ID: 1151769001

View in Genome Browser
Species Human (GRCh38)
Location 17:76147451-76147473
Sequence CAGAGTCAGGACAGCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151769001 Original CRISPR CAGAGTCAGGACAGCTCTCT GGG (reversed) Intronic
901059816 1:6466848-6466870 CACACTCAGGCCAGCCCTCTTGG - Exonic
901538780 1:9901250-9901272 CAGGGTCAGGATGGGTCTCTGGG + Intronic
902372882 1:16016713-16016735 CAGAGTGAGGACAGCTCCTCTGG - Intronic
902562657 1:17287421-17287443 TAGGGACAGGACAGCTGTCTTGG + Intergenic
902878634 1:19356265-19356287 ATCAGTCAGGCCAGCTCTCTGGG - Intronic
903994138 1:27294788-27294810 CTGAGCTAGGACATCTCTCTGGG - Intronic
904136168 1:28314227-28314249 CAGAGGCAGGAAAGGTCACTGGG + Intergenic
907547109 1:55271722-55271744 AAGAGACAAGGCAGCTCTCTGGG - Intergenic
908560842 1:65304637-65304659 CAGAGTCAGGAGAGGATTCTCGG + Intronic
910615358 1:89191693-89191715 GAGAGTCAGGAAAGAACTCTTGG + Intronic
911618709 1:100042489-100042511 TAGTGGCAGGAAAGCTCTCTGGG + Intronic
911901695 1:103513905-103513927 GAGGGTCAAGGCAGCTCTCTAGG - Intergenic
913076295 1:115343239-115343261 GAGAGTCAGGTGAGCCCTCTGGG + Intergenic
913251619 1:116916613-116916635 CAGTATCTGTACAGCTCTCTGGG - Intronic
913366843 1:118048240-118048262 CAGTGTCAGGTCAGCACTCAAGG + Intronic
916583227 1:166126996-166127018 CAGAATCAGGTGAGATCTCTTGG - Intronic
920012416 1:202878417-202878439 CAAAGTCAAGTCGGCTCTCTTGG + Intergenic
921266961 1:213428857-213428879 CAGAATCAACAAAGCTCTCTGGG - Intergenic
923212944 1:231822297-231822319 CAGATTCCTGACAGCTCACTGGG - Intronic
924553383 1:245098701-245098723 CAGCATCAGGACAGTTCACTCGG - Intronic
924814052 1:247427166-247427188 AAGAGGCAAGGCAGCTCTCTGGG + Intronic
1062853047 10:760016-760038 CAGTGGCAGGACGGCCCTCTGGG - Intergenic
1063037582 10:2302407-2302429 CAGAGTGAGGGCAACTGTCTGGG - Intergenic
1063420144 10:5906125-5906147 CAGAGTCCTGACAGCTGTCCTGG - Exonic
1064395966 10:14982245-14982267 CTGAGGCAGGGAAGCTCTCTTGG - Intronic
1064912451 10:20417147-20417169 CAGTGAAAAGACAGCTCTCTAGG + Intergenic
1065754015 10:28914129-28914151 CAGACTGAGGACAGCTCGCTTGG - Intergenic
1070027378 10:72645012-72645034 CAGAGTGAGGCCAGCTATTTAGG - Intergenic
1070576476 10:77682613-77682635 CAGACTGAGGACAGCCCTATGGG + Intergenic
1070587876 10:77780130-77780152 CAGAGTCAGGACTGCTTCCTGGG - Intergenic
1070760796 10:79023226-79023248 CAGAGCCAGGACAGAACTCAAGG - Intergenic
1070918226 10:80168439-80168461 GAGAAACAGGACAGCTCCCTTGG + Intronic
1071314028 10:84374367-84374389 GTGGGTCTGGACAGCTCTCTAGG + Intronic
1072535937 10:96362778-96362800 CAGAGAGAGGACAGCTGCCTAGG - Intergenic
1072576965 10:96709391-96709413 TAGGGGCAGGACAGCTCTCCTGG - Intronic
1076382923 10:130037467-130037489 CAGAGTCAGGGCCACTCCCTTGG - Intergenic
1076467912 10:130697686-130697708 CAGAGGGAGGACACCTCTGTGGG - Intergenic
1076474455 10:130742716-130742738 CAGAGCCAGGACACCTCACCTGG - Intergenic
1076921721 10:133457772-133457794 CTGAGCCAGGACACCTCTGTGGG - Intergenic
1077008596 11:370220-370242 CAGAGTCAGGGACCCTCTCTGGG - Intronic
1077589416 11:3480167-3480189 CAGAGACAGGGAAGCTCTCTTGG - Intergenic
1077670392 11:4151915-4151937 CAAAGTCAGGAAAGAGCTCTGGG + Intergenic
