ID: 1151778721

View in Genome Browser
Species Human (GRCh38)
Location 17:76227457-76227479
Sequence TGTACTAGCAAGTACTACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151778717_1151778721 20 Left 1151778717 17:76227414-76227436 CCTGGCCTATAATCTCTTCAGAG 0: 1
1: 0
2: 0
3: 12
4: 192
Right 1151778721 17:76227457-76227479 TGTACTAGCAAGTACTACACGGG 0: 1
1: 0
2: 0
3: 5
4: 59
1151778719_1151778721 15 Left 1151778719 17:76227419-76227441 CCTATAATCTCTTCAGAGGACTG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1151778721 17:76227457-76227479 TGTACTAGCAAGTACTACACGGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151778721 Original CRISPR TGTACTAGCAAGTACTACAC GGG Intronic