ID: 1151775804

View in Genome Browser
Species Human (GRCh38)
Location 17:76200961-76200983
Sequence CTGGGGTTGGGATGTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 350}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151775804 Original CRISPR CTGGGGTTGGGATGTGTGCC AGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900135284 1:1114602-1114624 CTGGGGGCGGGATGTGTGTCAGG + Intronic
900337296 1:2170655-2170677 CTGGGGTGAGGATGTGAGGCTGG - Intronic
900432399 1:2609114-2609136 CTGGGGTTGGGGTGTGAGTGAGG + Intronic
901018949 1:6246256-6246278 CCGGGCTTGGAATGTGGGCCAGG - Intergenic
901673031 1:10867083-10867105 CGGGGGTTGGGAGGGGTCCCGGG - Intergenic
901880156 1:12189062-12189084 AGGGAGTTGGGAAGTGTGCCAGG - Intronic
902295304 1:15463023-15463045 CTGGGGTGGGGATGTGACCTGGG + Intronic
902298150 1:15482555-15482577 CTGGGGTGGGGATGTGACCTGGG + Intronic
902884596 1:19395703-19395725 CAGGTGATGGGTTGTGTGCCTGG - Intronic
903850326 1:26301858-26301880 CTGGGGCTGGGATTTGGGGCTGG - Intronic
904032354 1:27541082-27541104 CTGGGGGTGGGGTGCGTGCTTGG + Intronic
905260707 1:36716150-36716172 CTGGGGTTGGGACTTGTGCAAGG + Intergenic
906558611 1:46736050-46736072 ATGGTTTTGGGATGTGTGTCTGG + Intergenic
906643848 1:47458644-47458666 ATGGGGTGGGGGTGTGTGGCTGG + Intergenic
906745829 1:48221533-48221555 CTGGGGATGGGGTGTGGGACAGG + Intergenic
907673922 1:56501212-56501234 TTGGGGTGGGTATGTGTGCGAGG + Intronic
908164524 1:61445299-61445321 CTGCGGTTGGGATTTGTGCAAGG - Intronic
912340577 1:108910719-108910741 CAGGGGTGGTGGTGTGTGCCTGG + Intronic
912383767 1:109261280-109261302 CTGGGGGTGGGGAGTGGGCCTGG + Intronic
915548818 1:156619811-156619833 CTGGGGTTGGGATGAGGGCTGGG - Intronic
916155197 1:161838554-161838576 CTGAGCCTGGGATGTGGGCCAGG + Intronic
916321154 1:163505595-163505617 CTGGAGTTGGGATATGGACCAGG - Intergenic
919830218 1:201535613-201535635 CTGGGGTGGGGAGGTGGGGCGGG + Intergenic
920404521 1:205699066-205699088 CTGAGGATCTGATGTGTGCCCGG + Intergenic
922218373 1:223539213-223539235 CTGCGGATGGGCTGTCTGCCTGG + Intronic
922566743 1:226606104-226606126 TTGGTGTTGGGATCTGTGCCTGG - Exonic
922978997 1:229809213-229809235 GTGGGGTTGGGATGTGGGCAGGG + Intergenic
1062840513 10:666717-666739 CTGGGGTCTGGACGTGGGCCTGG + Intronic
1062896693 10:1108783-1108805 CTGGGGCAGGGAGCTGTGCCAGG - Intronic
1065963841 10:30754945-30754967 CTGGGGGTGGGCTGTGGGGCTGG - Intergenic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1068821641 10:61383662-61383684 CAGGGGTTGGGGTGTGTGGGTGG - Intergenic
1069493845 10:68885162-68885184 CTGGGGATGGGCTGTGTAGCAGG - Exonic
1069684430 10:70308603-70308625 CCGGGGTTGGGGGGTGTGGCAGG + Intronic
1069887736 10:71634522-71634544 CTGGGGCTGGGAGGCTTGCCTGG + Intronic
1070324052 10:75376235-75376257 CTGGGCTTGTAATCTGTGCCTGG + Intergenic
1070543483 10:77434438-77434460 CTGGCCTTGAGATGTGTGTCGGG - Intronic
1074851292 10:117441579-117441601 CATGGGTTTGGATGTGTGACAGG + Intergenic
1075600085 10:123761345-123761367 CTGAGCTTGGGATGGATGCCTGG + Intronic
1075825983 10:125357342-125357364 CTGTGGGTGGGCTGTGAGCCAGG - Intergenic
1075861421 10:125679891-125679913 CTGGGGTTGGGGAGTGCGACAGG - Intronic
1080636111 11:34125021-34125043 ATTGGGTTGGGAAGTGAGCCAGG + Intronic
1081810291 11:45910531-45910553 CTGGGCTTGGGTTGGGTGACTGG - Intronic
1083877968 11:65534600-65534622 CTGGGCTAGGGGTATGTGCCTGG + Intronic
