ID: 1151778717 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:76227414-76227436 |
| Sequence | CTCTGAAGAGATTATAGGCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 205 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 192} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151778717_1151778721 | 20 | Left | 1151778717 | 17:76227414-76227436 | CCTGGCCTATAATCTCTTCAGAG | 0: 1 1: 0 2: 0 3: 12 4: 192 |
||
| Right | 1151778721 | 17:76227457-76227479 | TGTACTAGCAAGTACTACACGGG | 0: 1 1: 0 2: 0 3: 5 4: 59 |
||||
| 1151778717_1151778720 | 19 | Left | 1151778717 | 17:76227414-76227436 | CCTGGCCTATAATCTCTTCAGAG | 0: 1 1: 0 2: 0 3: 12 4: 192 |
||
| Right | 1151778720 | 17:76227456-76227478 | CTGTACTAGCAAGTACTACACGG | 0: 1 1: 0 2: 0 3: 4 4: 68 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151778717 | Original CRISPR | CTCTGAAGAGATTATAGGCC AGG (reversed) | Intronic | ||