ID: 1151770816

View in Genome Browser
Species Human (GRCh38)
Location 17:76159464-76159486
Sequence CCATCTCCAAGCACGTGAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151770810_1151770816 16 Left 1151770810 17:76159425-76159447 CCATCACTGCCATATGAAGGGAG 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1151770816 17:76159464-76159486 CCATCTCCAAGCACGTGAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1151770811_1151770816 7 Left 1151770811 17:76159434-76159456 CCATATGAAGGGAGCATTCCTGA 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1151770816 17:76159464-76159486 CCATCTCCAAGCACGTGAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151770816 Original CRISPR CCATCTCCAAGCACGTGAAG TGG Exonic
906739327 1:48166618-48166640 CTATCTCCAAGTATGTGGAGCGG - Intergenic
908003272 1:59702697-59702719 CCATCTTCAAACCCGTAAAGTGG + Intronic
911093796 1:94039487-94039509 CCATCTCCAAGGAGCTGCAGTGG - Intronic
912880683 1:113410061-113410083 CCATCTTCAGGCAAGAGAAGTGG - Intronic
921046109 1:211479099-211479121 CCATCTCCGAGGACGTGGAGCGG - Exonic
921589326 1:216985317-216985339 CCACCTCCACGCACTGGAAGAGG + Intronic
921802888 1:219421428-219421450 CCATTTACAAGCACCTGAGGAGG + Intergenic
923215297 1:231843366-231843388 CCATTTCCAAGCTCCTTAAGTGG - Intronic
924936402 1:248775570-248775592 CTATCTCCAACCACTTGAAAAGG + Intergenic
1072622938 10:97092352-97092374 TCATCTCCAAGCACTTGCATAGG + Intronic
1074589487 10:114799290-114799312 CCATCACCAAGGGAGTGAAGAGG - Intergenic
1075835552 10:125449805-125449827 TCATCACCCAGCACGAGAAGGGG + Intergenic
1076256603 10:129031576-129031598 CTACCTCCCAGCACTTGAAGTGG + Intergenic
1078857634 11:15219607-15219629 CTATCTCCAAGCATGTGTTGGGG + Intronic
1081403996 11:42675181-42675203 CCATCTGCAAGCAGGGAAAGAGG - Intergenic
1096464510 12:51840966-51840988 CCACCCCCATGCACGGGAAGGGG - Intergenic
1098850825 12:75594037-75594059 CCCTCTCTAACCACCTGAAGTGG - Intergenic
1099230136 12:80014069-80014091 CCATAGCCTAGCAGGTGAAGTGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1102447082 12:113011433-113011455 CAATCTCCAAGGAGGTGATGGGG + Exonic
1102935884 12:116896709-116896731 CCATCTCCAAGCAAGTACTGAGG - Intergenic
1104137331 12:125952882-125952904 CCATCTCCACACACATGGAGTGG + Intergenic
1104380090 12:128299826-128299848 CCACCTGCAATCACGTGTAGGGG - Intronic
1105790792 13:23796768-23796790 CCATCTCCAAGCTGGTACAGTGG + Intronic
1112196787 13:97234274-97234296 ACATCTTCAAGTACGTGAAGGGG - Intronic
1121729867 14:96179087-96179109 CCATCTTCAAGCACATGGAAGGG - Intergenic
1121851164 14:97222368-97222390 ACTTCACCAAGCAGGTGAAGAGG - Intergenic
1128676244 15:69611062-69611084 CCAGCTCCAAGCAGGTGACAAGG + Intergenic
1131327116 15:91458705-91458727 CAATCTGGAAGCACGGGAAGTGG - Intergenic
1132533781 16:467291-467313 CCAGCTCCAGGCTCCTGAAGAGG + Intronic
1132553565 16:563420-563442 ACTTCTCCAGGCAGGTGAAGGGG - Exonic
1132650594 16:1019830-1019852 CCATTTCCTAGCACGTGGACGGG - Intergenic
1132762855 16:1519449-1519471 CCAGCTCCAAGCTTGTGGAGAGG - Intronic
1132779758 16:1616367-1616389 GCATCTCCAAGAGGGTGAAGGGG - Intronic
1132802756 16:1762377-1762399 CCATCTCCACCCGCGTGAAGCGG - Exonic
1134630101 16:15750138-15750160 TCATCCCCAACCACGAGAAGAGG - Exonic
1137564092 16:49522465-49522487 ACATATCCAAGCAGGTGATGGGG - Intronic
1147225367 17:38972454-38972476 CCATCTCAAAGCTAGTGAATGGG + Intergenic
1147817217 17:43218721-43218743 CCATCTCCAAGGACTTTCAGGGG + Exonic
1149971365 17:61221600-61221622 CCAGCTCTAAGAAAGTGAAGGGG - Intronic
1150123613 17:62622527-62622549 CCTTCTCCAAGCCAGGGAAGAGG - Intergenic
1151718197 17:75842274-75842296 CCATCTCCAGGCACGTTAGGTGG - Intronic
1151770816 17:76159464-76159486 CCATCTCCAAGCACGTGAAGTGG + Exonic
1156400568 18:36736053-36736075 CCATCACAAGGCCCGTGAAGGGG - Intronic
1163602545 19:18257701-18257723 CCAGCTCCACCCACGTGACGGGG + Exonic
