ID: 1151769708

View in Genome Browser
Species Human (GRCh38)
Location 17:76152244-76152266
Sequence CCTTCTTGGCAGGAACTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151769700_1151769708 -2 Left 1151769700 17:76152223-76152245 CCAGCACTAGCACACCCCAGGCC 0: 1
1: 0
2: 1
3: 18
4: 214
Right 1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 187
1151769696_1151769708 26 Left 1151769696 17:76152195-76152217 CCTTCTTACTTCCTTCAGCAACT 0: 1
1: 0
2: 5
3: 18
4: 356
Right 1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 187
1151769698_1151769708 15 Left 1151769698 17:76152206-76152228 CCTTCAGCAACTGGTCTCCAGCA 0: 1
1: 0
2: 0
3: 17
4: 235
Right 1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151769708 Original CRISPR CCTTCTTGGCAGGAACTGCA GGG Intronic
901107952 1:6772011-6772033 CCTCCTTGGAAGGAACAGTACGG - Intergenic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
903567047 1:24275480-24275502 CCTGCTTGGTGGGGACTGCAGGG - Intergenic
908879987 1:68720673-68720695 CATTAGTGGGAGGAACTGCAAGG - Intergenic
910065986 1:83151366-83151388 CTTTCTTGGCAGGCAGTCCAGGG + Intergenic
910653828 1:89599878-89599900 TCTTGGTGCCAGGAACTGCATGG - Intergenic
911559372 1:99385258-99385280 CCTGCTTGGCAGGATCAGCTGGG + Intergenic
911733222 1:101311066-101311088 ACTTCTTGGCATGAAGTGGAAGG - Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
913247885 1:116886339-116886361 CAGTCTTGGCAGGCACTGCTGGG - Intergenic
913382275 1:118225460-118225482 CCTTCTGAGCATGAACTGCAAGG - Intergenic
917524069 1:175771638-175771660 CCTACTTAGAAGGACCTGCAAGG + Intergenic
918082414 1:181217824-181217846 CCACCTTGGCAGGAAAGGCATGG - Intergenic
918615561 1:186540474-186540496 CCTGCTTGGCAGGGATTGCCTGG + Intergenic
1063043425 10:2367900-2367922 CCATCTTGGCTGGACCTGCCTGG + Intergenic
1063484865 10:6410441-6410463 CCTTCTTGGGAGGAAATGTAGGG + Intergenic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1064561513 10:16599186-16599208 CTTTCCTCTCAGGAACTGCAAGG - Intronic
1066586565 10:36943045-36943067 CCATCTTTGCTGGAACAGCATGG + Intergenic
1067035871 10:42916103-42916125 CCCTCTGGGCAGCAACAGCAGGG + Intergenic
1067202715 10:44187136-44187158 TCATCTTGGAAGGAACAGCAGGG + Intergenic
1072816046 10:98510411-98510433 GCTTTTTGCCAGGATCTGCATGG + Intronic
1073068850 10:100780886-100780908 CCTTCTAGGCAGCACCTCCATGG - Intronic
1073540808 10:104315223-104315245 CCTGCACGGCAGGAACAGCATGG - Exonic
1073745803 10:106467223-106467245 CCATCTTGGAAGCAACTCCAAGG - Intergenic
1079842191 11:25417385-25417407 CCTTCTTGGCAGAAGAAGCATGG + Intergenic
1080622619 11:33999278-33999300 CATTCTTGGCTGGCACTGGAAGG - Intergenic
1081447365 11:43143877-43143899 CCTTCTTGGGTGGGACTGCCTGG + Intergenic
1081529672 11:43949271-43949293 CCATTTTGGGAAGAACTGCAGGG + Intergenic
1081969761 11:47189612-47189634 CATTCTAGGCAGGAGCTTCAGGG + Intergenic
