ID: 1151784122

View in Genome Browser
Species Human (GRCh38)
Location 17:76266638-76266660
Sequence CAGCACACAGAGAAGTGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151784115_1151784122 30 Left 1151784115 17:76266585-76266607 CCAAGATAAGGCCAGGAATGTGT 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG 0: 1
1: 0
2: 1
3: 18
4: 251
1151784116_1151784122 19 Left 1151784116 17:76266596-76266618 CCAGGAATGTGTCTTTAATCTCT 0: 1
1: 0
2: 0
3: 22
4: 288
Right 1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG 0: 1
1: 0
2: 1
3: 18
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151784122 Original CRISPR CAGCACACAGAGAAGTGGTC CGG Intronic
900617277 1:3571095-3571117 CAGGACACAGAGAGAGGGTCTGG + Intronic
901470587 1:9453784-9453806 AAGCACACAGAGACGTGGAAAGG + Intergenic
901847255 1:11991341-11991363 GGGCACACAGAGAAGGGGTCCGG + Intronic
902227944 1:15008521-15008543 CTGCAAACAGTGAAGTGCTCTGG - Intronic
902736652 1:18405671-18405693 CAGAACTCAGAAAAGTGGTGGGG - Intergenic
902776291 1:18676862-18676884 CAGCCCCCTGAGAAGGGGTCTGG - Intronic
904092424 1:27954674-27954696 CAGCACACAGGGCTGTGGTGAGG - Intronic
904205074 1:28849067-28849089 CAGCAGACACAGAAAGGGTCAGG + Intronic
906948519 1:50315921-50315943 CAGCACACAGAAAATGGTTCAGG - Intergenic
907722685 1:56986812-56986834 CAGCACACAGAGAAGGGGTTTGG - Intergenic
908443267 1:64176930-64176952 CATCACACAGAGAAGTAGCAAGG + Intronic
908780941 1:67689038-67689060 GAGCAAACAGGGAAGTGGCCAGG + Intergenic
911835169 1:102609769-102609791 AAGCACAAAGAGAAAAGGTCAGG + Intergenic
913608682 1:120490103-120490125 CAGCACACAGGGAGGTGGGGAGG - Intergenic
913986748 1:143572573-143572595 CAGCACACAGGGAGGTGGGGAGG + Intergenic
914205149 1:145520348-145520370 CAGCACACAGGGAGGTGGGGAGG + Intergenic
914582515 1:149031735-149031757 CAGCACACAGGGAGGTGGGGAGG + Intronic
915715090 1:157937899-157937921 CTCCAGACAGAGAAGTGGTCAGG + Intergenic
916159070 1:161890689-161890711 CAGCACACAGAGCTTTGGTAGGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916554470 1:165882163-165882185 CAGGTGACAGAGCAGTGGTCTGG + Intronic
917213819 1:172657734-172657756 CAGCACACAGAAATGTTGGCAGG + Intergenic
918829589 1:189376662-189376684 CAGCATAGAGTGAAGTGGTGTGG + Intergenic
918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG + Intergenic
919853042 1:201686566-201686588 CAGCATAAAGAAATGTGGTCAGG - Intronic
921055837 1:211541850-211541872 CAGCACACAGAGAAGTGAAAGGG - Intergenic
921323862 1:213971302-213971324 CAGCACACAGAGGGGTGCTAGGG + Intergenic
922161476 1:223081658-223081680 CAGCACACCGGGAGGTGGTCAGG + Intergenic
923113451 1:230912067-230912089 CAGAACACAGAGAAGGGGCGTGG + Intronic
924329795 1:242930184-242930206 CAGCACACACTGCAGTGGTGAGG - Intergenic
1064858917 10:19803760-19803782 CACCACACAGAGAATTAGCCTGG + Intergenic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1065845583 10:29739987-29740009 AAGGACACAGAGAAGTGACCTGG - Intergenic
1071386117 10:85123068-85123090 CAGGAGACAGAGAAGGGGTGAGG + Intergenic
