ID: 1151765445

View in Genome Browser
Species Human (GRCh38)
Location 17:76131198-76131220
Sequence CCTGTTCCCCACCCCCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151765445_1151765448 -7 Left 1151765445 17:76131198-76131220 CCCTTCAGGGGGTGGGGAACAGG No data
Right 1151765448 17:76131214-76131236 GAACAGGTGTGTGAGCGCAGTGG No data
1151765445_1151765449 16 Left 1151765445 17:76131198-76131220 CCCTTCAGGGGGTGGGGAACAGG No data
Right 1151765449 17:76131237-76131259 CTCCCCCTGCCCGAGTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151765445 Original CRISPR CCTGTTCCCCACCCCCTGAA GGG (reversed) Intergenic
No off target data available for this crispr