ID: 1151777306

View in Genome Browser
Species Human (GRCh38)
Location 17:76214162-76214184
Sequence TGCACCCTCAACCTGTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151777298_1151777306 25 Left 1151777298 17:76214114-76214136 CCTGGGGCTTGCGATGGGCATCA 0: 1
1: 2
2: 18
3: 48
4: 220
Right 1151777306 17:76214162-76214184 TGCACCCTCAACCTGTGGGATGG 0: 1
1: 0
2: 0
3: 18
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151777306 Original CRISPR TGCACCCTCAACCTGTGGGA TGG Intronic
900571034 1:3358336-3358358 AGCACCCTCAGCCAGGGGGAAGG - Intronic
903266516 1:22161165-22161187 TGGCCCCTTACCCTGTGGGACGG - Intergenic
903665282 1:25003343-25003365 TCCACTCTCACCCTGTGGGTCGG - Intergenic
904499048 1:30903593-30903615 TGCTGTCTCACCCTGTGGGAGGG - Intronic
905104908 1:35558450-35558472 TGCAGCCTCTACCCGAGGGAGGG + Intronic
906148595 1:43574795-43574817 GGCAGCCTCATCCTGTGGGCAGG + Intronic
906519389 1:46458311-46458333 TGCAGCCTGAGCCTGGGGGATGG - Intergenic
914858550 1:151369308-151369330 TGCACGCTCAACCTGGGACAAGG - Intronic
915067611 1:153239512-153239534 TGCAGTCTCACCCTGGGGGAAGG + Intergenic
915593124 1:156881746-156881768 TTCACCCTCAGCATGTGGGAAGG + Intronic
916166337 1:161970047-161970069 TCCACCCTCAACCTCTAGGATGG - Intergenic
916302147 1:163287509-163287531 TCCACTCTCAGCCTGTGGAATGG + Intronic
916468546 1:165097320-165097342 TGCATCCTCCAGCTGTTGGATGG - Intergenic
916816713 1:168361180-168361202 TCCATTCTCAGCCTGTGGGATGG + Intergenic
917458984 1:175211601-175211623 TAGAGCATCAACCTGTGGGATGG - Intergenic
922052189 1:222002943-222002965 TGCAGCCTCAAACTCTGGGTTGG - Intergenic
922699031 1:227747430-227747452 TGAACCCTCTGCCTGGGGGATGG + Intronic
923400993 1:233614981-233615003 TGCAGCCTCGGCCTCTGGGATGG - Intronic
923561823 1:235047462-235047484 TGCCCCCGCAAGCTCTGGGAGGG - Intergenic
924288505 1:242512733-242512755 TGAAATCTCAACCTGTGGGATGG + Intronic
924408965 1:243783248-243783270 CTCACCCTCAACCTCTGGGAAGG + Intronic
1062795576 10:342482-342504 TGCCTCCCCTACCTGTGGGACGG - Intronic
1064442104 10:15363469-15363491 TGCTACCTTAACCTGTGGCAAGG + Intronic
1067056982 10:43058169-43058191 TGCACCCTCCACCTCAAGGATGG + Intergenic
1068792241 10:61040641-61040663 GGCTCCCTCAGCCTGTGGGGAGG + Intergenic
1069721690 10:70553889-70553911 TGCACCCACAACCTGTGTCTGGG - Intronic
1069855150 10:71436100-71436122 TGCCACCTCACCCTGTGGGGAGG + Intronic
1070622822 10:78026965-78026987 TGTATCCTCAGCCTGTAGGATGG - Intronic
1071153402 10:82662683-82662705 GGCCCCCTCCACCTCTGGGAGGG + Intronic
1071438195 10:85666441-85666463 TGCACCCTCTGCCAGTGGGAGGG - Intronic