1078774234 11:14379676-14379698 TAGATTCAGAACAGCTTTCTAGG + Intergenic
1079963822 11:26956107-26956129 AAGAGACAAGGCAGCTCTCTGGG + Intergenic
1080308820 11:30866414-30866436 AAGAGGCATGGCAGCTCTCTTGG + Intronic
1080392117 11:31857979-31858001 AAGAGGCATGGCAGCTCTCTGGG - Intronic
1081107392 11:39087485-39087507 AAGGGTCAAGGCAGCTCTCTGGG - Intergenic
1081625636 11:44653639-44653661 CAGGGTCAGGTCAGGTTTCTGGG + Intergenic
1083924237 11:65796352-65796374 CAGCATCAGGCCAGCTCTCCGGG - Exonic
1084245136 11:67851942-67851964 CAGAGACTGGGAAGCTCTCTTGG - Intergenic
1084261539 11:67982089-67982111 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1084530857 11:69727022-69727044 GAGAGTCAGGCTTGCTCTCTGGG - Intergenic
1084807079 11:71586454-71586476 CCGAGACAGGGAAGCTCTCTTGG + Intronic
1084811103 11:71612022-71612044 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
1084827552 11:71742636-71742658 CAGAGACAGGGAATCTCTCTTGG + Intergenic
1084844163 11:71886466-71886488 CCGAGACAGGGAAGCTCTCTTGG + Intronic
1085978727 11:81694537-81694559 CAGTGTCAGGACAACCCTCTGGG - Intergenic
1088988370 11:114929420-114929442 AAGAGTCAGGACTGCTCCCTGGG + Intergenic
1089260707 11:117222081-117222103 CTGAGTCGGGAGATCTCTCTGGG - Intronic
1089543906 11:119207094-119207116 TGGGGTCAGGACAGCTCTCAGGG + Intronic
1090351452 11:126111007-126111029 GGGAGGCAGGGCAGCTCTCTGGG + Intergenic
1090890450 11:130918305-130918327 CAGAATCAGGAAGGCACTCTTGG - Intergenic
1091364839 11:135009269-135009291 CAGGCTCAGGACTGCTCACTGGG + Intergenic
1091723789 12:2831929-2831951 CAGACTCCCCACAGCTCTCTCGG + Intronic
1091911964 12:4240153-4240175 CAGTGGCAGGACAACCCTCTGGG + Intergenic
1092415709 12:8289073-8289095 CAGAGACAGGGAAGCTCTCTTGG - Intergenic
1092432837 12:8422658-8422680 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1092435425 12:8443287-8443309 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1095377763 12:41551221-41551243 AAGAGGCAAGATAGCTCTCTGGG + Intronic
1097247814 12:57616226-57616248 CAGAGACAGGTCTGCTCCCTAGG - Intronic
1097470249 12:59981652-59981674 AAGGGGCAGGGCAGCTCTCTAGG - Intergenic
1098191719 12:67956220-67956242 AAGAGACAGGGCAGTTCTCTGGG - Intergenic
1099208542 12:79756916-79756938 CAGAGGCAGGAAACCTCTCTTGG + Intergenic
1099230579 12:80019294-80019316 CAGAGCCAGGAGATCTCTATTGG + Intergenic
1100343967 12:93708970-93708992 GAGGGTCAAGATAGCTCTCTCGG + Intronic
1100780602 12:98021881-98021903 AAAAGTCAGAACAACTCTCTAGG + Intergenic
1102097698 12:110253334-110253356 CAGGGTCAGGCCAGCTCACGAGG - Intergenic
1102338636 12:112104085-112104107 CTGAGTTAGGACATTTCTCTTGG - Intronic
1104948963 12:132430201-132430223 CATTCTCATGACAGCTCTCTGGG - Intergenic
1105280683 13:18960933-18960955 CAGAGCTATGACAGCTCCCTGGG + Intergenic
1105810327 13:23989847-23989869 AAGTGGCAAGACAGCTCTCTGGG - Intronic
1106385569 13:29282234-29282256 CAGAGGCAGCACTTCTCTCTGGG - Intronic
1109517280 13:63460216-63460238 TAGGGTCAAGGCAGCTCTCTGGG + Intergenic
1110241263 13:73269879-73269901 AAGGGACAAGACAGCTCTCTGGG - Intergenic
1110668182 13:78142794-78142816 CAGAGTAAGGATAGCTCTGCAGG + Intergenic
1110900124 13:80811687-80811709 AAGAGGCAGCACAGCTCTCTGGG - Intergenic
