ID: 1151778720

View in Genome Browser
Species Human (GRCh38)
Location 17:76227456-76227478
Sequence CTGTACTAGCAAGTACTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151778717_1151778720 19 Left 1151778717 17:76227414-76227436 CCTGGCCTATAATCTCTTCAGAG 0: 1
1: 0
2: 0
3: 12
4: 192
Right 1151778720 17:76227456-76227478 CTGTACTAGCAAGTACTACACGG 0: 1
1: 0
2: 0
3: 4
4: 68
1151778719_1151778720 14 Left 1151778719 17:76227419-76227441 CCTATAATCTCTTCAGAGGACTG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1151778720 17:76227456-76227478 CTGTACTAGCAAGTACTACACGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151778720 Original CRISPR CTGTACTAGCAAGTACTACA CGG Intronic