1082005831 11:47418510-47418532 TCCTCTGTGCAGGAACTGCAGGG + Intergenic
1083191763 11:61057209-61057231 CCTGTTTCCCAGGAACTGCAGGG - Intergenic
1085512304 11:77094543-77094565 AATTATTGGCAGGGACTGCAGGG + Intronic
1086218252 11:84409116-84409138 CTTTCTTGGGGGGAAGTGCAAGG - Intronic
1087925030 11:103910291-103910313 CCATCTTGCCAGCAACTCCAGGG - Intronic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1093207230 12:16265017-16265039 ACTTCTTGCCATGAACTTCAAGG - Intronic
1095393686 12:41739596-41739618 CCTTCATGGCAAGCTCTGCAGGG + Intergenic
1097913838 12:64999202-64999224 ACTTCCTGGCAGGAACTTCTAGG + Intergenic
1099038430 12:77619554-77619576 CCTTCTAAGCAGGCATTGCATGG + Intergenic
1100387632 12:94118532-94118554 CCTAATGGGCAGGACCTGCAAGG + Intergenic
1100424844 12:94474816-94474838 AATTCTTGCCAGGAAATGCAAGG - Intergenic
1102612132 12:114121622-114121644 CCTTCTTGGCAGGAATCCCATGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1116803598 14:49468715-49468737 CCTTCTGGGGAGAAACTGAATGG + Intergenic
1116874010 14:50093383-50093405 GCTTCTTGCCAGGAACCTCAGGG + Intergenic
1117214208 14:53533473-53533495 CCTTTTTCTCACGAACTGCATGG - Intergenic
1119645582 14:76346236-76346258 CCTTAAGGGCAGGATCTGCATGG - Intronic
1122714465 14:103686329-103686351 TCTTCTTGGAAGGAACTCCTTGG - Intergenic
1127190600 15:56526562-56526584 CCTTCTTGACATGAACTACAGGG + Intergenic
1127275394 15:57439006-57439028 CCTTCCTGCCAGGAACTGGACGG + Exonic
1129239888 15:74244948-74244970 GACTCTTGGCAGGAACTGAATGG - Intronic
1129612393 15:77071030-77071052 CCTCCTCGCTAGGAACTGCACGG + Exonic
1130057277 15:80537375-80537397 CCTTCTGGTGAGGTACTGCAGGG - Intronic
1130401536 15:83559594-83559616 CAATCTTGGCAGTTACTGCAAGG + Intronic
1131012047 15:89026295-89026317 CCTTCTTGCCCACAACTGCAAGG - Intergenic
1132327734 15:100985827-100985849 ACTCCTTTGCAGGAAGTGCAGGG - Intronic
1133055035 16:3141625-3141647 CATTCCTGGCAGGGACAGCAGGG + Exonic
1133201836 16:4208521-4208543 CCTTCTTGGAAGCATCTCCAAGG - Intronic
1133690514 16:8210103-8210125 CCCTCTTGTCAGAGACTGCAGGG - Intergenic
1135080266 16:19428094-19428116 CTTTCTTGGAAGGAAGTTCATGG - Intronic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1135821452 16:25690302-25690324 GGTGCTAGGCAGGAACTGCAAGG + Intergenic
1137051311 16:35715113-35715135 GCTTGTTAGTAGGAACTGCAAGG + Intergenic
1137794449 16:51203509-51203531 CTTTCTTGGGAGGAAGGGCAAGG + Intergenic
1139832690 16:69812717-69812739 CATTCTTGGCAGGAACACCCAGG + Intronic
1140971792 16:80020486-80020508 CCTGATTGGCTGGAACTTCAAGG - Intergenic
1141245357 16:82302115-82302137 CTTTCTTGGCAGGGCGTGCAAGG + Intergenic
1141961378 16:87411658-87411680 ACTTCATGGCAGGGACAGCAGGG - Exonic
1142204614 16:88776913-88776935 ACTTCTTGGCAGGGACTAGAAGG + Intronic
1143521021 17:7444481-7444503 CCTTCTTGGCCTGACCTGTAGGG - Exonic
1143756611 17:9072282-9072304 CCTTCTTGGCAGACAGTCCACGG - Intronic