1113382356 13:109815431-109815453 AAGAATCAGCACAGCTCTCTGGG + Intergenic
1113679647 13:112234429-112234451 CAGAGACAGGACACCACCCTGGG - Intergenic
1113822846 13:113227373-113227395 AAGAGGCAGGGGAGCTCTCTGGG + Intronic
1114246952 14:20923326-20923348 CAGAGGCTGGACAGATCTTTAGG - Intergenic
1114283018 14:21212036-21212058 CAGAGCCAGTACAGATTTCTCGG + Intronic
1114562222 14:23601578-23601600 AAGAGGCAAGGCAGCTCTCTGGG - Intergenic
1114737980 14:25062730-25062752 GAGGGTGAGGAGAGCTCTCTGGG + Intergenic
1115668194 14:35577401-35577423 AAGAGTCAAGTAAGCTCTCTGGG - Intronic
1117038364 14:51749028-51749050 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
1119003669 14:70905774-70905796 AGGAGACAGGAAAGCTCTCTGGG - Intergenic
1119125579 14:72122705-72122727 CAGAATGAGGCCAGCACTCTGGG + Intronic
1119650475 14:76379528-76379550 CAGAGTGAGGACATCAGTCTCGG + Intronic
1121543137 14:94743419-94743441 CAGAGTCAGGGCTGGTCTCAAGG + Intergenic
1123428028 15:20188581-20188603 CAGAGTTAGGACAGATCCCAAGG - Intergenic
1124461446 15:29895972-29895994 AGGAGGCAGGGCAGCTCTCTGGG + Intronic
1124888964 15:33713822-33713844 AAGAGGCAAGGCAGCTCTCTGGG + Intronic
1126326305 15:47481146-47481168 CAGATCCATGACAGCTTTCTTGG + Intronic
1127668243 15:61169926-61169948 CAGAGTGAGGACTGCCTTCTGGG - Intronic
1129094713 15:73193392-73193414 CAGAGTCAGGACTGATATCTTGG + Intronic
1130965735 15:88696180-88696202 CAGAGCCAGAATGGCTCTCTGGG - Intergenic
1133041891 16:3065313-3065335 CAGACTCGGGACAGCTGGCTGGG - Intronic
1133111495 16:3550564-3550586 CAGAGTCAGGGAAGCCCTCCTGG + Intronic
1133916376 16:10113062-10113084 CAGAGTCGGGCCTGCTCCCTGGG + Intronic
1134179471 16:12035933-12035955 CAGAGTTAGGACAGTCCTCTGGG + Intronic
1135574169 16:23572482-23572504 CACTGTCAGGACAAGTCTCTAGG - Exonic
1136302947 16:29348865-29348887 CAGAGTTAGGACAGTCCTCTGGG + Intergenic
1137339840 16:47590765-47590787 CACAGTCAGGAGATCTTTCTTGG + Intronic
1137372171 16:47917715-47917737 CAGGGTTAGCACAGCTCTTTGGG + Intergenic
1138134048 16:54506494-54506516 CATAGTGAGGAAAGCTTTCTAGG + Intergenic
1141056284 16:80817698-80817720 GAGAGGCAAGACAGCTCTCTGGG + Intergenic
1141405057 16:83785347-83785369 GAGAGGCAAGGCAGCTCTCTGGG + Intronic
1142886628 17:2916800-2916822 CACAGTCAGGGCTTCTCTCTAGG + Intronic
1146742456 17:35298544-35298566 GAGAGTCAGGTCAGCTGTCCCGG + Intergenic
1149545508 17:57500608-57500630 AAGAGACAGGACAGTGCTCTGGG - Intronic
1149737203 17:59007034-59007056 CAGAGTCAGAACAGCATTCTGGG - Intronic
1151301951 17:73232954-73232976 CAGAATCAGAACAGCTTTCAGGG + Intronic
1151512885 17:74572219-74572241 AAGGGGCAAGACAGCTCTCTGGG + Intergenic
1151769001 17:76147451-76147473 CAGAGTCAGGACAGCTCTCTGGG - Intronic
1152317296 17:79588647-79588669 CAAGCTCAGGACAGGTCTCTTGG - Intergenic
1152841784 17:82573935-82573957 CCAAGTCAGGACAGGTCTTTTGG + Intronic
1154480395 18:14817319-14817341 TAGAGTCAGGACAGGTCACATGG - Intronic
1156260293 18:35439929-35439951 CAGACACAGGACTGCTATCTTGG - Intergenic
1157443820 18:47729980-47730002 CAGAGCCCGGACAGCACCCTGGG + Intergenic
1157517897 18:48323997-48324019 AAGGGTCAAGGCAGCTCTCTGGG - Intronic
