ID: 1151774452

View in Genome Browser
Species Human (GRCh38)
Location 17:76189913-76189935
Sequence GACCCACTGCTTCTTGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151774452_1151774458 19 Left 1151774452 17:76189913-76189935 CCAGGCGCAAGAAGCAGTGGGTC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 1151774458 17:76189955-76189977 GACCTTCCAGCACCTCCCACTGG 0: 1
1: 0
2: 3
3: 17
4: 236
1151774452_1151774461 29 Left 1151774452 17:76189913-76189935 CCAGGCGCAAGAAGCAGTGGGTC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 1151774461 17:76189965-76189987 CACCTCCCACTGGCAGCACATGG 0: 1
1: 1
2: 1
3: 47
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151774452 Original CRISPR GACCCACTGCTTCTTGCGCC TGG (reversed) Intronic
901118495 1:6869220-6869242 GAAGCACTGCTGCTGGCGCCTGG + Intronic
901638830 1:10682913-10682935 ATCCCCCTGCTTCTTGTGCCTGG + Intronic
906211283 1:44013581-44013603 CACCCACTTCTGCTTGGGCCTGG + Intronic
914213511 1:145603552-145603574 GCCCCACCACTTCTTGCTCCAGG - Intergenic
914465447 1:147923980-147924002 GCCCCACCACTTCTTGCTCCAGG - Intergenic
915726404 1:158020967-158020989 GGGCCACTGCTTCTTCCTCCTGG - Intronic
921433576 1:215090745-215090767 GCCCCACTCCTTCTTGAGCTAGG + Intronic
922783290 1:228269896-228269918 GACCGACTGCTCTTGGCGCCCGG + Intronic
1063140851 10:3255389-3255411 GAGCCACTGCTCCTGGCCCCCGG - Intergenic
1067063595 10:43090740-43090762 GCACCACTGCTGCATGCGCCTGG - Intronic
1067302754 10:45027569-45027591 GCCCCACTGCTACTAGCCCCAGG - Intergenic
1074670915 10:115789735-115789757 GACCCCCTGCTTCCTACGCCAGG + Intronic
1076810520 10:132884230-132884252 GAGCCACTGCTCCTCGCTCCGGG - Intronic
1078472763 11:11604908-11604930 GACCCACTGGCTATTGCTCCTGG + Intronic
1083664927 11:64269184-64269206 GGTCCACTCCTCCTTGCGCCGGG + Intergenic
1085716510 11:78878272-78878294 TAGCCACAGCTTCTTGTGCCGGG - Intronic
1089012437 11:115142035-115142057 GAACCAGTGCTCCTTGGGCCTGG + Intergenic
1091661398 12:2386502-2386524 GACACACTGATTCTTCTGCCTGG + Intronic
1097004231 12:55903422-55903444 CACCCTCCGCTGCTTGCGCCAGG + Exonic
1097025351 12:56051202-56051224 GAGCCACTGCCTCTGGCACCAGG + Intergenic
1097043099 12:56168053-56168075 TACTCACTGCTTCTCGCTCCCGG + Exonic
1099559180 12:84150540-84150562 GAGCCACTGCATCTGGCGCTTGG + Intergenic
1102796942 12:115696998-115697020 GACCCTCTGCTTCCTGCCCCAGG - Intergenic
1105752515 13:23434507-23434529 GAGCCCCTGCTTCTTGTACCTGG + Intergenic
1111298697 13:86318152-86318174 GAGCCACTGCTCCTGGCCCCTGG - Intergenic
1112983564 13:105418155-105418177 GTACCACTGCTTCTTTCACCTGG + Intergenic
1118770393 14:68938995-68939017 GGCCCCCTGCTTCTTGGCCCTGG - Intronic
1119902839 14:78275983-78276005 CACTCACTGCTTCTTGGGCCAGG + Intronic