1074096980 10:110322458-110322480 CAGCAGAAAGAGAAGAGATCAGG - Intergenic
1075107257 10:119548506-119548528 CAGACCACAGAGAAGAGGACAGG + Intergenic
1075264225 10:120987232-120987254 GAGGACACAGAGAACTGGTGTGG + Intergenic
1075791584 10:125088074-125088096 CAGCCCACAGAGAACTGTCCAGG + Intronic
1076370910 10:129952907-129952929 CAGCACACACAGTTGTGCTCTGG - Intronic
1077430994 11:2515933-2515955 TGGCACACATAGAGGTGGTCAGG - Intronic
1078110518 11:8388248-8388270 CAGCCCTCAGAGGAGTGGTGGGG - Intergenic
1079144728 11:17840549-17840571 CAGAACACATAGCAGTGGTAAGG + Intronic
1079447294 11:20568925-20568947 AAGCACAGAGATAAGAGGTCAGG - Intergenic
1079668265 11:23134828-23134850 CAGCAGACCAAGAAGTGCTCAGG + Intergenic
1080661121 11:34296765-34296787 GAGTAAACAGAGAAATGGTCTGG + Intronic
1083190870 11:61051421-61051443 CAGCACAGAGAGCAGGGGCCTGG + Intergenic
1084033532 11:66494528-66494550 CAGCCCACACAGCAGGGGTCAGG - Intronic
1084347824 11:68567721-68567743 CAGCACACAGAGAAGAAGCATGG - Intronic
1086462882 11:87023027-87023049 CAGCAAACCAAGAAGTGCTCAGG - Intergenic
1088952511 11:114586046-114586068 TAGCACACAAAGAACTGGTTAGG - Intronic
1089136374 11:116252508-116252530 CAGCACTGAGAGAGGTAGTCTGG - Intergenic
1093546805 12:20358380-20358402 CAGCACACAGAGATGTGAGCAGG - Intergenic
1095130815 12:38540319-38540341 GAGCAAACATGGAAGTGGTCTGG + Intergenic
1097102765 12:56601086-56601108 CTGCTCACAGAGATGTGCTCAGG - Exonic
1098402074 12:70086533-70086555 CAGCACAGAGATAAGAGGTCAGG - Intergenic
1102816434 12:115869906-115869928 GAGCACACAGACAAGTAGACAGG + Intergenic
1103347128 12:120258627-120258649 AAGCACACAGAGAAGTTGAGAGG + Intronic
1105024345 12:132838463-132838485 CAGCACACGGAGGGGTGGGCAGG + Intronic
1105923268 13:24984483-24984505 CAGCACCCAGAGAGGTGGAGGGG + Intergenic
1107220479 13:37973818-37973840 GGGCACAGAGATAAGTGGTCGGG + Intergenic
1109155328 13:58902356-58902378 CAACATACAGAGAAGTAGCCAGG - Intergenic
1110752939 13:79136910-79136932 GAGGATACAGAGAAGTGATCAGG - Intergenic
1112172732 13:96991260-96991282 CAGCACACAAAAAACCGGTCTGG + Intronic
1113593713 13:111517675-111517697 CAGCGCACACAGGAGTAGTCAGG - Intergenic
1113681470 13:112247865-112247887 CAGCACCCGGAGAGGTGGTTTGG + Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1118602020 14:67477537-67477559 TAGCACACAGGAAAGAGGTCTGG - Intronic
1120359466 14:83479598-83479620 GAGCATTCAGTGAAGTGGTCTGG - Intergenic
1120722227 14:87901659-87901681 GAGGAGACAGAGAGGTGGTCAGG - Intronic
1122694559 14:103546434-103546456 CAGCACCCACGGACGTGGTCGGG + Intergenic
1123954608 15:25322359-25322381 AAGCACACACAGGAGTGTTCAGG - Intergenic
1123979230 15:25584171-25584193 CAGCAGCCAGAAAAATGGTCTGG + Intergenic
1124436420 15:29652752-29652774 CTGCACACAGTCAAGTGGGCCGG - Intergenic
1125827593 15:42689489-42689511 CTGCAGACAGAGATGTGGCCTGG - Exonic
1126506232 15:49406988-49407010 CAGCAGACCAAGAAGTGCTCAGG + Intronic
1129118775 15:73382190-73382212 GAGCACACAGTGCAGTGGTCAGG - Intergenic