1083886032 11:65573959-65573981 CTGGGATTGGGATGAGTGCCTGG + Exonic
1084116375 11:67045123-67045145 ACGGGGTTGGGGTGGGTGCCAGG + Intronic
1084346010 11:68549400-68549422 GTGAGGTAGGGAGGTGTGCCAGG + Intronic
1084956183 11:72692857-72692879 GTGGGGTTGGGGTGTGTGTATGG + Intronic
1085417488 11:76329054-76329076 CTGGGCTTGGGACGCCTGCCTGG - Intergenic
1085733413 11:79018472-79018494 GTGGGGTAGGGATGTGTGTGGGG - Intronic
1086741670 11:90377178-90377200 CTAGGGTGGGTGTGTGTGCCCGG + Intergenic
1087011632 11:93519764-93519786 CTTGGGTTGAGAAGTGTGACAGG + Intronic
1087077816 11:94141990-94142012 CTGGGGTTGGGGAATGTGTCTGG + Intronic
1089739945 11:120575567-120575589 GTGGGTTTGGGGTGTGTGCGTGG + Intronic
1089879474 11:121759707-121759729 TGGGGGTTGGGATGGGTGGCAGG - Intergenic
1090595907 11:128321219-128321241 CTGGAGTTGGGAGGTGGGCAAGG + Intergenic
1091384687 12:85605-85627 CTGGGGCTGGGCTGAGTGGCGGG + Intronic
1092088073 12:5781470-5781492 CTAGGATTGAGATGTTTGCCTGG + Intronic
1092387215 12:8044965-8044987 CTGGAGTTGGGATGGGTGCAGGG + Intronic
1094491682 12:30964596-30964618 CTGGGGTTAGGAAGTGGGCAGGG - Intronic
1096279783 12:50242814-50242836 CTGGGACTGGGATCTGGGCCTGG + Intronic
1096466371 12:51849150-51849172 CTGGGGTTGGGGTGGGGGTCGGG + Intergenic
1096542333 12:52314783-52314805 CCGGGGTGGGGTTGTGTGCGGGG - Exonic
1096545682 12:52338557-52338579 CTGGATTTGAGATGTGAGCCAGG - Intergenic
1097224564 12:57469706-57469728 CTGGGTGTGGGAGGTGTGGCTGG + Intronic
1098195094 12:67991361-67991383 GTGGGGTTGAGAGGTGTGGCTGG + Intergenic
1101727600 12:107401093-107401115 CTGGGGTTTGGTTCTGAGCCTGG + Intronic
1102539967 12:113611383-113611405 CTAGTGTTGGGATGGGTGGCTGG - Intergenic
1102548197 12:113671684-113671706 CTGCTGGTGGGATTTGTGCCTGG - Intergenic
1102864268 12:116361571-116361593 CTGGGGGTGGGAGGTGGGACAGG - Intergenic
1107507464 13:41048774-41048796 TTGGGGTTGCGGTGTGTGACAGG - Intronic
1107921231 13:45210317-45210339 CTGCAGTGTGGATGTGTGCCTGG - Intronic
1113564714 13:111313017-111313039 CTGGGTTTGGAATGTGTGAGGGG - Intergenic
1114075811 14:19160579-19160601 CTGGGGTCTGGATGTCAGCCTGG + Intergenic
1114086352 14:19238993-19239015 CTGGGGTCTGGATGTCAGCCTGG - Intergenic
1114617973 14:24078262-24078284 CTGGGGTTGGGAGGTGAGGGAGG - Intergenic
1118000561 14:61519139-61519161 CGGGTGTGGTGATGTGTGCCTGG + Intronic
1119667639 14:76496647-76496669 CTGGAGGAGGGATGGGTGCCAGG + Intronic
1120750693 14:88195209-88195231 GTGGGGTTGGGATGTGTCTCAGG - Intronic
1121369488 14:93344022-93344044 CTGGGGTGGGGGTGGGTGGCAGG + Intronic
1122372564 14:101236764-101236786 GTGGGCCTGGCATGTGTGCCAGG - Intergenic
1122788219 14:104173634-104173656 CTGGGGTGGGGATGTGGAGCAGG + Intronic
1122810288 14:104284351-104284373 CTGGGGTGGCGGTGTGGGCCGGG + Intergenic
1123000731 14:105292836-105292858 CTGGGGAAGGGGTGTGGGCCTGG - Intronic
1123000740 14:105292855-105292877 CTGGGGAGGGGATGTGGGCCTGG - Intronic
1202897895 14_GL000194v1_random:20612-20634 CTGGGGTCTGGATGTCAGCCTGG - Intergenic
1202897976 14_GL000194v1_random:21031-21053 CTGGGGCTGGGACATTTGCCTGG - Intergenic
1123938934 15:25207412-25207434 CTGTGTTTGGGAGGTGTGCAGGG + Intergenic
1123939342 15:25209276-25209298 CTGAGTTTGGGAGGTGTGCAGGG + Intergenic
1124568630 15:30839110-30839132 CTGGGGTTGTGATGTGATTCTGG + Intergenic
1127315946 15:57793746-57793768 CTGGGGTTAGCAAGTCTGCCTGG + Intergenic
1127900824 15:63339621-63339643 CTGGCGTGGGGCTGTGAGCCAGG + Intronic