1157699006 18:49747889-49747911 CAAAGTGAGGACAGCTGCCTGGG + Intergenic
1158406149 18:57161395-57161417 CACAGTCAGGATACCTGTCTTGG + Intergenic
1162472596 19:10881446-10881468 CAGGGCCAGGACATCTCTCCAGG + Intronic
1165253985 19:34561959-34561981 AAGGGTCAAGACAGCTGTCTGGG + Intergenic
1167769906 19:51508602-51508624 CAGAGTCAGTCCAGCTGTCTTGG - Intergenic
1167797287 19:51717821-51717843 CAGAGTCAGCACAGCTCAACTGG - Intronic
1168270709 19:55248259-55248281 CGGAGTGATGACAGCTTTCTTGG - Intronic
926422382 2:12712797-12712819 AAGTGGCAGGACAGCTCTCTGGG - Intergenic
927271988 2:21221179-21221201 CAGAGGCAGCACAGCTATGTGGG + Intergenic
927467439 2:23347959-23347981 CACAGTGAGGAAGGCTCTCTCGG + Intergenic
927678954 2:25127617-25127639 CAGGGTCAGCACAGCTCTGTGGG - Intronic
928893990 2:36240150-36240172 CAGAGGCAGGACAGCAAGCTAGG - Intergenic
929754443 2:44752442-44752464 CAGAGGCTGGACAACTCTCCTGG + Intronic
930194846 2:48499005-48499027 AAGGGTCAGGTGAGCTCTCTGGG + Intronic
932074158 2:68647523-68647545 CACAGTCAGGACAGTGTTCTAGG + Intronic
932349491 2:71020836-71020858 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
932353069 2:71047324-71047346 CTGAGACAGGGAAGCTCTCTTGG + Intergenic
934780507 2:96966790-96966812 AAGAGGCAAGAGAGCTCTCTGGG - Intronic
936077003 2:109408017-109408039 CAGAGTCAGGAAAGATCCTTGGG + Intronic
936153082 2:110032258-110032280 CAGCATCAGGACAGCTTTCCTGG - Intergenic
936191598 2:110339154-110339176 CAGCATCAGGACAGCTTTCCTGG + Intergenic
936463526 2:112727939-112727961 CCGAGTGAGCTCAGCTCTCTCGG + Intronic
937490812 2:122365478-122365500 AAGTGGCAAGACAGCTCTCTGGG + Intergenic
939041453 2:137193870-137193892 CAGAGTCAGGAGAATTATCTAGG - Intronic
940873990 2:158882622-158882644 CGGAGACAGGGAAGCTCTCTTGG + Intergenic
941341769 2:164314514-164314536 CAAAGTCTGGACAGTCCTCTAGG + Intergenic
941957488 2:171219567-171219589 AAGAGTCAAGAGAGCTTTCTGGG + Intronic
943369641 2:187001675-187001697 CAGAATCAGAACTGCTCCCTGGG - Intergenic
944481892 2:200165689-200165711 CACTTGCAGGACAGCTCTCTGGG + Intergenic
944581623 2:201137313-201137335 CAGAGTCAGGACTGCTCCCTGGG - Intronic
945066258 2:205949863-205949885 CAGAGTCACGACTGCTCCCTGGG - Intergenic
948133257 2:235616998-235617020 CAAAGTCACATCAGCTCTCTAGG + Intronic
948873871 2:240817408-240817430 CAGAGTCTGGGGACCTCTCTAGG - Intronic
1170596475 20:17809789-17809811 CATAGCCAGGACAGCTCTGTGGG + Intergenic
1171499253 20:25580443-25580465 CTGAAACAGGAGAGCTCTCTAGG - Intronic
1172482101 20:35277389-35277411 CAGAGGCAGGACAGGCCTCCTGG - Intergenic
1172999330 20:39094180-39094202 AAGGGGCAAGACAGCTCTCTGGG - Intergenic
1173324522 20:42020414-42020436 CAGGGTCAGGAAGGGTCTCTGGG + Intergenic
1173416224 20:42858557-42858579 AAGAGGCAAGGCAGCTCTCTGGG - Intronic
1173808090 20:45939168-45939190 CAGGGTCAGGACTGCTCCCAGGG - Intronic
1175479021 20:59298728-59298750 AAGGGTCAAGGCAGCTCTCTGGG - Intergenic
1175866389 20:62179536-62179558 CAGGGACAGGACAGATCTCGAGG + Exonic
1176297251 21:5080682-5080704 CAGAGCCAGCCCAGCTGTCTGGG - Intergenic
1176702361 21:10070854-10070876 GAGAGTCATCAAAGCTCTCTTGG - Intergenic
1176800153 21:13418934-13418956 TAGAGTCAGGACAGGTCACATGG + Intergenic