1129450109 15:75646973-75646995 CAGCAAGGAGAGAAGTGGTCAGG - Intronic
1130104653 15:80920307-80920329 CAGCACACAGAGAGGGGTCCAGG - Intronic
1130684438 15:86024504-86024526 CAACCCACAGAGAGATGGTCTGG + Intergenic
1132237745 15:100234736-100234758 CAGCAGTCAGAGGAGTGGTCGGG - Intronic
1132262832 15:100441391-100441413 GGGCACAGAGATAAGTGGTCAGG - Intronic
1134269507 16:12721408-12721430 CAGCAAGCAGAGGGGTGGTCTGG - Intronic
1134657138 16:15955535-15955557 AAGCAGCCAGAGAAGAGGTCAGG - Intronic
1136056324 16:27692550-27692572 CAGCACACTGAGGAGTGGCAAGG - Intronic
1137597569 16:49734954-49734976 GAGGCCACAGAGAAGTGGTGGGG + Intronic
1138823857 16:60294626-60294648 CAGCACTTTGAGAAGTGGTTTGG - Intergenic
1139194163 16:64898685-64898707 CTGCACACAGAGTTGTGATCTGG + Intergenic
1140075771 16:71697672-71697694 CAGTACACAGAGAAACGTTCAGG + Intronic
1140258544 16:73357657-73357679 CAGCAGACAGAGGAGTGGTAGGG + Intergenic
1141290987 16:82717972-82717994 CTGCACACACAGAATGGGTCAGG - Intronic
1141421171 16:83917511-83917533 CAGAAGACAGAGAAGGGGCCTGG - Exonic
1141872500 16:86797482-86797504 CAGCACACAAAGAAGGGAACAGG - Intergenic
1142440152 16:90092826-90092848 CAGCATACATAGAACTGGGCCGG + Intergenic
1142814769 17:2416525-2416547 CAGGACACACAGCAGAGGTCTGG + Exonic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1144038479 17:11387929-11387951 CAGCACCCAGACAAATGGGCTGG - Intronic
1144945390 17:18967077-18967099 CGGCCCACAGAGGAGTGCTCGGG + Intronic
1145795581 17:27653656-27653678 CAGCAAACATAGAGGTGGCCTGG + Intergenic
1146277499 17:31524770-31524792 CAGCACAAAAAGAAGAGGTGAGG + Intronic
1147559526 17:41500370-41500392 GAGCACAGAGAGAAGGGGCCAGG + Intergenic
1148876613 17:50691064-50691086 CAAAAAAGAGAGAAGTGGTCAGG - Intronic
1149127553 17:53254349-53254371 CAGCAAACAGAAGAGTGCTCAGG - Intergenic
1151471071 17:74318123-74318145 CAGCACACAGAGAGGCTGGCTGG - Intergenic
1151622304 17:75253672-75253694 GGGCACACAGATAAGAGGTCGGG - Intronic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1152556660 17:81056500-81056522 CCGCACACGGGGAAGTGGTGTGG + Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152957402 18:50735-50757 CAGCATACATAGAACTGGGCCGG - Intronic
1154033245 18:10772507-10772529 CAGAACACAGAGGAGAGGACTGG - Intronic
1155072642 18:22329761-22329783 CAGCAGACAGTGAACTGGTGTGG - Intergenic
1155170525 18:23263777-23263799 CATCACACAGAGAATGGTTCAGG + Intronic
1156211963 18:34953961-34953983 CATTACACAGAGATGTGGACAGG + Intergenic
1157489156 18:48110281-48110303 CAGCAAACACAGATGTGGTCAGG - Intronic
1157629694 18:49081830-49081852 CTGCACACAGAGCAGAGGTGGGG - Intronic
1158498825 18:57982154-57982176 CGGCAAATAGACAAGTGGTCAGG + Intergenic
1159505267 18:69328010-69328032 CAGCAGACCGAGGAGTGCTCAGG - Intergenic
1160291414 18:77598055-77598077 GAGCACACACAGAAATGGACAGG + Intergenic
1163588290 19:18175786-18175808 CTGCACAGACAGCAGTGGTCAGG - Intronic
1165038065 19:33049027-33049049 CAGCCCATAGATATGTGGTCAGG + Intronic