1128684506 15:69673819-69673841 ATGGGGTTGGGGTGTGTGGGAGG - Intergenic
1130170809 15:81511304-81511326 CTGGAGTTGGGATCTTTCCCAGG - Intergenic
1130972215 15:88741975-88741997 CAGGGGCTGGGATCTGGGCCGGG - Intergenic
1131418674 15:92284465-92284487 CTGGGGATGGGATGGAGGCCGGG + Intergenic
1132553451 16:562857-562879 CAGGGGTGGGGATGTGTGTAGGG + Intronic
1132695723 16:1200949-1200971 CGGGGGTGGGGAGGTGTGGCTGG + Intronic
1132828503 16:1916616-1916638 CTGGGGGTGGGATCTGAGCTGGG - Intronic
1133142625 16:3758928-3758950 CTAGGGTTGGCATGAGGGCCTGG + Exonic
1133456012 16:5943123-5943145 CTGTGTTAGGGATGTGTGTCTGG - Intergenic
1133611286 16:7435767-7435789 CTGTGGCTGTGATGTTTGCCTGG - Intronic
1133922477 16:10165961-10165983 CTGGTGTTAGGGTGTGTGCATGG - Intronic
1134196673 16:12164191-12164213 CTGGGGTAGGGATGAGTGTGGGG + Intronic
1134592204 16:15463726-15463748 CTGGGGTGGGGATGGGGGTCAGG - Intronic
1134690180 16:16186052-16186074 CTGGGGCTGGGATTTGGACCTGG + Intronic
1136458669 16:30396494-30396516 TTGAGGAAGGGATGTGTGCCTGG + Intronic
1136653783 16:31696500-31696522 CTGGGCTAGGGATGTCTGCTGGG + Intergenic
1136989296 16:35142357-35142379 CTGGGCTTGGGCTGGGTGCAGGG + Intergenic
1137496161 16:48970986-48971008 CTGGGGATGGGATGTGGTTCAGG + Intergenic
1137726023 16:50657343-50657365 TTGGGGTAGGGCTGTGAGCCTGG - Intergenic
1137769672 16:51005912-51005934 CTGGGCTTGTGCTCTGTGCCTGG + Intergenic
1138281048 16:55772532-55772554 CTGGGGTTGGGCCCGGTGCCAGG - Intergenic
1141155020 16:81591397-81591419 CTGGGGTTGAGGCGTGTCCCGGG + Intronic
1141642074 16:85347213-85347235 CTGGGGCTGGGAGGGGTCCCTGG + Intergenic
1141649406 16:85385149-85385171 TGGGGCTTGGGATGGGTGCCTGG + Intergenic
1141672214 16:85498048-85498070 GTGGGGGTGGGGTGGGTGCCTGG + Intergenic
1142096106 16:88240823-88240845 CTGGGGAGGGGAAGTGGGCCGGG - Intergenic
1142157943 16:88541145-88541167 CTGGAGTTAGGGTGTGTGCCAGG - Intergenic
1142175276 16:88642386-88642408 CTGGGGTCTGGATTTGGGCCAGG + Intergenic
1142363751 16:89639190-89639212 CAGGGGTGGGGGTGTGTGCAGGG - Intergenic
1142363805 16:89639378-89639400 CAGGGGTGGGGGTGTGTGCAGGG - Intergenic
1143015583 17:3889704-3889726 CTGGGTGGGGGATATGTGCCAGG - Intronic
1143272580 17:5686748-5686770 CTGGGGCTGGGCTGGGTGACGGG + Intergenic
1143283708 17:5773530-5773552 CTTGGGGTGGGGTGTGTGCGTGG + Intronic
1143338240 17:6189610-6189632 CTGGGCTTGGGGCGTGTGCAGGG - Intergenic
1143375235 17:6463357-6463379 CTGTGGCTGGGCTGTGTGCTGGG - Intronic
1144068026 17:11641704-11641726 ATGGGGTGGGGAGGGGTGCCAGG + Intronic
1144831239 17:18132377-18132399 CTTGGGCTTGTATGTGTGCCTGG + Intronic
1146501205 17:33366011-33366033 CTGGGGTCAGGATCAGTGCCTGG + Intronic
1147038405 17:37699034-37699056 CGGGGGTTGGGGTGTGGGCAGGG - Intronic
1147386244 17:40084020-40084042 CTGGGGTGGGGATGAGTTCTGGG + Intronic
1147691167 17:42315663-42315685 CTGGGGTTTGGCTGTGTGAGGGG + Exonic
1147743836 17:42683299-42683321 CTGGGGCTGGGTTTTGTGGCAGG + Intronic
1148196516 17:45717145-45717167 GTGGGGTGGGGCTGTGTGTCTGG - Intergenic
1148786536 17:50148772-50148794 CTGGGGTTGGGTAGTGTGAAGGG - Intronic
1148943598 17:51238078-51238100 CTGGGGATGGGGTGGGGGCCAGG + Intronic
1149466512 17:56884295-56884317 CTGGGATTGGGATGAGTGTCTGG - Intergenic
1150281060 17:63929898-63929920 CAGGGGTGGGGTTGTGAGCCTGG + Intronic
1151223568 17:72631867-72631889 CAGGGGTGGGGATCCGTGCCAGG + Intergenic
1151548997 17:74810628-74810650 GAGGGGATGGGATTTGTGCCAGG - Intronic