1144280516 17:13721667-13721689 CTTTCTTGGCAGGTAGGGCAAGG + Intergenic
1145063761 17:19748352-19748374 CTTCCTGGGCAGGAACTCCAAGG - Intronic
1145838352 17:27972053-27972075 CCATCTTGCCAGCAACTGGAGGG + Intergenic
1146281700 17:31549405-31549427 CCTCCTTGCCAGGGGCTGCAAGG + Intergenic
1151349157 17:73521456-73521478 TCTTCTTCCCAAGAACTGCATGG - Intronic
1151354700 17:73551433-73551455 CATTCCTGGCAGGAGCTGCGAGG - Intronic
1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG + Intronic
1152910294 17:83001198-83001220 ACTACTTTGCAGGAACTCCAGGG + Intronic
1155530077 18:26758063-26758085 CCCTTTTGACTGGAACTGCAGGG + Intergenic
1155860256 18:30889251-30889273 GCCCCTTGGCAGTAACTGCAAGG + Intergenic
1156549984 18:38005133-38005155 CCTCCTTGAGAGGAACTCCAGGG + Intergenic
1157211007 18:45742004-45742026 CACTCTGTGCAGGAACTGCATGG - Intronic
1162361720 19:10224386-10224408 CATCCTTGGCTGGAACTGCCTGG - Exonic
1162792330 19:13069543-13069565 CCTGCCTGGCAGGGACTGCCAGG + Intronic
1164868525 19:31624970-31624992 CCTTCTTGGAAGGATGTTCACGG + Intergenic
1165363955 19:35352522-35352544 GCTGCTTCGGAGGAACTGCAGGG + Exonic
1165968353 19:39603981-39604003 CCTTCTTGGAAGGATGTCCATGG + Intronic
1166177318 19:41083557-41083579 CCTGGTAGGCAGGAACTTCATGG + Intergenic
1166521857 19:43486265-43486287 CCGTGATGGCAGGAACAGCAGGG + Exonic
1168706508 19:58473294-58473316 CCTTCATGGCAGGGACAGAAAGG + Exonic
927487467 2:23498461-23498483 CCTGCTTGGCAGGGAGGGCAGGG - Intronic
927648994 2:24899462-24899484 CCTACTGGGCAGGAAATCCAGGG - Intronic
928625884 2:33139575-33139597 CTTTCTAGGCAGGGACAGCAAGG - Intronic
929217909 2:39436085-39436107 TCTTCTTGGCAGTAACTGTGAGG + Intronic
929660287 2:43777489-43777511 CCTTCCTGGCAGGAACTTTGTGG - Intronic
930483221 2:51976040-51976062 CCTTGTTGGAGAGAACTGCAAGG - Intergenic
932739770 2:74282715-74282737 CCTTCTTGGCAAGGGCTCCACGG + Intronic
933817829 2:86082402-86082424 CTTTCTTGGCAGTAACTGTTAGG - Intronic
933834552 2:86234783-86234805 CGTCCTTGGCAGGAACAGCTGGG + Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
937092368 2:119214949-119214971 CCTTCTTGTCATGAAGTTCAGGG - Intergenic
940429140 2:153567479-153567501 CCTGCTTTGCAGGCACAGCATGG + Intergenic
942495291 2:176533819-176533841 CTTTCTTTGCAGGAAATGAAGGG - Intergenic
943077178 2:183209591-183209613 CATTCTTGGCAGGACCCCCATGG + Intergenic
945492909 2:210476758-210476780 CCCTCCTGGCAGGAACTGGGCGG - Intronic
946671883 2:222113867-222113889 CATTCTTGGCAAGCACTGAACGG + Intergenic
948276795 2:236715145-236715167 CCTCCTTGGAAGGATTTGCAAGG - Intergenic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
1172929192 20:38571385-38571407 TCTAGTTGTCAGGAACTGCAGGG - Intronic
1173187555 20:40852527-40852549 CCTTATAGGCATGAATTGCAAGG + Intergenic
1174298785 20:49567840-49567862 CCTTCTTGGCAGGGGGAGCACGG + Intronic
