ID: 1151767257

View in Genome Browser
Species Human (GRCh38)
Location 17:76138907-76138929
Sequence GAAGAGTCTGGGCGTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151767251_1151767257 -3 Left 1151767251 17:76138887-76138909 CCCGCTTTGGGTGCTTCAGGGAA 0: 1
1: 0
2: 2
3: 19
4: 166
Right 1151767257 17:76138907-76138929 GAAGAGTCTGGGCGTCCTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 118
1151767252_1151767257 -4 Left 1151767252 17:76138888-76138910 CCGCTTTGGGTGCTTCAGGGAAG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1151767257 17:76138907-76138929 GAAGAGTCTGGGCGTCCTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 118
1151767247_1151767257 8 Left 1151767247 17:76138876-76138898 CCTGTGGCCTGCCCGCTTTGGGT 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1151767257 17:76138907-76138929 GAAGAGTCTGGGCGTCCTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 118
1151767248_1151767257 1 Left 1151767248 17:76138883-76138905 CCTGCCCGCTTTGGGTGCTTCAG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1151767257 17:76138907-76138929 GAAGAGTCTGGGCGTCCTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151767257 Original CRISPR GAAGAGTCTGGGCGTCCTTG GGG Intronic
900764661 1:4495916-4495938 GAAGAGTGAGGTCGTCCTGGAGG + Intergenic
901181822 1:7347237-7347259 GAACAGTCCGGGCCTCATTGTGG - Intronic
901859662 1:12066190-12066212 CAGGAGTCAGGGAGTCCTTGGGG + Intronic
903292711 1:22324998-22325020 GAAGTGACTGGGCCTCCCTGGGG + Intergenic
912128422 1:106569963-106569985 GAAGAGTCAGGCCATCCTTGGGG - Intergenic
912410743 1:109479328-109479350 GAATAGTCAGGGGGTCATTGTGG - Intronic
912509252 1:110177067-110177089 GAAAACACTGGGCGTGCTTGAGG + Intronic
915650532 1:157307328-157307350 GAAAACTCTGGGTGTCCCTGTGG - Intergenic
915660860 1:157403838-157403860 GAAGACTCTGGGTGTCCCTGTGG + Intergenic
918140535 1:181715985-181716007 GAATGGTCTGGGTGTACTTGTGG + Intronic
922741405 1:228016194-228016216 GAGGACTCTGAGGGTCCTTGGGG - Intronic
1065484223 10:26221684-26221706 GCAGAGTCTGCGCATCCTTCCGG + Intronic
1065537987 10:26733346-26733368 GAAGAGTCTGGGAGACCATATGG - Intronic
1066013502 10:31215776-31215798 GAAGAGTCAGGCCTGCCTTGGGG - Intergenic
1066039976 10:31539362-31539384 GCATAGTCTGGGCACCCTTGTGG + Intergenic
1069858239 10:71453535-71453557 GAGGAGTCTGGGAGGCATTGGGG + Intronic
1070707801 10:78654075-78654097 GAAGACTCTGGGCTTCCTTGAGG + Intergenic
1072693481 10:97586689-97586711 GAAGAGTCTGGGGGTCTCTGTGG - Intronic
1073584114 10:104692209-104692231 GCAGAGTGTGGGAGGCCTTGGGG + Intronic
1075802654 10:125162051-125162073 GAAGAGTTTGGGGGGCCCTGGGG - Intergenic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076909430 10:133379713-133379735 GCAGAATCAGGGCGGCCTTGTGG - Intronic
1078266046 11:9757044-9757066 GCAGAGGCTGGAGGTCCTTGGGG - Intergenic
1078411416 11:11122851-11122873 TGAGAGTCTGGGCCTCCCTGAGG - Intergenic
1078508264 11:11967720-11967742 GAAAAGTCTGTGAGTCCATGTGG + Intronic
1079604776 11:22351385-22351407 GAAGAGTGTGAGAGTGCTTGGGG - Intronic
1080653707 11:34242331-34242353 GAGTAGTCTGGGTGTCCTCGTGG - Intronic
1084423432 11:69071812-69071834 GGGGAGTCTGGGCAGCCTTGGGG - Intronic
1085202086 11:74707940-74707962 GAAAAGTCTGGGCGTGGTAGAGG - Intronic
1089879973 11:121764064-121764086 GAAGACTCTGGGCTCCCTAGGGG + Intergenic
1092019896 12:5192567-5192589 AATAAGTCTGGGGGTCCTTGGGG + Intergenic
1094370508 12:29732708-29732730 GAGGGGTCTGGGTGTCCTTGTGG + Intronic