1071963824 10:90832566-90832588 AGCTCCCTCAGCTTGTGGGAAGG - Intronic
1075651860 10:124132550-124132572 AGCACCCTGATGCTGTGGGATGG + Intergenic
1076700427 10:132270058-132270080 CGTCCCCTCAACCTGTGGCAGGG + Intronic
1076788491 10:132764017-132764039 AGCACCCACAGCCTCTGGGAAGG - Intronic
1077003016 11:334429-334451 CCCACCCTCAGCCTGTGGGGAGG - Intergenic
1077227045 11:1443034-1443056 TGCACCATCACCCTGGGGGGAGG + Intronic
1078490249 11:11761719-11761741 CGAGCCCTTAACCTGTGGGATGG - Intergenic
1078643184 11:13114804-13114826 TGCACCCTGACCCTCTGGCAAGG - Intergenic
1081776839 11:45681520-45681542 TGCACCCTCCACCTGGGGTGGGG - Intergenic
1083875146 11:65519155-65519177 TGCAACCTCAACCTCTTGGGTGG + Intergenic
1085280729 11:75328713-75328735 TGCAGTCTCACCCTCTGGGATGG + Intronic
1087638243 11:100727523-100727545 TCCACCCCCACCCTCTGGGAAGG + Intronic
1090566070 11:127993464-127993486 TGCACACTCAAATTGTGGGTTGG - Intergenic
1091998137 12:5011222-5011244 TGCAGCATCAACTGGTGGGAAGG - Intergenic
1095521944 12:43076886-43076908 TGCATCCTCAAGTTTTGGGAGGG - Intergenic
1100022921 12:90091423-90091445 TGCACCCACACCCAGTGGGTGGG + Intergenic
1101650452 12:106672790-106672812 TGCAACAAAAACCTGTGGGAAGG - Intronic
1102075414 12:110056136-110056158 TGCACACTTTACCTGTAGGAGGG + Intronic
1106143083 13:27027288-27027310 TGCACCCCAAATGTGTGGGACGG + Intergenic
1108557799 13:51612810-51612832 TGCACCCTCTACCTGTAAGGGGG - Intronic
1110187265 13:72690064-72690086 AGCACTTTCAACCTCTGGGAAGG - Intergenic
1113163539 13:107411266-107411288 TTCACCTTCAGCCTGTGGGCAGG - Intronic
1113782220 13:112983189-112983211 TGCAACCTAGACCTGTGTGAGGG - Intronic
1113881879 13:113631566-113631588 GGCACCCTCGCCGTGTGGGAGGG + Intronic
1118576944 14:67251869-67251891 CCCACCTTCAACCTCTGGGAAGG + Intronic
1121097518 14:91228130-91228152 GGCAGCCTCACCCTGTGGGTGGG + Intergenic
1121164164 14:91775828-91775850 AGCCCCCTCAACCTCTGGGGAGG + Intronic
1123545176 15:21332392-21332414 TGCACCCCCTCCCCGTGGGAAGG - Intergenic
1124995921 15:34722666-34722688 TGCACCCTCTAGCTGTGCCAGGG + Intergenic
1125599550 15:40907698-40907720 TTCACCCTCAACCTGCTGCAGGG - Intergenic
1126356547 15:47802133-47802155 AGCACCTTCCACCTGAGGGAAGG - Intergenic
1126719963 15:51567996-51568018 TGCAGCCTCAACCTGTCAAATGG - Intronic
1129235544 15:74221797-74221819 AGCACCCTGAGCCTCTGGGAAGG - Intergenic
1129696997 15:77746497-77746519 AGCACCCTGAACCTGTGGTCTGG + Intronic
1130035619 15:80358226-80358248 TGAACCCTTAACCTGTGGCGGGG + Intronic
1130157442 15:81363853-81363875 TGCACCATCATCCTTTGGCAAGG + Intronic
1131056520 15:89378363-89378385 CTCACCCTCAACCTGTGAAATGG + Intergenic