1122814750 14:104306941-104306963 CGCTCCCTGCTTCTTGCGCCTGG - Intergenic
1124778871 15:32610772-32610794 GAATCACTGCTTCTAGGGCCTGG - Intergenic
1125179394 15:36864914-36864936 TAGCCACAGCTTCTTGCTCCAGG - Intergenic
1125653710 15:41338669-41338691 GAGCCACTGCGCCTGGCGCCTGG - Intronic
1128526471 15:68415562-68415584 CACCCACTGCTGCTTCCGGCAGG + Intronic
1136540626 16:30925888-30925910 GCACGACTGCTTCATGCGCCCGG - Exonic
1138346047 16:56320853-56320875 GACCCACTCCTTCATGCCTCAGG + Intronic
1141969368 16:87470046-87470068 GAACCACTGCTCCTGGCCCCAGG - Intronic
1144887931 17:18476710-18476732 GACCCACTTCCTCTTGCTGCCGG + Intergenic
1145144277 17:20467591-20467613 GACCCACTTCCTCTTGCTGCCGG - Intergenic
1145175728 17:20698991-20699013 GACCCACTTCCTCTTGCTGCCGG - Intergenic
1146002847 17:29141511-29141533 CACCCCATGCTTCTTGCCCCTGG + Intronic
1148911016 17:50942773-50942795 GACCCAGTTCTTCTAGAGCCTGG - Intergenic
1149565447 17:57637774-57637796 GGCCCTCTGCTCCTTGGGCCGGG - Intronic
1151515556 17:74592734-74592756 GACCCACTGCCCCTTCCCCCAGG + Exonic
1151774452 17:76189913-76189935 GACCCACTGCTTCTTGCGCCTGG - Intronic
1153501840 18:5757571-5757593 AACCCTCTGCTGCCTGCGCCGGG + Intergenic
1156183889 18:34639123-34639145 GAGCCACTGCTCCTGGCCCCAGG + Intronic
1159687177 18:71437099-71437121 GACCCAGTGCTCCTTCTGCCAGG + Intergenic
1160287731 18:77560786-77560808 GACTCACTGCCTCTTGCGCTGGG - Intergenic
1160428049 18:78791820-78791842 GAGCCACTGCTCCATGAGCCTGG - Intergenic
1160672757 19:374033-374055 GCCCCACTGCCTCTTGCCCTGGG + Intronic
1161967330 19:7555726-7555748 GGCCCGCTGCTTCGTGCGGCTGG - Exonic
1162692104 19:12441331-12441353 GACCTCCTGCTTCTTCCTCCTGG + Intronic
1162937137 19:13986903-13986925 GACCCTCTGCCTCCTGCCCCTGG + Intronic
1163559346 19:18009761-18009783 GCCCCACTGCTCCTTGCTGCAGG + Exonic
1163893876 19:20040455-20040477 GATCCAGTGCTTCTTACCCCTGG + Intergenic
1165455740 19:35909528-35909550 CACCCACCGCTCCTTGGGCCTGG + Intergenic
1166569484 19:43784739-43784761 GACCCCCAGCTTCTTCCTCCTGG - Intergenic
926198700 2:10778441-10778463 GACTCTCTGCTTCTGGCTCCTGG + Intronic
929727740 2:44448210-44448232 CACCCACTGCTCCTTACGCACGG + Intronic
932185440 2:69691397-69691419 GAGCCACTGCTCCTAGCCCCTGG + Intronic
936133777 2:109871290-109871312 CACCCTCTGCTGCTTGAGCCAGG - Intergenic
936210920 2:110500195-110500217 CACCCTCTGCTGCTTGAGCCAGG + Intergenic
936435447 2:112501298-112501320 CACCCTCTGCTGCTTGAGCCAGG + Exonic
941096656 2:161245081-161245103 GACCGACTGCTCTTGGCGCCCGG + Intergenic
948238433 2:236408323-236408345 GACCCACTGAGGCTTGCGCAAGG - Intronic
1178293497 21:31388919-31388941 GAGCCAGTGCTTCTTGCTGCTGG - Intronic
1178720138 21:35000877-35000899 GAGCCACTTCTTCTGGTGCCAGG + Intronic
1179525063 21:41970791-41970813 GCCCCACTGCTCCTTCTGCCAGG - Intergenic