1094601348 12:31911756-31911778 ACAGAGTCTGGGTTTCCTTGAGG + Intergenic
1099915041 12:88882513-88882535 GAAGAATCTTGGCCTGCTTGAGG + Intergenic
1100692466 12:97053406-97053428 GAAGGGACTGGGATTCCTTGAGG + Intergenic
1101524060 12:105511582-105511604 GGTGAGTCTGGGCATCCCTGTGG + Intergenic
1102145758 12:110654006-110654028 GAAGCGTGTGTGCGTCCGTGGGG + Intronic
1103991339 12:124801314-124801336 GATGAGTCTGGGTCTCCTTTTGG + Intronic
1106399742 13:29418277-29418299 GTAGTGTCTTGGGGTCCTTGAGG + Intronic
1107898459 13:44989178-44989200 GAAGAATCTGGGCGTCGAAGGGG + Exonic
1107898473 13:44989214-44989236 GGAGAGACTGGGCCTCCATGGGG + Exonic
1111021848 13:82460424-82460446 GAAGAGTCTGGGGGACGCTGGGG - Intergenic
1112234733 13:97625135-97625157 GGAGAGTGTGGGTTTCCTTGGGG + Intergenic
1114100203 14:19373087-19373109 GCAGATCCTGGGCGTCCCTGGGG - Intergenic
1118896745 14:69951706-69951728 GAAGAGGCTGGACATCCTAGAGG + Intronic
1119477785 14:74941159-74941181 GAGGAGTTCGGGAGTCCTTGCGG + Intergenic
1120817052 14:88872138-88872160 GAAGTTTCTGGGAGTCATTGCGG + Intronic
1120835163 14:89032423-89032445 GGAGAATCTGGTCGCCCTTGAGG + Intergenic
1122804216 14:104248448-104248470 GCAGAGCCTGGGTGTCCTTGTGG + Intergenic
1123105760 14:105840397-105840419 GCAGAGTCCGGGAGTCCTCGTGG + Intergenic
1124824987 15:33084724-33084746 GAAGACTCAGGGGTTCCTTGGGG - Intronic
1127686657 15:61352210-61352232 GAAGAATCTGTGCAACCTTGAGG - Intergenic
1129263562 15:74382222-74382244 GAAGGGGCTGGGAGGCCTTGAGG + Intergenic
1130808418 15:87351527-87351549 GAACAGTCTGGGGGTCATTGTGG - Intergenic
1131357176 15:91755971-91755993 CAGGAGTCTGGGCATCATTGAGG - Intergenic
1133723925 16:8520228-8520250 GAAGAGTCTGGGGGCTCATGTGG - Intergenic
1138266235 16:55661824-55661846 TAAGACTCTGAGCTTCCTTGGGG - Intronic
1140025895 16:71289728-71289750 GAAGAGTCTGAAAGCCCTTGGGG - Intergenic
1143572382 17:7767827-7767849 GAAGGGCCTGGGCGTCCGTCAGG + Intronic
1143758465 17:9083862-9083884 GATGAGTCTTCGCTTCCTTGGGG + Intronic
1147339591 17:39745683-39745705 GGAGAGTCGGGGCGTGCTTGGGG - Intronic
1150858642 17:68777718-68777740 GAAGATTCTTGCAGTCCTTGGGG + Intergenic
1151767257 17:76138907-76138929 GAAGAGTCTGGGCGTCCTTGGGG + Intronic
1156300956 18:35835544-35835566 GAAGAGTCTGTAAATCCTTGGGG - Intergenic
1164936422 19:32218064-32218086 GCAGAGACTGGGCATCCCTGTGG + Intergenic
926051263 2:9746316-9746338 GAGGTGGCTGGGGGTCCTTGGGG - Intergenic
926922052 2:17948609-17948631 GAAATGTCTGGGTTTCCTTGAGG - Intronic
928999448 2:37331616-37331638 GAAGACATTGGGCGTACTTGTGG + Intergenic
931552657 2:63463708-63463730 GAATAGTCTTGGCACCCTTGTGG - Intronic
931587009 2:63840608-63840630 GAAGCGTCTGGGCTCCCTCGGGG + Intergenic
933991059 2:87634211-87634233 AAAGTGTCTGGTGGTCCTTGGGG + Intergenic
935206957 2:100904337-100904359 GAAGACCCTTGGGGTCCTTGAGG + Intronic
935217927 2:100989004-100989026 AAAGAGTCTGGGGGGCCTGGAGG - Intronic
936302780 2:111316612-111316634 AAAGTGTCTGGTGGTCCTTGGGG - Intergenic
939105132 2:137940003-137940025 GGAGAGTCAGGGCTTCATTGTGG + Intergenic
946202331 2:218077777-218077799 GAGGAGCCTGGGGGTCCTTTTGG - Intronic
947664441 2:231894807-231894829 GAAGAGTCCAGGCAGCCTTGAGG + Intergenic
1172909190 20:38393834-38393856 GAAGAGCCTGGACGTGGTTGAGG + Intergenic
1172926173 20:38537973-38537995 GAAGAGGTTTGGCTTCCTTGAGG + Intronic
1174749134 20:53094717-53094739 GAAGAGTCTAGGTGTTCTGGGGG - Intronic
1176144609 20:63559985-63560007 GAAGTTTCTGGGCTTCGTTGTGG - Exonic