1202953522 15_KI270727v1_random:59663-59685 TGCACCCCCTCCCCGTGGGAAGG - Intergenic
1132953673 16:2579268-2579290 CCCACCCCCCACCTGTGGGAGGG - Intronic
1132960678 16:2620899-2620921 CCCACCCCCCACCTGTGGGAGGG + Intergenic
1133340040 16:5030222-5030244 AGAACCCTCATCCTGTGGGAAGG + Intronic
1136466899 16:30450633-30450655 TGCAGGCTCAGACTGTGGGAAGG - Intergenic
1138809225 16:60129290-60129312 TGCACCCTCACACTGGGGAAGGG + Intergenic
1140218752 16:73028502-73028524 TGCATCCTTAGCCTGTGGGTTGG - Intronic
1141347648 16:83261990-83262012 TTCAACCGTAACCTGTGGGAAGG + Intronic
1141856168 16:86682817-86682839 TGCAGCCTCTCCCTTTGGGAAGG - Intergenic
1150681810 17:67290714-67290736 TGGCCCCTCAGCCTGGGGGAAGG + Intergenic
1151777306 17:76214162-76214184 TGCACCCTCAACCTGTGGGATGG + Intronic
1160009357 18:75092535-75092557 TACAACCTCAACCTGTAGAAGGG - Intergenic
1161416603 19:4150567-4150589 TGCAGCCTCAACCTTCCGGACGG - Intergenic
1163719980 19:18894319-18894341 GGCCCCCTCAGCCTCTGGGAAGG - Intronic
1165768502 19:38365050-38365072 TGAACCCACCACCTGTGGGTAGG - Exonic
1165879069 19:39030211-39030233 TGAACCTTGATCCTGTGGGAAGG - Intronic
925802777 2:7617953-7617975 TGAACCCTCAGCCTATGTGAGGG - Intergenic
926097442 2:10091372-10091394 TGCTCCCTCAGCCTGTGGGGAGG + Intergenic
929580746 2:43080519-43080541 TGCATCCTGGATCTGTGGGAAGG + Intergenic
929794387 2:45047819-45047841 TAAACCCTCATCCTGTGGGCTGG + Intergenic
931570034 2:63658691-63658713 TGCACCCCCAACCTGTGTAATGG + Intronic
932795532 2:74692173-74692195 TGCACCCTGAAGTTGTGAGAAGG - Intergenic
933415219 2:81978695-81978717 TGCAGTCTCACCCTGTGGCATGG - Intergenic
933660719 2:84925418-84925440 GGCTCCCTAAACCTGTGGGCAGG - Intergenic
938732822 2:134159747-134159769 TGCAACCTCCACCTCTGGGGCGG - Intronic
940288232 2:152053227-152053249 CTCACCCTCAACCTCTGGGAAGG + Intronic
943660218 2:190552091-190552113 TGCACTCACAACTTGTGGGTTGG + Intergenic
947034895 2:225841254-225841276 TGCACACTCAACCACTGGGTGGG - Intergenic
947772235 2:232679681-232679703 TTCAACCTCAACCTGGGGGATGG + Intronic
948152881 2:235758406-235758428 TGCACCATGTACCTCTGGGAAGG - Intronic
948268608 2:236656902-236656924 GACACCCTGATCCTGTGGGAGGG + Intergenic
948313701 2:237010499-237010521 TGAACCCTCAACCCATTGGATGG + Intergenic
1173252589 20:41372405-41372427 TGCCCCCTCAGGCTGTGGGCAGG + Intergenic
1173440930 20:43075487-43075509 TGCAACAACAACCTGTGGGATGG - Intronic
1173891347 20:46513451-46513473 TGCACCCACAACCTATAGGAAGG - Exonic
1176449656 21:6851256-6851278 TGCACCCCCTCCCCGTGGGAAGG + Intergenic
1176827828 21:13716280-13716302 TGCACCCCCTCCCCGTGGGAAGG + Intergenic