1165319924 19:35078942-35078964 AAGCACACAGAAGAGTTGTCAGG + Intergenic
1165723744 19:38098354-38098376 CATCACACAAAGAAGTGGGCAGG + Intronic
1165953374 19:39487196-39487218 TAGCACACAGAGAGGTGATTAGG - Intronic
1168051411 19:53832404-53832426 GGGCACACAGATAAGAGGTCAGG - Intergenic
1168404428 19:56103364-56103386 CAGGACACCGAGAACTGGCCTGG + Intronic
1168453255 19:56482889-56482911 CAGCCAGCAGTGAAGTGGTCTGG + Intergenic
924965559 2:73407-73429 CAGCACCCTGAGAAGTGCCCCGG + Intergenic
927029647 2:19107162-19107184 GGGAACACAGAGAAATGGTCTGG + Intergenic
928940384 2:36721436-36721458 CAGCACCCAGAGGAGGGGTAGGG - Intronic
929123141 2:38499874-38499896 CAGTACACAGAGATGTGGGGAGG + Intergenic
929533629 2:42767335-42767357 CAGTACACAGAGAGGTAGTGGGG + Exonic
929781962 2:44962749-44962771 CAGCCCACATAGAAATGGTTTGG + Intergenic
932245925 2:70196369-70196391 CAGCACTCTGAGAGGTGGGCAGG - Intronic
932591117 2:73068346-73068368 CAGGACACAGAGATGTGGGCTGG + Intronic
933151460 2:78919983-78920005 CAGTACAGACAGACGTGGTCAGG - Intergenic
933163557 2:79052440-79052462 GAGCACAGAGATAAGAGGTCAGG - Intergenic
933848586 2:86347697-86347719 CATCACACAGAAATGTGCTCAGG - Intergenic
935085592 2:99841547-99841569 CAGAACACTGAGAAATGTTCTGG + Intronic
935496385 2:103787225-103787247 CAGCACAGAGTCAAGTGGTAAGG - Intergenic
936347691 2:111687776-111687798 CAGCTCACAGCGAATTGGCCAGG + Intergenic
940909079 2:159194596-159194618 CAGCATACACAGAAAGGGTCGGG + Intronic
941044111 2:160653241-160653263 CAGCTCTCTGAGAAATGGTCAGG - Intergenic
946245540 2:218385139-218385161 CAGCACCCAGAGAAGCTGTGAGG - Exonic
947773594 2:232690267-232690289 CAGCACACATAGTAATGCTCAGG + Intergenic
948478514 2:238236578-238236600 CAGCCCTCAGAGAAGGGATCCGG + Intergenic
948882249 2:240865583-240865605 CAGCACAGAAGGAAATGGTCGGG - Intergenic
1168796570 20:613769-613791 CAGCACACAGAGCAGTGTCGAGG - Intergenic
1168915471 20:1482008-1482030 CAGCCCAGAAAGAAGTGTTCTGG + Intronic
1169565467 20:6848997-6849019 CATCATAGAGAGAAGTGGCCTGG - Intergenic
1171345293 20:24461440-24461462 CAGCCCACAGAGAGGGGGGCAGG + Intergenic
1171900839 20:30854784-30854806 CAGCATACATAGAACTGGGCCGG + Intergenic
1172083772 20:32362205-32362227 CTGCCCAAAGAGAAGTGTTCAGG - Intronic
1173476722 20:43364901-43364923 AAGAACACAGGGAAGAGGTCTGG - Intergenic
1176300100 21:5095322-5095344 CAGGACACACAGGACTGGTCTGG + Intergenic
1177886627 21:26754941-26754963 CAGCAAAGAGACAAGTGGTCTGG + Intergenic
1179074705 21:38109262-38109284 CAGCACACAGAGAATTTCTTGGG - Intronic
1179074750 21:38109632-38109654 CAGCACACAGAGAATTTCTTGGG - Intronic
1179856922 21:44166589-44166611 CAGGACACACAGGACTGGTCTGG - Intergenic
1180334209 22:11560771-11560793 CAGCATACATAGAACTGGGCCGG + Intergenic
1182948788 22:34351498-34351520 CAGTACACAGGGAGGTGGACAGG + Intergenic
1184424674 22:44402550-44402572 CAGCCCACACATAAGTGGTTTGG + Intergenic
1184947122 22:47811378-47811400 CAGCACACACAGAAGCAGGCAGG - Intergenic
949769974 3:7568679-7568701 CAGCACTCAGAGCAGCGGGCCGG + Intronic