1177796811 21:25787797-25787819 AAGGGGCAAGACAGCTCTCTGGG + Intergenic
1178264598 21:31131473-31131495 CTGAATCAGGTAAGCTCTCTAGG + Intronic
1178394858 21:32234280-32234302 CAGCATCAGGACTGCTTTCTAGG - Intergenic
1178899778 21:36589550-36589572 CAGGGTCAGGACTGCCCCCTAGG + Intergenic
1179350053 21:40600374-40600396 AAGAGACAAGGCAGCTCTCTGGG + Intronic
1179523328 21:41959461-41959483 CAGAGGCAGGGCAGCCATCTGGG - Intergenic
1179666072 21:42913440-42913462 CAGAGGCAGGGGAGCTGTCTGGG + Intergenic
1179769394 21:43603246-43603268 CAGTGCCAGGACAGCGCTCAGGG + Intronic
1179859778 21:44181266-44181288 CAGAGCCAGCCCAGCTGTCTGGG + Intergenic
1182567519 22:31211384-31211406 AAGAGTTAGGACAGCTGACTGGG - Intergenic
1182657147 22:31899832-31899854 CAGAGTCCGGGCTGCTCTCAGGG - Intronic
1183210111 22:36445952-36445974 AAGAGGCAAGAGAGCTCTCTTGG + Intergenic
1183468021 22:37989865-37989887 CAGAGGGAGGACAGCGCTCCAGG - Intronic
1184610191 22:45598552-45598574 GGGAGTCAGGACAGGTTTCTTGG - Intronic
949787076 3:7753499-7753521 AAGGGCCAAGACAGCTCTCTGGG - Intergenic
950014002 3:9743528-9743550 CAGACTCAGGGCAGCCCTCAGGG - Intronic
950113177 3:10433483-10433505 CAGAGTCAGGACTTATCTTTGGG - Intronic
950142429 3:10624636-10624658 CAGGGTCAGGAAAGCCCTGTTGG - Intronic
951066762 3:18276014-18276036 AAGGGGCAGGACAGCTCCCTAGG - Intronic
951659295 3:25044863-25044885 GAGAGACAGGACTGCTGTCTGGG - Intergenic
951909733 3:27737334-27737356 AAGAAACAAGACAGCTCTCTGGG + Intergenic
952416154 3:33093053-33093075 CCGAGCCTGGAGAGCTCTCTTGG + Exonic
955164220 3:56494843-56494865 CAGCACCTGGACAGCTCTCTTGG + Intergenic
957044825 3:75365473-75365495 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
957076615 3:75607662-75607684 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
961141934 3:124563130-124563152 TAGAGTCAGGCCAGCGCTCATGG - Intronic
961274678 3:125717520-125717542 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
961277599 3:125740152-125740174 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
961735944 3:129002198-129002220 CACAGTCAGGACCGCTGTCGGGG - Exonic
961876825 3:130029511-130029533 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
961893255 3:130147686-130147708 CAGAGACAGGGAAGCTCTCTTGG - Intergenic
962948602 3:140197175-140197197 CATAGTGAGGACAGCTACCTTGG - Intronic
965648542 3:170909262-170909284 TAGAGTCAGCACTGCTCCCTGGG + Intergenic
966674373 3:182569362-182569384 CAAAGTCAGAACAGATATCTTGG - Intergenic
968989098 4:3896713-3896735 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
969020066 4:4133956-4133978 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
969037492 4:4266488-4266510 CAGAGTCAGGACCTGACTCTGGG + Intergenic
969662254 4:8537127-8537149 CAGAGGCAGCACAGCTGCCTGGG + Intergenic
969729043 4:8942805-8942827 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
969733787 4:8973456-8973478 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
969785217 4:9452340-9452362 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
969788632 4:9476747-9476769 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
969826259 4:9760882-9760904 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