1179536557 21:42056422-42056444 AAAGAGTTTGGGCGATCTTGAGG + Intergenic
1180962866 22:19770193-19770215 GAGGAGTCTGGGGGCCCTTCTGG - Intronic
1182818057 22:33185631-33185653 GAAGAGTCTGTGCGTGTGTGAGG + Intronic
1183986178 22:41571894-41571916 GAGGGGTTTGGTCGTCCTTGCGG - Exonic
1184808287 22:46810963-46810985 GAAGAGGCTGGGCTTACTTTGGG + Intronic
1185066283 22:48633155-48633177 GAGGAGGCTGGGCCTCCTGGAGG + Intronic
1185388528 22:50547303-50547325 GACGAGAGTGGGCGACCTTGAGG - Intergenic
951891437 3:27571517-27571539 AAAGAGGCTGGGCTTCCTTGGGG + Intergenic
959363647 3:105427695-105427717 GTAGAGTTTGGGTGTCTTTGGGG + Intronic
960258826 3:115541637-115541659 GAAGAGTCAGGGCCTCCCTCCGG + Intergenic
961384640 3:126516645-126516667 GAGGATGCTGGGGGTCCTTGTGG - Intronic
967331973 3:188298981-188299003 GAAAAGTCTGGGCCTGCTTAGGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968954386 4:3710821-3710843 GAAGGTTCTGGTCCTCCTTGCGG + Intergenic
975567932 4:75779589-75779611 GAAGAGTCAGGGCGTCACTCTGG - Intronic
976214697 4:82705147-82705169 GGACAGACTGGGCGTGCTTGGGG + Intronic
977874731 4:102135591-102135613 GAGGAGTCAGGGCAACCTTGAGG - Intergenic
981267445 4:142803458-142803480 GAAGAGTCTTTGTGTCTTTGTGG - Intronic
984757828 4:183340363-183340385 GAAGGGTCTGGGTTTCTTTGAGG - Intergenic
987580643 5:19786926-19786948 GAAGGGTCTGGACATCCTAGAGG - Intronic
989973850 5:50557560-50557582 GATGAGACTGGGCGTGTTTGGGG - Intergenic
990177675 5:53126167-53126189 GAAGAGTTGTGGGGTCCTTGCGG - Intergenic
992225486 5:74616384-74616406 GAAGAGTCTGGGCCTCTTAGTGG - Intergenic
997625375 5:135327427-135327449 TGAGAGTCTGGGCTTCCTTCTGG - Intronic
1003411947 6:5873086-5873108 GAAGAGTCTGGGCATCTCTGGGG - Intergenic
1007077628 6:39078120-39078142 GAAGAGTCTGGGGGTCCGCATGG + Intronic
1009653054 6:66501150-66501172 GAATAATCTTGGCATCCTTGTGG + Intergenic
1011195316 6:84774304-84774326 GGGGAGCCTGGGCCTCCTTGCGG + Intergenic
1012611549 6:101226114-101226136 GAAGTGCCTGGGAGTCCTCGTGG + Intergenic
1013705240 6:112825331-112825353 GAATAGTCTAGGTGGCCTTGGGG - Intergenic
1020340659 7:7106283-7106305 AAAGAGTCTGGTGGTCCTAGAGG - Intergenic
1020457879 7:8394825-8394847 GAAGAATCTGCAGGTCCTTGAGG - Intergenic
1021404978 7:20254736-20254758 GAAGAGTTTCGGGCTCCTTGGGG + Intergenic
1037627298 8:20619215-20619237 GAAGACTCTGGGAATCCTGGGGG + Intergenic
1038040166 8:23717442-23717464 GAAGACCCTGGGCATGCTTGGGG + Intergenic
1039631310 8:39114420-39114442 GAAGAGGCTGTGAGTCCTCGTGG + Intronic
1047747206 8:127854066-127854088 GAGGAGGGTGGGCGGCCTTGGGG - Intergenic
1049324425 8:142014651-142014673 GAAGCATCTGGACGTCCCTGCGG - Intergenic
1050259063 9:3821935-3821957 GAAGAGTCAGGGCGCCCTGACGG - Intergenic
1052761918 9:32601421-32601443 GAAGACTCTGTGGGTCCTGGAGG + Intergenic
1054455193 9:65426871-65426893 GCAGGGTCTGGGCCTCCTTAGGG - Intergenic
1055673111 9:78626998-78627020 TATGAGTCTGGGAGACCTTGGGG - Intergenic
1056998721 9:91488011-91488033 GAAGAGTCCGGGGGTGCCTGAGG + Intergenic
1060882049 9:127124100-127124122 GAAGTGTCAGGGTCTCCTTGGGG - Intronic
1061429811 9:130523883-130523905 GAGGAGCGTGGGGGTCCTTGGGG - Intergenic
1185538659 X:884411-884433 GTAAAGTCGGGGCGTCCTGGAGG + Intergenic
1192045313 X:67665776-67665798 GAACAGTGAGGGCCTCCTTGAGG - Intronic
1192553766 X:72073846-72073868 GAGGGGTCTGGGCTTGCTTGTGG + Intergenic
1195726875 X:107926818-107926840 GAAGCGTCTGGGTGTCCTCCTGG + Exonic
1198302081 X:135343206-135343228 GGGGAGGCTGGGCCTCCTTGAGG + Exonic