1151696985 17:75722701-75722723 CAGGGGTTGGGATGGGGGCCAGG + Intronic
1151775804 17:76200961-76200983 CTGGGGTTGGGATGTGTGCCAGG - Intronic
1151820884 17:76496196-76496218 CTGGGCGTTGGGTGTGTGCCAGG - Intronic
1151972787 17:77467438-77467460 CTGGGGTTGGGGAGTGGGCGGGG + Intronic
1152077611 17:78168919-78168941 CTGGGGGTGGGGTGGGTGGCGGG - Intronic
1152232299 17:79120070-79120092 CTGGGGTTGGGTGGTGTGAGCGG + Intronic
1152253102 17:79221868-79221890 CTGGGGCTGGCATGGATGCCTGG + Intronic
1152391438 17:80006148-80006170 CTGGGGTGGGGAGGGGTGTCAGG - Intronic
1152660916 17:81541504-81541526 CTGGGGTGGGGAGGGGTGCCAGG - Intronic
1152797826 17:82316626-82316648 CTGGGGTTGGGAGGGGGGTCTGG + Intronic
1152887567 17:82861234-82861256 TTGGGCTTGGGATGTGCGGCCGG + Intronic
1153625712 18:7020652-7020674 CTGGGGTTTGGGTCTGGGCCTGG - Intronic
1154928687 18:20968495-20968517 CTGGGGTTTCGATGTCAGCCAGG + Intronic
1157333765 18:46722274-46722296 CTGGGCTTGGGAAGAGGGCCTGG - Intronic
1158265341 18:55655185-55655207 CTGGGGTTGGGAATTGAGACTGG + Intronic
1158892822 18:61889037-61889059 CTGGGGTTGGGCTGAGGGCCAGG - Intronic
1160069704 18:75616041-75616063 CTGGGGTTGGAATGGGGACCAGG + Intergenic
1161310542 19:3591646-3591668 CTGGGGTTGGGATCTGGACTGGG - Exonic
1161365420 19:3876480-3876502 CTGGGTGTGGTATGTTTGCCTGG + Intergenic
1161592829 19:5136524-5136546 CTGGGTTTGAGATGTGCCCCCGG + Intronic
1161870275 19:6864500-6864522 ATGGGGTTTGGCTGTTTGCCAGG + Intergenic
1162032435 19:7923305-7923327 CAGGGCTGGGGGTGTGTGCCAGG + Intergenic
1163122381 19:15225819-15225841 CTGGGGTGGGGATGGGTGGGGGG - Intergenic
1163587785 19:18173391-18173413 CTGGGGATGGGATGGAGGCCGGG - Intronic
1163601790 19:18253768-18253790 CCTGGGATGGGATGTGAGCCAGG - Intronic
1163718054 19:18883886-18883908 CTGAGGAGGGGATGTGGGCCCGG - Intronic
1165490613 19:36120976-36120998 CTGGGGTGGGAATGAGGGCCGGG + Intronic
1166183151 19:41122788-41122810 GAGGGGTGGGGATGTGAGCCAGG - Intronic
1166199285 19:41226169-41226191 CTGGGGTGGGGAGGTGCCCCCGG + Intronic
1166638362 19:44472065-44472087 CTGCAGTTGGGATGTCTACCAGG - Intergenic
1166684857 19:44790165-44790187 CTGGGGTTGGAATGTTGGCTTGG + Intronic
1167072625 19:47229766-47229788 CTGGGTTTGGCTTGTGTGTCTGG - Intronic
1168188952 19:54724564-54724586 CTGGGGTGGAGATCTGGGCCTGG + Intronic
1168188978 19:54724659-54724681 CTGGGGTGGAGATATGGGCCTGG + Intronic
1168191087 19:54739309-54739331 TTGGGGTGGGGATATGGGCCTGG + Intronic
1168193244 19:54755496-54755518 CTGGGGTGGAGATATGGGCCTGG + Intronic
1168201077 19:54816704-54816726 CTGGGGTGGAGATATGTGCCTGG + Intronic
1168201092 19:54816761-54816783 CTGGGGTGGAGATATGTGCCTGG + Intronic
1168203631 19:54834270-54834292 GTGGGGTGGAGATATGTGCCTGG + Intronic
1168203731 19:54834653-54834675 CTGGGGTGGAGATATGGGCCTGG + Intronic
1168203791 19:54834881-54834903 TTGGGGTGGGGATATGGGCCTGG + Intronic
925216040 2:2096739-2096761 CTGAGGATGGACTGTGTGCCAGG + Intronic
925730979 2:6919001-6919023 CTGGGGTTGAGAGTTGAGCCTGG + Intronic
925893036 2:8451441-8451463 CTGGTGTGGCCATGTGTGCCTGG - Intergenic
927876887 2:26663008-26663030 ATGGGGTTGGGGAGTGTGCAGGG - Intergenic
929950888 2:46408864-46408886 CCGGGGTTGGGATGGGTTCCTGG - Intergenic
930608636 2:53517692-53517714 TTGGATTTGGGGTGTGTGCCGGG - Intergenic
930869132 2:56152069-56152091 CTGGAGTAGAGAGGTGTGCCAGG + Intergenic
932620915 2:73264564-73264586 CTGGTGTGGGGATGTGTGTGGGG + Intronic
