ID: 1151765407

View in Genome Browser
Species Human (GRCh38)
Location 17:76131081-76131103
Sequence GTGTCCTTAGTGCAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151765407_1151765418 8 Left 1151765407 17:76131081-76131103 CCCACCAACTGCACTAAGGACAC No data
Right 1151765418 17:76131112-76131134 GGGAGGCCGCCGGGACCTCCAGG No data
1151765407_1151765419 9 Left 1151765407 17:76131081-76131103 CCCACCAACTGCACTAAGGACAC No data
Right 1151765419 17:76131113-76131135 GGAGGCCGCCGGGACCTCCAGGG No data
1151765407_1151765422 19 Left 1151765407 17:76131081-76131103 CCCACCAACTGCACTAAGGACAC No data
Right 1151765422 17:76131123-76131145 GGGACCTCCAGGGCCAATGCCGG No data
1151765407_1151765412 -9 Left 1151765407 17:76131081-76131103 CCCACCAACTGCACTAAGGACAC No data
Right 1151765412 17:76131095-76131117 TAAGGACACAGCCCCATGGGAGG No data
1151765407_1151765414 -1 Left 1151765407 17:76131081-76131103 CCCACCAACTGCACTAAGGACAC No data
Right 1151765414 17:76131103-76131125 CAGCCCCATGGGAGGCCGCCGGG No data
1151765407_1151765413 -2 Left 1151765407 17:76131081-76131103 CCCACCAACTGCACTAAGGACAC No data
Right 1151765413 17:76131102-76131124 ACAGCCCCATGGGAGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151765407 Original CRISPR GTGTCCTTAGTGCAGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr