ID: 1151768794

View in Genome Browser
Species Human (GRCh38)
Location 17:76146290-76146312
Sequence GACCTCACGGGCTTGCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 1, 2: 3, 3: 69, 4: 445}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151768791_1151768794 0 Left 1151768791 17:76146267-76146289 CCATCAGATGGGACATGCGTACT 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1151768794 17:76146290-76146312 GACCTCACGGGCTTGCTGTGAGG 0: 1
1: 1
2: 3
3: 69
4: 445
1151768790_1151768794 1 Left 1151768790 17:76146266-76146288 CCCATCAGATGGGACATGCGTAC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1151768794 17:76146290-76146312 GACCTCACGGGCTTGCTGTGAGG 0: 1
1: 1
2: 3
3: 69
4: 445
1151768787_1151768794 15 Left 1151768787 17:76146252-76146274 CCTTGGTTTTCTCACCCATCAGA 0: 1
1: 0
2: 3
3: 51
4: 670
Right 1151768794 17:76146290-76146312 GACCTCACGGGCTTGCTGTGAGG 0: 1
1: 1
2: 3
3: 69
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151768794 Original CRISPR GACCTCACGGGCTTGCTGTG AGG Intronic