933942145 2:87253764-87253786 CTGGTGTGGGGATGGGTACCAGG + Intergenic
934926415 2:98384767-98384789 CTGGGGCTGGGGTGTGGGCAAGG + Intronic
935450115 2:103199699-103199721 CTGGGGTTGGGGGGTGGGGCAGG + Intergenic
936161437 2:110086629-110086651 GTGGGGCTGGGATGTTTGGCAGG - Intronic
936183226 2:110284725-110284747 GTGGGGCTGGGATGTTTGGCAGG + Intergenic
936338080 2:111607805-111607827 CTGGTGTGGGGATGGGTACCAGG - Intergenic
937118501 2:119426424-119426446 GTGGGGGTTCGATGTGTGCCTGG + Intergenic
937274516 2:120675343-120675365 CTGGGCTTGGGAAGTGAGTCAGG - Intergenic
937318942 2:120949177-120949199 CGGGGGCTGCTATGTGTGCCCGG - Intronic
937355586 2:121196236-121196258 CAGGGGTTGGGCTATGGGCCAGG + Intergenic
938379518 2:130828703-130828725 CGGGGGCTGGGATCTGTGCAGGG + Intergenic
938490405 2:131758097-131758119 CTGGGGTCTGGATGTCAGCCTGG + Intronic
939371516 2:141307657-141307679 CTGGGGTAGGAATGCATGCCAGG + Intronic
940992717 2:160114459-160114481 CAGGGGTGAGGATGTGGGCCTGG + Intronic
941309955 2:163914735-163914757 CTGGTGTTCGGATGTGTTCAGGG - Intergenic
941439283 2:165513381-165513403 TTTGGGTTGTGATGTGTGCCAGG + Intronic
943358204 2:186885320-186885342 CTGAGGAAGGGGTGTGTGCCTGG + Intergenic
946302504 2:218832463-218832485 CTGTGGTTGGGAGATATGCCTGG + Intergenic
946310010 2:218878113-218878135 CTGGGGCTGGGCTGAGGGCCAGG + Intergenic
946584171 2:221165461-221165483 CTGGTCTTGGGATCTGTGTCTGG + Intergenic
948802614 2:240439735-240439757 CTGGTGAGGGGCTGTGTGCCAGG - Intronic
1169201098 20:3710600-3710622 CTGGGGGTCAGATGTGTCCCTGG + Intergenic
1170547565 20:17448201-17448223 CTGGGGTTGGTATGGGTGCAGGG - Intronic
1172012591 20:31854560-31854582 CTGGGGGTGTCCTGTGTGCCAGG - Intronic
1172148976 20:32777461-32777483 CTGGGGTTCTAATGTGTGCTGGG - Intronic
1172450492 20:35019211-35019233 CTGGGTTTCTGCTGTGTGCCGGG - Intronic
1172618423 20:36305375-36305397 CTGGGTTGGGGATGTGAGCAGGG + Intergenic
1172881179 20:38200944-38200966 CTGGGGTTGGGAAGTCTGTGGGG - Intergenic
1173431803 20:42994565-42994587 TTTTGGTTGGGATGTGTGCCTGG - Intronic
1174200245 20:48802122-48802144 GTGGGGATGGGGTGTGTGCAGGG - Intronic
1174365544 20:50054239-50054261 CTGGGGTTGGTGGGTGTGGCAGG - Intergenic
1174365820 20:50055587-50055609 CTGGGGTTGGGGGGTTTGCAGGG + Intergenic
1174479239 20:50819321-50819343 CTGGGCTTGAGGTGTCTGCCTGG + Intronic
1174500771 20:50982392-50982414 CTGGGGTGGGGATGGGTGGGGGG - Intergenic
1174540130 20:51282728-51282750 ATGGGGTTGGGGTGTGTGAGGGG - Intergenic
1175387411 20:58606081-58606103 CTGGGCCTGGGATATGAGCCTGG - Intergenic
1175916587 20:62428680-62428702 CTGGGTTTGGGATGAGGGCTGGG + Intergenic
1175935423 20:62511714-62511736 GTGGGGTGGGGATCTGAGCCAGG - Intergenic
1175989175 20:62779027-62779049 CTGGGGCTGGGATGCGGGACGGG - Intergenic
1176617577 21:9036601-9036623 CTGGGGTCTGGATGTCAGCCTGG - Intergenic
1176707568 21:10127069-10127091 CTGGGGTCTGGATGTCAGCCTGG + Intergenic
1179344852 21:40546908-40546930 CTGGGGCTGGGGTGGGAGCCTGG + Intronic
1179355038 21:40651163-40651185 CTGGAGTTGGTCTGTGTGCTTGG - Intronic
1179363009 21:40730281-40730303 TTGGGGTTGGGGTGAGTGGCTGG + Intronic
1179824405 21:43956097-43956119 CTGGGGCTCTGCTGTGTGCCAGG + Intronic
1179879795 21:44288670-44288692 CCCGGGTGGGGATGTGGGCCTGG - Intronic
1180291511 22:10853743-10853765 CTGGGGTCTGGATGTCAGCCTGG + Intergenic
1180494316 22:15883165-15883187 CTGGGGTCTGGATGTCAGCCTGG + Intergenic