1177323051 21:19546614-19546636 TGAGCCCTTAACCTGTGGGATGG + Intergenic
1178389115 21:32184245-32184267 TGCAGCCTCACCCTGTGAGTAGG - Intergenic
1179982966 21:44905978-44906000 TGCACCCTCTCCCTGGGAGATGG + Intronic
1181625429 22:24119483-24119505 TCCACACCCACCCTGTGGGATGG + Exonic
1182292408 22:29291151-29291173 TGCACCCTCAACCTCTCCCAAGG - Intronic
1182847811 22:33446047-33446069 TTCACCCTCAACCTGCAGGGAGG + Intronic
1184962791 22:47943822-47943844 AGCACCCTCCACCTGAGGGCAGG + Intergenic
953930806 3:47004855-47004877 TGCTCCCCCAACCTGTGGGCAGG + Intronic
955957437 3:64304973-64304995 TGCAACCACACCCTGTAGGAAGG - Intronic
958830079 3:99076377-99076399 TGCACCCTGAAATTGTTGGAAGG - Intergenic
959169872 3:102831207-102831229 TGCACACTCTTGCTGTGGGAAGG - Intergenic
961230807 3:125306609-125306631 TCCCACCTCAGCCTGTGGGAAGG - Intronic
962087485 3:132207284-132207306 TTCACTTTCAACCTGAGGGATGG + Intronic
967945313 3:194799357-194799379 TGGACGCTGAACCTGTGGGAAGG + Intergenic
969119373 4:4896586-4896608 TGTACACTCAGCCAGTGGGAAGG - Intergenic
969617519 4:8262288-8262310 TGCTCCCTCCAGCTGTGGCAAGG - Intergenic
969629914 4:8330065-8330087 GGGACCCTCAACCTGTGCAATGG + Intergenic
969869471 4:10095742-10095764 TGCACCCTCAGCCACAGGGAGGG - Intronic
973146265 4:46831011-46831033 GGCTCCCTCAGCCTGTGGGGAGG + Intronic
977940684 4:102855195-102855217 TGCTCCTTAAACTTGTGGGAAGG + Intronic
977942100 4:102869598-102869620 TGTACCCTCAGCATGTGGGTGGG + Intronic
979047270 4:115884019-115884041 TCCACCTTCAAACTGTGAGAAGG + Intergenic
980698705 4:136395318-136395340 GGCTCCCTCAGCCTGTGGGGAGG + Intergenic
982271848 4:153598414-153598436 TGCACCCTTATTCTGTGAGATGG + Intronic
986512755 5:8525503-8525525 TGAACCTTCAACTTGCGGGATGG + Intergenic
994895836 5:105701333-105701355 TACACCATCAACTTGGGGGAAGG + Intergenic
995086512 5:108117248-108117270 AGCACTCTCAATCTCTGGGAAGG - Intronic
999232510 5:150069977-150069999 TGCACCGTCACCTTGTGGAAGGG + Exonic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1001843519 5:174901492-174901514 AGCTCCCTCAGCCTGTGGGGAGG + Intergenic
1004499721 6:16198479-16198501 GGCTCCCTCAGCCTGTGGGGAGG - Intergenic
1005773091 6:29097327-29097349 TGCATGCTCAACCAGTGGGTGGG + Intergenic
1006152354 6:31996280-31996302 TGCACCCTCATCCTGGAAGACGG - Exonic
1006158655 6:32029018-32029040 TGCACCCTCATCCTGGAAGACGG - Exonic
1007066223 6:38992673-38992695 TGCACCATCACCCTGGGTGAGGG - Intronic
1009862623 6:69354222-69354244 TGCATCCTGAACCTGTGGGGAGG - Exonic
1010248957 6:73688645-73688667 TGCACCCTCATCCTCTGGAGAGG + Intergenic