1176030401 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG + Intergenic
1179567908 21:42260648-42260670 GCTCCTTGGCAGGAGCTGCTTGG - Intronic
1179984060 21:44911592-44911614 CCCACCTGGCAGGGACTGCAGGG - Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1180953227 22:19730145-19730167 CCTTCTAGGCAGGAACAGGTTGG + Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181865205 22:25849124-25849146 GCTGCTTGGCAGGAAGTGCTGGG + Intronic
1183265806 22:36824339-36824361 CCTTCTTGGGTGGTACTGGAGGG + Intergenic
1184243189 22:43222257-43222279 GCTTCTTGGCATGCTCTGCACGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
950008463 3:9705687-9705709 CCTTCTTGGCTGCCACTGCTGGG + Intronic
950971691 3:17195457-17195479 CCTTGGTGCCAGGAACAGCAAGG - Intronic
953351135 3:42217049-42217071 CCTTCTTGGCAGGAAATAGGGGG - Intronic
954142957 3:48619785-48619807 CCTTCTTCCCAGGCCCTGCAAGG - Intergenic
954233035 3:49233453-49233475 CCTTAATGCCAGGAACTGGAGGG + Intronic
955443077 3:58977977-58977999 CCTTCCTCTCAGGAACTGAATGG + Intronic
957030315 3:75233116-75233138 CTTACTTGGAAGGAACTCCAAGG - Intergenic
957156476 3:76551010-76551032 CCTTCTAGGCAGGGACAGCTAGG + Intronic
961368948 3:126418096-126418118 CCTTCTAGCCAGGACCTGAATGG - Intronic
961564124 3:127751279-127751301 CCTTGCTGGGAGGAGCTGCAGGG - Intronic
966858265 3:184211462-184211484 CATTTTTGGCAGGAACACCACGG + Intronic
971340354 4:25763030-25763052 GCTTGTGGGCAGGGACTGCAAGG + Intronic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
972090882 4:35281925-35281947 TCTTTTTGGCAGAAACTGAAAGG + Intergenic
976203702 4:82604378-82604400 CCTCCTTGGCAGGAACAACAGGG - Intergenic
976787298 4:88836418-88836440 CTCTCTTGGGAGGATCTGCAAGG + Intronic
979189180 4:117835293-117835315 CCCTCATCGCAGGACCTGCAAGG - Intergenic
982460773 4:155667050-155667072 CCTTATGGAAAGGAACTGCAAGG + Intronic
983104317 4:163667272-163667294 CATTCTTGGCTGAAACTGCAAGG + Intronic
986090128 5:4496216-4496238 CATTTTTGGCAGGAACGCCAAGG + Intergenic
986993517 5:13580041-13580063 CCGTGCTGGCAGCAACTGCATGG - Intergenic
992750112 5:79853822-79853844 CCTTCTTGACATGAGCTGCCTGG + Intergenic
993480585 5:88419460-88419482 TTTACTTGGCAGTAACTGCAAGG - Intergenic
995332582 5:110961676-110961698 ACTTCTTGGAAGGACCAGCATGG - Intergenic
995468988 5:112480309-112480331 CCTCCTGGACAGGAACAGCAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995741845 5:115364010-115364032 CCTTCGTGGGAGGGAGTGCAAGG + Intergenic
996881517 5:128302291-128302313 ACTGCATGCCAGGAACTGCATGG - Intronic
997871831 5:137512843-137512865 CATTTTTGGCAGGAACGCCAAGG - Intronic
1001796180 5:174504218-174504240 CTTTCTTTGCAGGAAATGAAGGG + Intergenic
1002461341 5:179375476-179375498 CCATCTGGGTGGGAACTGCATGG - Intergenic
1005109066 6:22258790-22258812 GCATCTTGACAGGAACTGCCTGG + Intergenic
1005781905 6:29201458-29201480 GCCTCTTGGCAGGAACAGCCTGG + Intergenic