1180855372 22:19041759-19041781 CTGGGGTGGGGATGGGGACCAGG + Intronic
1181854944 22:25774802-25774824 CTGGGGTCTGGGTGTGTGCCTGG + Intronic
1181891413 22:26066905-26066927 CTGGGGATTTGATGTGTCCCCGG + Intergenic
1182105343 22:27685230-27685252 CTGGGGCTGGGATTTGAACCTGG - Intergenic
1182456006 22:30450943-30450965 CTGGGATTGGGATTTGGGGCAGG + Intronic
1182889628 22:33806409-33806431 CTGGGGCTGGAAAATGTGCCAGG - Intronic
1183702076 22:39456666-39456688 CTGGGCCTGTGATGTGTGCACGG - Intergenic
1185068333 22:48643018-48643040 CTGGGGTTGGGGTGAGTCCTGGG + Intronic
1185077706 22:48692073-48692095 CTGGGATGGGGCAGTGTGCCAGG + Intronic
1185167434 22:49270239-49270261 CTGGGGTTGGGAAGTGCACGGGG + Intergenic
949675335 3:6447228-6447250 CTGGAGTTGGAATATGTGTCTGG - Intergenic
950040833 3:9918122-9918144 CTGGGGTGGGCATGAGGGCCAGG + Intronic
950939619 3:16879963-16879985 CTGGGGTTGGGATTTGGGAGTGG + Intronic
950965077 3:17140304-17140326 CTGGGGTTGGGATGTGGGGCTGG + Intergenic
953735333 3:45489431-45489453 CTGGGGTGGGGGTGGGGGCCAGG - Intronic
954068944 3:48128934-48128956 CTGGGGTGGTGATGCATGCCAGG - Intergenic
954127561 3:48540449-48540471 ATGGGGTTGGGAAGGGGGCCTGG - Intronic
954684242 3:52361888-52361910 CTGGGGTTAGGGTGTGCCCCCGG - Intronic
956334377 3:68146739-68146761 CTGAGGTTGAGAGGTCTGCCAGG + Intronic
958093030 3:88902353-88902375 CGGGGGTTGGGAGGTGTGGGGGG - Intergenic
958418562 3:93906391-93906413 CTGCAGTGGGGATGTGGGCCAGG + Intronic
960732717 3:120743936-120743958 CTGGGGTAGGGAGGTGAGGCTGG + Intronic
961475016 3:127140852-127140874 GTGGGGTTGGGGTGGGTGGCAGG + Intergenic
961714013 3:128846615-128846637 TGGGGGTGGGGATGTGAGCCAGG + Intergenic
961785191 3:129343308-129343330 GTGGGGGGGGGATGTGAGCCTGG - Intergenic
961865820 3:129952902-129952924 CAGGCCTTGGGATGTGTGGCAGG + Intergenic
963903531 3:150755147-150755169 CTGGAGTTGGGATTTGGACCAGG + Intronic
965607990 3:170515605-170515627 CTGGGGTTAGGATGTGTGTTGGG + Intronic
966314098 3:178625478-178625500 CCGGGGTGGGGAGGTGGGCCAGG + Intronic
966910536 3:184557169-184557191 CTGGGGTTTGGGAATGTGCCCGG + Intronic
967069074 3:185946366-185946388 CTGGGGTGAGGATGTTTGTCGGG + Intergenic
967185696 3:186942689-186942711 CTGGGCTTTTGCTGTGTGCCTGG + Intronic
968652056 4:1764023-1764045 CAGGGGCTGGGCTGGGTGCCAGG + Intergenic
968747096 4:2365674-2365696 CTGGGCCTGGGTTCTGTGCCTGG + Intronic
968974792 4:3816424-3816446 CAGGGGCCGGGATGTGGGCCTGG + Intergenic
969721678 4:8895683-8895705 CTGGGCTTGGTAAGGGTGCCTGG - Intergenic
970264653 4:14268170-14268192 CTTGGCTTGGGATATGTGGCAGG + Intergenic
971757326 4:30720872-30720894 CTGGGTTTGGAGTGAGTGCCTGG + Exonic
972336895 4:38114994-38115016 CTGGGATTGGGGTGGGTGCAGGG + Intronic
972647122 4:40979681-40979703 CTGGGGATGGAAAGTGAGCCTGG + Intronic
977292801 4:95181583-95181605 CAGGGGTGGTGCTGTGTGCCTGG + Intronic
977921051 4:102642829-102642851 CAGGGGTTGGGGTGTGTTTCTGG - Intronic
979861774 4:125702476-125702498 CTGGGGTTGTTATCTGTACCAGG + Intergenic
981502730 4:145469853-145469875 CAGGGGTTTGAATGTGTGTCAGG - Intergenic
982821350 4:159943861-159943883 CTGGGGTGGAGATATGTTCCTGG + Intergenic
984829799 4:183961887-183961909 CTGGCTTTGGCATTTGTGCCAGG - Intronic
985149872 4:186935856-186935878 CTGGGGTTTGGATGTGGATCAGG + Intergenic
985725858 5:1515474-1515496 CTGGGGGTGGGACTTGGGCCAGG - Intronic
985768802 5:1796174-1796196 CTGGGGCTGGGTTGTGCTCCGGG - Intergenic