970756252 4:19429877-19429899 CAGGGGCAGGATGGCTCTCTCGG + Intergenic
971536970 4:27765176-27765198 CAAAGTTTGGACAGCTTTCTTGG + Intergenic
971658095 4:29375919-29375941 AAGAGGCTGGAGAGCTCTCTGGG - Intergenic
972672067 4:41222057-41222079 CAGAGTCATAACATCTCTTTAGG - Intergenic
972833022 4:42835841-42835863 AAGAGGCAAGACAGCTCTCTGGG - Intergenic
980206712 4:129729113-129729135 AAGAGGCAAGGCAGCTCTCTGGG - Intergenic
980249060 4:130290653-130290675 AAGAGTCATGAGAGCTATCTGGG + Intergenic
980349802 4:131670103-131670125 AAGACTCAGGAAAGCTGTCTAGG + Intergenic
980374533 4:131927269-131927291 GAGAGTCATCAAAGCTCTCTTGG - Intergenic
981620528 4:146692841-146692863 CAGTGCCAGGACAGTTCTCTGGG - Intergenic
982256361 4:153455188-153455210 AAGAGGCAAGGCAGCTCTCTGGG - Intergenic
983000202 4:162405084-162405106 AAGGGGCAAGACAGCTCTCTGGG + Intergenic
983801437 4:171934970-171934992 AAGGGTCAGGAGAGCTCTCTAGG - Intronic
985152189 4:186959089-186959111 CAGAATCAGTACAGCTCTTGCGG + Intergenic
985875864 5:2593626-2593648 CAGAGTGAGAACAACTCTTTGGG + Intergenic
985922182 5:2986024-2986046 AAGGGTCAGGACAGCTGTCTGGG - Intergenic
986634847 5:9811156-9811178 AAGTGTCTGGGCAGCTCTCTGGG - Intergenic
988253238 5:28787600-28787622 CAGAGTCTGGGCAGCTCAATGGG + Intergenic
988485161 5:31662608-31662630 AAGAGGCAAGGCAGCTCTCTTGG + Intronic
988574316 5:32405291-32405313 CAGAGCCAGGACTGCAATCTTGG + Intronic
989182358 5:38591168-38591190 GAGAGACAGGAAAGCCCTCTAGG + Intronic
989231056 5:39086674-39086696 CAGGGGCAGGACAACCCTCTGGG - Intergenic
991953714 5:71971744-71971766 AAGGGGCAGGGCAGCTCTCTGGG + Intergenic
992457957 5:76933433-76933455 CAGAGACTGCTCAGCTCTCTAGG - Intergenic
995065012 5:107851652-107851674 AAGAGGCAAGACAGCTCTCTGGG - Intergenic
996776316 5:127136309-127136331 CAGAGTGTGGACAGCTTTGTAGG + Intergenic
996923617 5:128797495-128797517 CAGAGTGAGCACAGCCCTGTTGG - Intronic
999796049 5:154990714-154990736 CAGAGTCAGGACTGGAATCTAGG + Intergenic
999833492 5:155342954-155342976 CTGTTTCAGGACAGCCCTCTGGG + Intergenic
1000845320 5:166272653-166272675 AAGGGGCAAGACAGCTCTCTGGG + Intergenic
1001089162 5:168724431-168724453 CGGAGGGCGGACAGCTCTCTGGG + Exonic
1001289957 5:170450073-170450095 CATGCTCAGGACTGCTCTCTTGG + Intronic
1002479730 5:179492337-179492359 CAGAGTCCGGCCACATCTCTAGG + Intergenic
1002538353 5:179890711-179890733 CTGAGTCAGGACAGGTCCCAAGG - Intronic
1004456096 6:15792721-15792743 CTGAGTCAGGCCAGTTCTCTCGG + Intergenic
1004731844 6:18366533-18366555 CTGAGTCAGGACTGCTCCCTGGG - Intergenic
1008862228 6:56162635-56162657 GAGAGTCAGAAAAGCACTCTAGG + Intronic
1009041773 6:58188897-58188919 AAGAGGCAAGGCAGCTCTCTGGG + Intergenic
1009217623 6:60943160-60943182 AAGAGGCAAGGCAGCTCTCTGGG + Intergenic
1010679399 6:78781647-78781669 CAGAGCCAGGTAAACTCTCTGGG + Intergenic
1011352801 6:86441150-86441172 AAGGGGCAGGGCAGCTCTCTGGG - Intergenic
1012378125 6:98586984-98587006 CAGAGTAAGGACAGCTCTCCTGG - Intergenic
1012413379 6:98986014-98986036 AAATGTCATGACAGCTCTCTCGG - Intergenic
1013609574 6:111781606-111781628 CAGAGGCCGGACAGGCCTCTGGG - Intronic
1015685581 6:135855863-135855885 CAGTGTCAGGAAAACTCTCATGG + Intronic