1006593257 6:35173606-35173628 CTTTCCTGGCAAGACCTGCAGGG - Intergenic
1008685964 6:53926703-53926725 GCTTGGTGGCAGGAATTGCAGGG - Intergenic
1014122463 6:117740712-117740734 CCTTATTGATAAGAACTGCAGGG - Intergenic
1015980759 6:138836033-138836055 CCTTCTTGGCAGGAATAGCGCGG + Intronic
1016210802 6:141531436-141531458 ACATCTTGGCAGGAACAGCCTGG + Intergenic
1016354999 6:143209117-143209139 TCTTTATTGCAGGAACTGCAGGG - Intronic
1020712782 7:11629671-11629693 CAGTCTTGGGAGTAACTGCAAGG - Intronic
1021973274 7:25985444-25985466 CAGTCATGGCAGGAGCTGCAGGG - Intergenic
1027278123 7:76583409-76583431 CTTTCTTGGCAGGCAGTCCAGGG - Intergenic
1034293662 7:149951577-149951599 CCTCCTTGTCATGAACTGCCTGG - Intergenic
1034812405 7:154145276-154145298 CCTCCTTGTCATGAACTGCCTGG + Intronic
1035218722 7:157391512-157391534 CCTGCTTGGCAGGGACTGGCAGG - Intronic
1035232190 7:157471958-157471980 CTTGCTTGGCAGGAAATGCCTGG - Intergenic
1035311978 7:157975193-157975215 CAGTGTTGGCAGGAACTGGAGGG - Intronic
1036161673 8:6394673-6394695 CATTCTTGGCAGGAACCCCCTGG + Intergenic
1036450541 8:8863430-8863452 CCATCTAGGCAGGAAATACATGG - Intronic
1037910446 8:22740883-22740905 CCTTCTCCCCAGGAACTTCAAGG - Intronic
1038455405 8:27669412-27669434 CCACCCTGGCAGGACCTGCAGGG - Intronic
1039969079 8:42306419-42306441 ACTTCTTACCAGGTACTGCAGGG - Exonic
1040275615 8:46012231-46012253 CCTTCCTGGCAGCCCCTGCATGG - Intergenic
1040275944 8:46013716-46013738 CCTTCCCGGCAGGCACTGCGTGG - Intergenic
1040453961 8:47577306-47577328 CAGTCCTGGCAGGAACTGCTTGG - Intronic
1041463512 8:58137090-58137112 CCTTTTAGCCAGAAACTGCATGG + Intronic
1041475929 8:58266020-58266042 CCTTCTTATCAGAAACTGTAAGG + Intergenic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1047529167 8:125659675-125659697 CCTTCCAGGCAGGAACTTTAAGG + Intergenic
1048969977 8:139640011-139640033 GCTGCTTGGCAGGAAGTGGATGG - Intronic
1049228563 8:141470130-141470152 CCTTCAGGGCAGGTTCTGCAGGG + Intergenic
1052811155 9:33061787-33061809 GCTTCTTGGGAAGAAGTGCAAGG + Intronic
1057747900 9:97766392-97766414 CCTTCTGTGCAGGAAAGGCAGGG + Intergenic
1058270678 9:102968099-102968121 GCCTCTTGGCAGGAACAGCCTGG - Intergenic
1058335502 9:103823358-103823380 CATTCATGGCAGGAAGTGAAGGG + Intergenic
1058899691 9:109431193-109431215 CCTTTTTGGCAGAGCCTGCAGGG - Intronic
1059344073 9:113616446-113616468 CGTTCCTGGAAGGAACTCCAAGG + Intergenic
1060818354 9:126647649-126647671 GCTTCCTGGAAGGAACTGCTGGG - Intronic
1061370766 9:130196134-130196156 CTGTCTTGGCGGGAACTGCTGGG + Intronic
1061638052 9:131927902-131927924 GCTTCTTGGCAGGGACTGCTTGG + Intronic
1187493882 X:19777702-19777724 CCTACTTGGAAGCAATTGCAGGG + Intronic
1189074542 X:37902617-37902639 CTTTCCTGGCAGGAACTGAAAGG + Intronic
1199980162 X:152916448-152916470 CCTGCTTGGCAGCAACTGAGGGG - Intronic
1200235015 X:154463943-154463965 CCTTCGCGGCAGCACCTGCACGG - Exonic