986180771 5:5391062-5391084 CTGGGAGTCGGATGTTTGCCTGG + Intergenic
986764801 5:10915688-10915710 ATGGGGCTGGGATTTGAGCCTGG + Intergenic
987707361 5:21473476-21473498 CTGGGAGTCGGATGTTTGCCTGG - Intergenic
988735605 5:34017570-34017592 CAGGGGATGGGATGGGTGACAGG - Intronic
992713604 5:79486643-79486665 CTGGGGTTGGGGTGTGATCTTGG - Intronic
992967682 5:82019973-82019995 CTGGATTAGGGAAGTGTGCCAGG + Intronic
995862879 5:116660734-116660756 CTGCAGTGGGGAGGTGTGCCTGG + Intergenic
995870606 5:116739908-116739930 GTGGGGCTGGTGTGTGTGCCAGG + Intergenic
996747500 5:126857883-126857905 CTGGGGAAGGGATGAGAGCCAGG + Intergenic
997958287 5:138297819-138297841 CAGGGGTTGGGAAGTCTGTCAGG + Intronic
1000045137 5:157516192-157516214 CTGGGGTGGGGGTGTGTAACAGG - Intronic
1000337683 5:160253715-160253737 GTGGGGGTGGGGGGTGTGCCGGG + Exonic
1001953700 5:175833696-175833718 CTGGGGTGGGGATGGGAGGCTGG + Intronic
1002328112 5:178423106-178423128 CAGGCGTGGTGATGTGTGCCTGG - Intronic
1002369700 5:178741930-178741952 CTAGTGTTGGGAGGTGGGCCTGG - Intergenic
1003018730 6:2491237-2491259 CTGGGGTTGGGGGGCGTGCAGGG - Intergenic
1004426595 6:15511077-15511099 CTGTGGTTTGGCTGTGTGCTAGG + Intronic
1005652225 6:27894887-27894909 CTTGGGGAGGGAGGTGTGCCAGG + Intergenic
1005813342 6:29532168-29532190 CTGGAGCTGGGCTGTGGGCCAGG - Intergenic
1005911213 6:30311282-30311304 GTGGGGTGGGGGTGTGTGCGGGG - Intergenic
1006386410 6:33733495-33733517 CTGGGGCTGAGATGGATGCCGGG - Intronic
1007093146 6:39196845-39196867 CTGGGGATGGGATGTCCCCCTGG + Intronic
1007600614 6:43078491-43078513 CTGGGGGTGGGTTGAGTCCCAGG - Intronic
1007719988 6:43879199-43879221 CTGGGGCTGGGGTGTGTGTAGGG - Intergenic
1007737737 6:43992241-43992263 GTGGAGATGGGATGTGTGGCAGG + Intergenic
1007988774 6:46233543-46233565 CTGGGGTTGAGATGAGGGCAAGG + Intronic
1008435164 6:51467424-51467446 CTGTGGTTCGGATGTTTGCTAGG + Intergenic
1011952682 6:92986343-92986365 CTGGGCCTGAGATGTGTGGCTGG + Intergenic
1014191496 6:118501351-118501373 AGGGGGTTAGCATGTGTGCCAGG + Intronic
1015209950 6:130685689-130685711 CTGGGGTAGGAATGTGTCCAAGG + Intergenic
1015871724 6:137782227-137782249 CTGGCGTGGTGGTGTGTGCCTGG - Intergenic
1015942089 6:138462818-138462840 CTGGAGTTGGGTTCTTTGCCAGG + Intronic
1016120567 6:140337717-140337739 CTGGGGTTGGTAAGCCTGCCAGG + Intergenic
1017684054 6:156894267-156894289 CGGGGGTTGGGATGGGGGCCGGG + Intronic
1017684066 6:156894287-156894309 GGGGGGTTGGGATGGGGGCCGGG + Intronic
1018173658 6:161161407-161161429 CTGGGTTTGGCAAGTGTGCTGGG - Intronic
1018454714 6:163941538-163941560 CTGGGGTTGGGGTGTGGGGATGG + Intergenic
1019267597 7:127125-127147 GTGGAGTTGGGATGTGTCCCTGG - Intergenic
1019700986 7:2475015-2475037 CTGGGGAGGGGTTGTCTGCCTGG - Intronic
1022503301 7:30895858-30895880 CTGGGGCTGGGACGTTTCCCTGG + Intergenic
1022505386 7:30906207-30906229 CTGGGGGTGGCATCTGTGCCAGG - Intergenic
1022668003 7:32429104-32429126 CTGAGGTTGGAATGTGTGAGGGG + Intergenic
1024971785 7:55078243-55078265 CGGGGCTTGGGGTGTGTGCGGGG - Intronic
1027221678 7:76218122-76218144 CGGGGGTTGGGATCTGATCCTGG + Intronic
1027231477 7:76275202-76275224 GTGGGGTAGGGATGAGTGGCTGG - Intronic
1029419763 7:100466645-100466667 ATGGGGGTGGGGTGTCTGCCGGG + Exonic
1029457754 7:100679638-100679660 CTGGGGTTGGGGTGGGTGCAGGG - Exonic
1034276806 7:149827432-149827454 CTGGGGGTGGGTGGTCTGCCCGG - Intergenic
1034898985 7:154895941-154895963 CAGGAGTTGGGCTGTGGGCCTGG - Intergenic