1016496512 6:144668664-144668686 CAAGGGCAGGGCAGCTCTCTGGG + Intronic
1016980444 6:149848918-149848940 CAGAGGCAAGGCAGCCCTCTGGG - Intronic
1018012439 6:159683821-159683843 CAGAATCTGAACAGCTCTTTTGG - Intronic
1018111023 6:160537032-160537054 CAGAGTCAGAACAGTTTTCCAGG + Intronic
1018197246 6:161366153-161366175 AAGAGGCAAGAGAGCTCTCTGGG - Intronic
1018198910 6:161377771-161377793 AAGGGGCAAGACAGCTCTCTGGG - Intronic
1019340573 7:507084-507106 CAGCGGCAGGACCGGTCTCTTGG + Intronic
1020307475 7:6845991-6846013 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1020455155 7:8364354-8364376 CAATGTAAGAACAGCTCTCTTGG + Intergenic
1020941719 7:14547569-14547591 CAGGGTCAGAACAGCTCCTTAGG - Intronic
1021308515 7:19062290-19062312 CATATGCAGGACAGTTCTCTGGG + Intronic
1022820971 7:33960700-33960722 CAGAAACAGGAAAGCTTTCTTGG - Intronic
1022922772 7:35033247-35033269 TAGGGTCAGGAAAGGTCTCTGGG - Intronic
1022955120 7:35373706-35373728 AAGAGACAAGGCAGCTCTCTGGG + Intergenic
1026563712 7:71472146-71472168 AAGAGACAAGAGAGCTCTCTAGG + Intronic
1027351371 7:77315152-77315174 GAGAATCAAAACAGCTCTCTTGG + Intronic
1028148463 7:87345398-87345420 CAGAGTTAGGACAGCTCATTTGG + Intergenic
1029078598 7:97954930-97954952 CTGAGACAGGGAAGCTCTCTTGG - Intergenic
1029839533 7:103347560-103347582 CAGAGTCCGGACAGAGCCCTGGG - Exonic
1029887737 7:103890731-103890753 CAGAGACAGGACAGGACTCTGGG - Intronic
1032018188 7:128392806-128392828 CAGAGTCAGGACTGCTCCCGGGG - Exonic
1032649257 7:133859313-133859335 CATATTCAGAAAAGCTCTCTGGG - Intronic
1033097283 7:138442422-138442444 CAGAGTCAGGACTGCTCCCTGGG + Intergenic
1034202359 7:149290374-149290396 CAGTGTCAGGGCAGGTCTCACGG - Intronic
1034467053 7:151235962-151235984 AAGAAACAGGGCAGCTCTCTGGG - Intronic
1035185129 7:157120451-157120473 GGGAGTCTGGACGGCTCTCTAGG - Intergenic
1036239412 8:7069549-7069571 CTGAGACAGGGAAGCTCTCTTGG + Intergenic
1036262478 8:7251576-7251598 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1036304110 8:7587982-7588004 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
1036314517 8:7710115-7710137 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1036354964 8:8035974-8035996 CCGAGACAGGGAAGCTCTCTTGG + Intergenic
1036817040 8:11910065-11910087 CTGAGACAGGGAAGCTCTCTTGG - Intergenic
1036833772 8:12041571-12041593 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1036855616 8:12288136-12288158 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1036878326 8:12491842-12491864 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1036903934 8:12691979-12692001 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1036906407 8:12711649-12711671 CTGAGACAGGGAAGCTCTCTTGG - Intergenic
1037219079 8:16495317-16495339 AAGAGGCAAGAGAGCTCTCTGGG - Intronic
1039276108 8:35935313-35935335 AATGGTGAGGACAGCTCTCTGGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG + Intergenic
1041804741 8:61837612-61837634 CAAAGTGAGGACAGCTGCCTGGG + Intergenic
1043398900 8:79864731-79864753 GACAGTCAGGCCAGCTGTCTAGG + Intergenic
1044695647 8:94919944-94919966 CAGATTCAGGAAGGCTCTGTGGG + Intronic
1045778795 8:105839074-105839096 AAGGGGCAAGACAGCTCTCTGGG - Intergenic