1168110596 19:54189587-54189609 CGAGCTCCGAGTACGTGAAGGGG + Exonic
925478834 2:4247942-4247964 CTGTCTGCAAGCACGAGAAGAGG + Intergenic
936171478 2:110180739-110180761 CCATCCCCAACCAAGAGAAGTGG + Intronic
941703088 2:168626595-168626617 CCATATCCAAGCAAATGTAGTGG + Intronic
944791102 2:203128169-203128191 CCATCTCCCAGAAGGAGAAGTGG + Intronic
945823579 2:214694248-214694270 CCATCTTCAAGCACCTACAGGGG - Intergenic
949048316 2:241882382-241882404 GCCTCTCCAAACACGTGACGTGG + Intergenic
1169265858 20:4167060-4167082 CCAGCTCCAAGCTCATGAAAGGG - Intronic
1170449271 20:16465358-16465380 CCATCTCCAAGGACTTGAGAGGG - Intronic
1172094914 20:32455889-32455911 CCTTCTCCGAGCCTGTGAAGTGG - Intronic
1175751397 20:61500410-61500432 CCCTCTCCACGCCCGTGATGTGG - Intronic
1178840263 21:36132950-36132972 CCAACCCCAGCCACGTGAAGAGG + Intergenic
1179721032 21:43316171-43316193 CCACCTCCAAGCACAAGCAGGGG - Intergenic
1179893458 21:44349401-44349423 CCATGTCCAGGGAAGTGAAGAGG - Intergenic
1180260290 21:46663724-46663746 CCATCTGACAGCACGGGAAGTGG + Intronic
1182831005 22:33304468-33304490 CCATCTGCAAGCACTGGGAGGGG - Exonic
1182898133 22:33875486-33875508 CCATCTCCAACCATGCCAAGGGG + Intronic
1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG + Intronic
950532693 3:13561763-13561785 CCATATCCCAGCACCTGCAGTGG + Intronic
952032553 3:29161841-29161863 CCATCCCAAAGCTTGTGAAGTGG + Intergenic
952935734 3:38397063-38397085 ACATCTGCAAGCACCTGAAAAGG - Exonic
953178088 3:40570247-40570269 ACATCTCCAAGCAAGGGTAGAGG + Intronic
953848930 3:46450455-46450477 CCATATCCAAGCAAGTGGGGAGG + Intronic
954752892 3:52823621-52823643 CCATCTCTGAGCCCTTGAAGAGG + Exonic
955157767 3:56434126-56434148 CCATCTGCAACCATGTGAAAAGG + Intronic
958890176 3:99774524-99774546 CCATCTCCCAGCATGTGATTAGG - Intronic
966576327 3:181506613-181506635 CCTTCACCAACCACGTGAATAGG + Intergenic
966918987 3:184600344-184600366 TCAGCTCCAGGCAGGTGAAGGGG - Intronic
975824769 4:78308131-78308153 CCATCTCTCAGCACGTGGAGGGG - Exonic
976100288 4:81554934-81554956 CCATCCCCAACCCCGGGAAGGGG - Intronic
982173519 4:152683809-152683831 CCATCTCACTGCGCGTGAAGTGG + Intergenic
985834950 5:2263521-2263543 GCATTTCCATCCACGTGAAGAGG - Intergenic
987123633 5:14791208-14791230 CCCTCTCCAGGCACCCGAAGGGG - Intronic
992108398 5:73469940-73469962 CCATGTCCGAGAGCGTGAAGAGG + Intergenic
992890795 5:81202218-81202240 CCATCCCCAAGCACGGACAGAGG - Intronic
1000866881 5:166524864-166524886 CCATCTCCTAACACAGGAAGGGG - Intergenic
1005293557 6:24402013-24402035 CTTTTTCCAAGCACCTGAAGGGG + Intergenic
1009541837 6:64969622-64969644 CCATCTTCAAGCAAAAGAAGTGG - Intronic
1010133899 6:72527387-72527409 CCATGTGCAAGAACGTGAATGGG + Intergenic
1013416696 6:109931969-109931991 CCATCTGCAAGCTGGGGAAGAGG + Intergenic
1017595870 6:156027893-156027915 CCACCTCAAAGCATGTGGAGAGG + Intergenic
1022560005 7:31337655-31337677 CCATCTGCAAATACTTGAAGAGG + Exonic
1028528275 7:91809487-91809509 TCATCTCCAAGGAGGTGAATTGG - Intronic
1031386074 7:121152253-121152275 TCATCTTCAAGCATGTGGAGGGG - Intronic
1031973094 7:128077704-128077726 CCACCTCTAAGCATGTGGAGAGG - Intronic
1032400911 7:131623682-131623704 CCATCTCCAAGCACGTACATGGG - Intergenic
1033146129 7:138871295-138871317 CCATCTTCGAGCACGTGGACAGG - Exonic
1033275858 7:139971251-139971273 CCTCCTCCCAGCCCGTGAAGAGG + Intronic
1059467452 9:114477976-114477998 CCAGCTTCAACCACGAGAAGGGG + Intronic
1061382047 9:130264696-130264718 CCATATCCAAGCACATGGTGGGG - Intergenic
1061662298 9:132138246-132138268 GCATCTCAAAGCACGGCAAGAGG + Intergenic
1187140792 X:16591760-16591782 CCTTCTCCAAGCAGGTCAAAAGG + Intronic
1193625933 X:83819866-83819888 CCATCTCCAGCCAGGGGAAGTGG - Intergenic
1199139465 X:144292738-144292760 CTATCTCCAAGGACGTTATGAGG + Intergenic
1200250565 X:154551650-154551672 ACACCTCCAAGCAGGAGAAGTGG - Intronic