1179575660 21:42306830-42306852 GACCAACAGCTGCTTGCACCGGG - Intergenic
1180611581 22:17101694-17101716 CACCCACAGCTTCTTGTCCCCGG - Intronic
1182410888 22:30185071-30185093 AACCCACTGCTTCTATCTCCTGG - Intergenic
1183210602 22:36449067-36449089 GACCTACAGCTTCTTGGGGCGGG - Intergenic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
954442921 3:50531486-50531508 TACCCAGTGCTTCTTCTGCCAGG - Intergenic
954640904 3:52097199-52097221 GGGCCACAGCTTCTTGGGCCTGG - Intronic
955402791 3:58605322-58605344 GACCCACAGGTTCTTGCCCAAGG - Intronic
959894484 3:111591088-111591110 GAGCCACTGCTTCTGGCCTCTGG - Intronic
961053798 3:123769222-123769244 CACCAACTCCTTCTTGCACCTGG - Intronic
961749581 3:129087380-129087402 CACCAACTGCTTCTTGCTCAGGG + Intergenic
962640982 3:137386140-137386162 AACCCAGTGCTTCATGCGCAGGG - Intergenic
964727740 3:159832327-159832349 GACCCAGTTCTTCTAGCACCTGG + Intronic
965282444 3:166771055-166771077 GCTCCTCTGCTTCTAGCGCCTGG - Intergenic
982407979 4:155041877-155041899 CCCCCACTGCTGCTTGCTCCAGG - Intergenic
982411512 4:155082821-155082843 GACCCTCTGCTTCTGGGGCTGGG + Intergenic
991302006 5:65137849-65137871 CATCCTCTGCTTCTTGGGCCCGG - Intergenic
992902399 5:81310988-81311010 CACCCACTGCTTCTTGCACCTGG - Intronic
998169370 5:139863627-139863649 GCCCCACTGTCTCTTGCCCCTGG + Intronic
1000368486 5:160512426-160512448 GGCCCACTTCTTCTTCCACCCGG + Intergenic
1000678951 5:164159209-164159231 GAGCCACTGCATCTGGCGTCTGG + Intergenic
1002636635 5:180612019-180612041 CACCCCCTGCTTCTTGCTCCAGG + Intronic
1004377877 6:15106407-15106429 CACTCACTGGTTCTTGCTCCTGG - Intergenic
1007937470 6:45746017-45746039 GACCCACTTCTCCCTGCACCAGG + Intergenic
1019708059 7:2505775-2505797 CACCCCCTGTTTCTTGTGCCAGG + Intergenic
1020423450 7:8036206-8036228 AACTCACTGCCTCTTGGGCCAGG - Intronic
1031782619 7:125988499-125988521 ACCCCACTGCTTCTTCCGCATGG + Intergenic
1038463913 8:27742514-27742536 GACCCAGTGATTCTTCAGCCTGG - Intronic
1043432688 8:80210235-80210257 GAGCCACTGCTCCTGGCCCCTGG - Intronic
1044711328 8:95061076-95061098 TACACACTGCTTCTTCAGCCAGG - Intronic
1049300341 8:141866431-141866453 GACCCCCTGCTTCATCCACCAGG + Intergenic
1057827672 9:98383223-98383245 GAGCCACTGCACCTTGCCCCAGG + Intronic
1059015718 9:110513492-110513514 GAGCCACAGCTTCTTGCACATGG + Intronic
1061425286 9:130494579-130494601 GACCCACTGCTTCATGCCATAGG - Intronic
1062633982 9:137480365-137480387 GACCCAGCGCTGCGTGCGCCAGG - Exonic
1186502704 X:10064824-10064846 GACCCACTGCTTTTTGGACAGGG + Intronic
1187045723 X:15646477-15646499 GGCCCAGTGCTTCTGGCGCGGGG - Intronic
1197935294 X:131734364-131734386 GACCCACGACTTCCTGTGCCAGG - Intergenic
1200150053 X:153946930-153946952 GACACCCTGCTTCTGGGGCCTGG - Intergenic