1046663347 8:116973067-116973089 AAGAGACAAGGCAGCTCTCTGGG - Intronic
1047275534 8:123402285-123402307 CAGAGTCAGGACTGCTCCCTGGG + Intronic
1047632592 8:126724567-126724589 AAGGGACAAGACAGCTCTCTTGG - Intergenic
1048042293 8:130743031-130743053 AAAAGGCAAGACAGCTCTCTGGG - Intergenic
1048133376 8:131721579-131721601 CAGAGCCAGGACATCTCATTTGG + Intergenic
1048818947 8:138361841-138361863 CAGAGTCAGAACAGATGTCTCGG - Intronic
1049427466 8:142543846-142543868 CAGGGTCAGGCCAGCCCTCAGGG - Intronic
1049802739 8:144525750-144525772 CAAAGACAGGACACCTTTCTGGG - Exonic
1051636629 9:19186664-19186686 CAGAGCCAGGACAGGACTCTAGG - Intergenic
1051682089 9:19617696-19617718 CAAAGTCAGGAGAGTTCTCATGG - Intronic
1051698590 9:19794819-19794841 CAAAGGCAGGACAGCCCACTCGG + Intergenic
1052234348 9:26191977-26191999 CAGGGACAAGGCAGCTCTCTGGG - Intergenic
1052358158 9:27527778-27527800 CAGAGGCAAGACAACTCGCTGGG + Intronic
1052941163 9:34132980-34133002 CAGAGTCAGGGCTGCTCCCTGGG - Intergenic
1053639508 9:40057250-40057272 GAGAGTCATCAAAGCTCTCTTGG - Intergenic
1053766573 9:41407864-41407886 GAGAGTCATCAAAGCTCTCTTGG + Intergenic
1054320310 9:63653909-63653931 GAGAGTCATCAAAGCTCTCTTGG - Intergenic
1054545240 9:66319369-66319391 GAGAGTCATCAAAGCTCTCTTGG + Intergenic
1056893854 9:90522631-90522653 CAAAGTGAGGACAGCTGCCTGGG + Intergenic
1056917611 9:90758811-90758833 CCGAGACAGGGAAGCTCTCTTGG - Intergenic
1058362986 9:104172063-104172085 CCGAGTCAGGACAACTCTGAAGG + Intergenic
1059149464 9:111936195-111936217 AAGAGGCAAGAAAGCTCTCTGGG - Intergenic
1059625844 9:116065152-116065174 CAGAGGCAGGACAGCTATCTGGG + Intergenic
1061223748 9:129267879-129267901 AAGGGACAAGACAGCTCTCTGGG - Intergenic
1062117165 9:134815663-134815685 CAGAGGCAGGCCAGCACTGTGGG - Intronic
1062522038 9:136961940-136961962 CAGAGTCAGGACAGCCACCAGGG + Intergenic
1202787380 9_KI270719v1_random:40946-40968 GAGAGTCATCAAAGCTCTCTTGG - Intergenic
1186277545 X:7956442-7956464 CAGAGTCAGAACAGGGCTGTAGG - Intergenic
1187722790 X:22169554-22169576 CAGAGCCAGGACTGATATCTGGG + Intronic
1189361789 X:40358982-40359004 CAAAGTCAGGACCGCTCCCTGGG - Intergenic
1189658995 X:43277918-43277940 CAGAGTCATTACTGCTCCCTGGG - Intergenic
1190522563 X:51295180-51295202 CATGGTCAGGAAAGCTTTCTTGG + Intergenic
1190525803 X:51328369-51328391 CATGGTCAGGAAAGCTTTCTTGG + Intergenic
1192233101 X:69279214-69279236 CAGAGGCAGGACTGCTGTCCAGG + Intergenic
1193443904 X:81576909-81576931 CAGACTCTAGGCAGCTCTCTGGG - Intergenic
1194193139 X:90861163-90861185 CAGTGTCACTGCAGCTCTCTAGG + Intergenic
1194323466 X:92480941-92480963 CAGAGGCAGCATGGCTCTCTAGG + Intronic
1194472781 X:94317988-94318010 AAGAGGCAAGACAGCTCTCTTGG + Intergenic
1194548959 X:95272933-95272955 CAATGTCAGGCCATCTCTCTCGG + Intergenic
1194800291 X:98264466-98264488 CAGTGGCAGGAAAACTCTCTGGG - Intergenic
1196158776 X:112459638-112459660 TAGAGTCAGGAGAACTATCTTGG + Intergenic
1200081521 X:153579121-153579143 CAGAGCCAGGCCAGAGCTCTGGG + Intronic
1200539753 Y:4443613-4443635 CAGTGTCACTGCAGCTCTCTAGG + Intergenic
1200631567 Y:5594107-5594129 CAGAGGCAGCATGGCTCTCTAGG + Intronic
1201259530 Y:12145028-12145050 CAGATTGAGGTCAGCTCTGTGGG - Intergenic