1036923488 8:12880959-12880981 CTGAGGATGTCATGTGTGCCAGG + Intergenic
1037748523 8:21664858-21664880 CTGGGGGTGGGGTGAGTCCCTGG + Intergenic
1037787964 8:21913499-21913521 CTGGGGTTGGGCAGGGGGCCTGG - Intronic
1037799359 8:22024170-22024192 GTGGGGTGGGGAGGTGAGCCGGG - Exonic
1037802632 8:22043767-22043789 TTGGGGGTGGGAGGTGTGCATGG - Intronic
1037934765 8:22908119-22908141 CTGGGGTTGGGAGTGGTGACTGG + Intronic
1038054168 8:23842668-23842690 CTGGGGGTGGGAAGTGTGGGAGG + Exonic
1038390747 8:27198479-27198501 CCGGCGTGGTGATGTGTGCCTGG - Intergenic
1038642661 8:29340166-29340188 CCGGGGGTGGGATGGCTGCCAGG + Exonic
1039476291 8:37841021-37841043 CTGGGGTGGGGCTGGGGGCCGGG - Intronic
1041261602 8:56025334-56025356 GTTGGTTTGGGATGTGTGCCTGG - Intergenic
1041401996 8:57456073-57456095 CTTGGGTTGGGAGATGTGCATGG + Intergenic
1043139932 8:76575472-76575494 CTAGGGTTGAGTTGTGTGCCTGG - Intergenic
1043916318 8:85926715-85926737 TTGGGGTGAGGATGTGTGACTGG - Intergenic
1044985564 8:97753646-97753668 CTGGGGATGGAAAGTGTGCAAGG + Intergenic
1045423452 8:102039844-102039866 TTGGGGGTGGGTAGTGTGCCAGG - Intronic
1046503227 8:115105655-115105677 CTGGGGTTGGGTTGGGTCCTAGG + Intergenic
1046620636 8:116525982-116526004 CTGGGGTTGGCACCTCTGCCTGG - Intergenic
1047485644 8:125328450-125328472 CCTGGATTGGGTTGTGTGCCAGG + Intronic
1048301208 8:133252675-133252697 CTGGAGTTGGCAAGTGTACCAGG - Intronic
1049404326 8:142444953-142444975 CTGGGGGTGGGAGGGGGGCCAGG + Intergenic
1049640244 8:143712015-143712037 CGGGGGTGGGGCTGTGTGCCTGG + Intronic
1050179359 9:2903641-2903663 ATGGGGTTGGGATGTTGCCCAGG + Intergenic
1051079488 9:13278950-13278972 CTGGGGGTGGGGTGTTAGCCTGG - Intronic
1051268369 9:15330691-15330713 TTGGAGTTGGCATATGTGCCTGG - Intergenic
1052857308 9:33415352-33415374 CTGGGGTGGGGCAGTGAGCCGGG + Intergenic
1053644764 9:40113806-40113828 CTGGGGTCTGGATGTCAGCCTGG + Intergenic
1053761221 9:41351045-41351067 CTGGGGTCTGGATGTCAGCCTGG - Intergenic
1054325783 9:63711686-63711708 CTGGGGTCTGGATGTCAGCCTGG + Intergenic
1054349995 9:64012590-64012612 CTGGGGTCTGGATGTCAGCCTGG - Intergenic
1054900882 9:70368449-70368471 CTGGGATTGGGATTTGTTGCTGG + Intergenic
1056042385 9:82681787-82681809 CAGGGTTTGGGATTTTTGCCGGG + Intergenic
1057588485 9:96350310-96350332 CTGGCGTCGTGGTGTGTGCCTGG - Intronic
1059327166 9:113511118-113511140 CTGTGGTTGGCATGTTTCCCAGG + Intronic
1061798531 9:133102174-133102196 GTGGGGTTGGGATGTGTCCTTGG - Intronic
1062100279 9:134724399-134724421 CTGGAGCTGGCATGTGGGCCGGG + Intronic
1062210488 9:135360991-135361013 CTGGGGGTGGGAAGAGTGCCTGG - Intergenic
1062478224 9:136740109-136740131 CTGGGGTAGGGATGGGGGTCAGG - Intronic
1202792314 9_KI270719v1_random:95949-95971 CTGGGGTCTGGATGTCAGCCTGG + Intergenic
1187293387 X:17976505-17976527 CTGGAGATGGGAGGGGTGCCAGG - Intergenic
1188172164 X:26941007-26941029 CTGGGGTCTGCCTGTGTGCCAGG + Intergenic
1189317931 X:40068998-40069020 CTGGGGTGGGGATTTGGGGCAGG - Intronic
1192180766 X:68914368-68914390 TTGGGGTTGGAATGTGTGTGGGG - Intergenic
1193020662 X:76789100-76789122 CTGAGGATGAGCTGTGTGCCAGG - Intergenic
1195095126 X:101494129-101494151 CTGGGGCTGGGATTTGGTCCTGG + Exonic
1195162278 X:102182381-102182403 CTGAGGTAGGGATGTGTGCTGGG + Intergenic
1198079375 X:133224706-133224728 CTGGAGTTGGGTTGTGGGTCAGG - Intergenic
1200090764 X:153634926-153634948 TTGGGGCTGGAATGTGGGCCTGG + Intergenic