1011621590 6:89248831-89248853 TGAACACTGAAACTGTGGGAAGG - Intergenic
1012517940 6:100084958-100084980 TGCACCCACTACCAGTGGGTAGG - Intergenic
1014987673 6:128031918-128031940 TGCACCCTCACCCTGTGTCAGGG + Intronic
1018265421 6:162019419-162019441 TGCACCCTCAAGCTCAGAGATGG + Intronic
1019771671 7:2887156-2887178 AGCACCCCCTAGCTGTGGGAAGG - Intergenic
1022520939 7:31006537-31006559 TGCCCCCACAGCCTGTGAGAGGG - Intergenic
1024735868 7:52303306-52303328 GGCTCCCTCAGCTTGTGGGAAGG - Intergenic
1026136219 7:67663621-67663643 TGCACACACAATCTGTGGGCAGG - Intergenic
1027413205 7:77944449-77944471 TGAACCCTAAACCTGTAGTAAGG - Intronic
1031619277 7:123916528-123916550 AGCACCCTGAACCTGGGGAAAGG - Intergenic
1032784925 7:135193434-135193456 TGCACCCTCCCTCTGTGGGCAGG - Intronic
1033668599 7:143467791-143467813 TGCACCTTCAACTTTTGGGGGGG - Intergenic
1035458142 7:159022941-159022963 TGCACCCTCATCCTGTTAAAAGG + Intergenic
1036619454 8:10415069-10415091 TGCACCCTCCACCCGCAGGATGG - Intronic
1038037191 8:23696459-23696481 TGGACTCTCTCCCTGTGGGACGG - Intergenic
1038425215 8:27460281-27460303 TGCAGCCTCAGACTGTGGGGTGG + Exonic
1041049528 8:53919665-53919687 TGCAGCCTCAACTTCTGGGCAGG + Intronic
1042344656 8:67715196-67715218 TGAGCCCTTAACCTGTGGCAGGG - Intronic
1043667154 8:82828990-82829012 AGGACCCACAATCTGTGGGATGG - Intergenic
1043990559 8:86748077-86748099 TGCACACTCACCTTTTGGGACGG + Intergenic
1044697185 8:94935266-94935288 TGGACCCTCAACCTAAGAGAGGG + Intronic
1049244241 8:141553188-141553210 TCCACCCTCGGCCTGTGGGCAGG - Intergenic
1051215078 9:14788975-14788997 TTCACCTTCTACCTTTGGGATGG - Exonic
1053393776 9:37754015-37754037 CGCACGCTCAGCCTGTGGGCCGG + Intronic
1053453728 9:38214688-38214710 TGAACCCTCACCAAGTGGGAAGG + Intergenic
1055849997 9:80615485-80615507 TGCACCTTGAAACTGTGGAAAGG - Intergenic
1059041037 9:110815846-110815868 GGGACCCTCACCCTGTGAGAAGG - Intergenic
1061624874 9:131835702-131835724 TGCACACCCAGCCTCTGGGAAGG + Intergenic
1062033901 9:134374297-134374319 GGCACTCACCACCTGTGGGATGG + Intronic
1203519529 Un_GL000213v1:33261-33283 TGCACCCCCTCCCCGTGGGAAGG - Intergenic
1187186341 X:16990264-16990286 TGCCCCCTCAACCCCTGGCATGG - Intronic
1187953773 X:24495747-24495769 TCTACCCTCAACCTCTGGGGAGG - Intronic
1189896881 X:45665158-45665180 GGCTCCCTCAGCCTGTGGGGAGG - Intergenic
1192564460 X:72152023-72152045 TGGACCCTCAGCCCCTGGGATGG + Intergenic
1198955104 X:142120691-142120713 TGAGCCCTCAACTTGTGGGATGG - Intergenic
1199322347 X:146455450-146455472 TGCACCCTTAGCCTGTGATAGGG - Intergenic
1199926067 X:152465572-152465594 TATACCCTCAATATGTGGGAAGG + Intergenic