85700186 AGTTACCTGGCACATAGAAAGGG - Intronic
1072399748 10:95085422-95085444 AGTGGCATGGCATATTTAAACGG - Intergenic
1072737180 10:97887027-97887049 AGTTAAGTGGCACATATAAAAGG + Intronic
1072787258 10:98292726-98292748 AATGACATGGTGCATCTCAAAGG + Intergenic
1074167742 10:110899872-110899894 CGTGACATGGCACATAAAATTGG + Exonic
1077667773 11:4129512-4129534 AGTTACATCGGGCATATAAATGG + Intronic
1078660387 11:13281061-13281083 AGGGAGATGGTGCATGTAAAAGG + Intronic
1092809430 12:12258564-12258586 TGGTACATGGTGCATATAAAGGG + Intronic
1093234786 12:16594370-16594392 AGAGACATGGCTAATACAAATGG + Intronic
1093890937 12:24519935-24519957 AGTGACTTGTCACATATAAGGGG + Intergenic
1111379525 13:87428823-87428845 AATGACAAGGTGCATATCAATGG - Intergenic
1118116524 14:62783093-62783115 AGTGACATGGAGGTTATATAAGG + Intronic
1126469687 15:48995207-48995229 AGTGAAATGCCGCATCTCAAAGG - Intronic
1129496631 15:75988618-75988640 TGTGACATGTAGAATATAAAGGG - Intronic
1134890240 16:17835086-17835108 AGTGCCATGGAGCATATGAGGGG - Intergenic
1135940635 16:26818907-26818929 AGAGATATGGCGCACATAATGGG + Intergenic
1144051017 17:11497172-11497194 AGTGTCATGGGCCAAATAAATGG + Intronic
1147266821 17:39239508-39239530 AGTGACATGTTGCAAAGAAATGG + Intergenic
1151763468 17:76120590-76120612 AGTGACATGGCGCATATAAAAGG + Intronic
1156245970 18:35298444-35298466 AGTGACAGAGAGCATATTAATGG - Intergenic
1156310711 18:35919246-35919268 AGTGGCATGGGGAATTTAAATGG + Intergenic
1159159049 18:64620397-64620419 AGTGAGATGGAGAATATGAATGG - Intergenic
1165313737 19:35042501-35042523 AGTGACATGGCGCAGAAGGAGGG + Exonic
1167351830 19:48980109-48980131 AGTGACATGTCTCATAGAGAAGG - Intronic
925295917 2:2777281-2777303 AGTGAGGTGAGGCATATAAATGG + Intergenic
926605801 2:14897421-14897443 AGAAAAATGGTGCATATAAATGG - Intergenic
927332530 2:21882710-21882732 AGATACATGGGGCAGATAAATGG + Intergenic
928715330 2:34054208-34054230 AGTGGCATGGCATATTTAAAGGG - Intergenic
934072356 2:88396084-88396106 ACTGACATGGAGCATGGAAAAGG + Intergenic
936369371 2:111890809-111890831 GTTGAGATGGCGCATACAAAAGG - Intergenic
936409507 2:112244037-112244059 AGAGATATGTCTCATATAAAAGG + Intronic
937446948 2:121966425-121966447 AGTGAAATGGGGCATCTAGAAGG + Intergenic
941560848 2:167041942-167041964 AGGGGCATGTCACATATAAAGGG + Intronic
942145447 2:173022200-173022222 AATGACATGGCGCAGACACAGGG + Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1169702005 20:8457218-8457240 TGGGACATGGTGCATACAAATGG + Intronic
1173324895 20:42024227-42024249 AGTCACATGGCCAATAAAAAGGG + Intergenic
1176904033 21:14478632-14478654 AGTGACTGGCAGCATATAAATGG - Intergenic
1179312132 21:40205957-40205979 AGTTCCATGTCGAATATAAAAGG - Intronic
1182007395 22:26972182-26972204 AGTGACATAGCGTGTATGAATGG + Intergenic
1183427816 22:37748899-37748921 AAGGACATGGCACATATGAAGGG + Intronic
954209776 3:49088988-49089010 TCTGGCATGGGGCATATAAATGG - Intronic
955914504 3:63893126-63893148 AGTGAAATGATGCATGTAAAAGG + Intronic
959255199 3:104001931-104001953 AGTGTCATAGAGCAGATAAATGG - Intergenic
960148047 3:114224406-114224428 AGTGCAATGGAGCATATAGAGGG + Intergenic
970954630 4:21795617-21795639 TGTGAGATGTCCCATATAAATGG - Intronic
979128042 4:117001924-117001946 AGTGTCATGGCTTATATGAAGGG - Intergenic
983717441 4:170801663-170801685 AGTGAAATGGGGAAAATAAACGG + Intergenic
984480847 4:180299406-180299428 ATTGAAAAGGCTCATATAAAAGG - Intergenic
989299191 5:39868789-39868811 AATGAGTTGGCTCATATAAAGGG + Intergenic
990853989 5:60241993-60242015 AGTGACATGACACATTTACAGGG + Intronic
993998576 5:94751488-94751510 AGTGACCTGGAGAATGTAAATGG + Intronic
994975416 5:106798058-106798080 AGTGACAAAGCCCATAAAAATGG - Intergenic
995072441 5:107940394-107940416 AGTGAGATGGCGTATATGCAAGG + Intronic
996485577 5:124030003-124030025 TGTGACATGCCACAGATAAAAGG + Intergenic
997350534 5:133227914-133227936 AGTGAAATGGATCATTTAAAAGG + Intronic
1010938918 6:81892727-81892749 AGTCTCATGGGGCTTATAAAAGG - Intergenic
1012546875 6:100430119-100430141 AGTGTCATGTGGCTTATAAATGG + Intronic
1015495591 6:133879734-133879756 ATTGAGATGATGCATATAAAGGG - Intergenic
1020364626 7:7367838-7367860 ACTGAGATGGAGAATATAAAAGG - Intronic
1028009730 7:85626349-85626371 AGTGGCATGGCATATTTAAAGGG - Intergenic
1038321817 8:26534157-26534179 AGTGAAATAGTCCATATAAATGG - Intronic
1044944309 8:97376443-97376465 AGTGGCATGGAGAATGTAAATGG - Intergenic
1046850233 8:118964031-118964053 AGTGCTATGGAGCAAATAAATGG + Intergenic
1047332960 8:123909002-123909024 AGGGGCATGGCCCATGTAAAGGG + Intronic
1062537963 9:137029092-137029114 AGTGTCAGGGCGCACATAGAAGG + Intronic
1186831811 X:13398292-13398314 AGTGACAAGGCACAAATCAATGG - Intergenic
1193756588 X:85417050-85417072 AGTGACATGACATATTTAAAGGG - Intergenic
1195574858 X:106438315-106438337 AGGGAGATGGCGGACATAAAGGG - Intergenic
1195828683 X:109032007-109032029 AGTGACATGACATATTTAAAGGG - Intergenic
1202261061 Y:22970877-22970899 AGTGACATGGGTCATATCACTGG - Intergenic
1202414049 Y:24604618-24604640 AGTGACATGGGTCATATCACTGG - Intergenic
1202456735 Y:25065468-25065490 AGTGACATGGGTCATATCACTGG + Intergenic