950511281 3:13429305-13429327 CAATACACAGAGAAGTACTCAGG - Intergenic
952841637 3:37651702-37651724 AGGGACTCAGAGAAGTGGTCTGG + Intronic
952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG + Exonic
959972431 3:112422134-112422156 GAGCACAGAGATAAGAGGTCAGG + Intergenic
960719140 3:120608491-120608513 AATCACACCGGGAAGTGGTCCGG + Intergenic
961076335 3:123986492-123986514 CAGGACACAGAGAAGTCACCTGG - Intronic
962878301 3:139552933-139552955 CAGAGCACAGGGAAGTGGCCAGG - Intergenic
966028320 3:175313766-175313788 CAGGAATCAGAAAAGTGGTCCGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967317087 3:188159838-188159860 CCTCACACAGACAGGTGGTCTGG + Intronic
969207778 4:5660615-5660637 GACCATAAAGAGAAGTGGTCAGG - Intronic
969956833 4:10899141-10899163 TAGCATAAAGAGAAATGGTCAGG + Intergenic
975714124 4:77189346-77189368 CGGCACAGAGAGAAGAGGTGTGG - Intronic
975909189 4:79248081-79248103 CAGTAGACAGGGAAGTGCTCAGG - Intronic
978302408 4:107285769-107285791 CAGTACACAGAGAATTGGCATGG + Intergenic
979076225 4:116274755-116274777 CAGCAGACCAAGAAGTGCTCAGG - Intergenic
980331443 4:131415772-131415794 CAGCACACCAAGGAGTGCTCAGG - Intergenic
981008293 4:139897993-139898015 AAGGACACATAGAATTGGTCAGG - Intronic
981961101 4:150539711-150539733 TAGCACACTGAGTAGTGTTCAGG - Intronic
984181904 4:176494013-176494035 CATAACACACACAAGTGGTCTGG - Intergenic
984748950 4:183253201-183253223 CAGCAAAGAGAGCAGTGGTGTGG - Intronic
985441675 4:189986045-189986067 CAGCATACATAGAACTGGGCCGG - Intergenic
985671186 5:1207416-1207438 CAGCACCCAGAGAAGGGGCCTGG - Intronic
986176832 5:5359751-5359773 CGGCACACAGCGAAGTCTTCTGG - Intergenic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
991518399 5:67466055-67466077 CAGCACACAGAGTAGAGGAAAGG - Intergenic
992305349 5:75431527-75431549 CATAACACAGAGAAGGGATCAGG - Intronic
994647107 5:102483870-102483892 CAGCTCCCACAGAAGTGATCTGG + Intronic
994779213 5:104069242-104069264 GGGCACACAGATAAGAGGTCGGG + Intergenic
997149526 5:131477939-131477961 CAGCCCACACTGAAGAGGTCAGG - Intronic
997628686 5:135349664-135349686 CAGCAGACAGTGAAGTCATCTGG - Intronic
998478926 5:142445241-142445263 CAGCATTCAGAGAGGTCGTCAGG + Intergenic
998650715 5:144118558-144118580 CACCACACAGAGAAGCGGGGTGG - Intergenic
999694974 5:154180639-154180661 CAAAACACAGAGAGGTGGTGGGG - Intronic
1000731511 5:164839733-164839755 CAGCCCAGGAAGAAGTGGTCAGG - Intergenic
1001548688 5:172586797-172586819 AGGCACAGAGAGAAGTGGTGTGG + Intergenic
1002187232 5:177460026-177460048 CAGCACACTGAGAAGCGGAACGG + Intronic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1003400193 6:5784563-5784585 CAGCACCCAGAGAGGTGGAGGGG + Intergenic
1004050487 6:12073475-12073497 GAGGACACAGAGATGGGGTCTGG - Intronic
1006899958 6:37493620-37493642 CAGCACGCAGAGGACTGTTCAGG - Intronic
1008056702 6:46952998-46953020 CAGCACACACAGAAATAGGCAGG + Intronic
1008276715 6:49551069-49551091 CTGCACCCAGAGAGGTGGTTAGG + Exonic
1010478695 6:76322232-76322254 CAGCCCAAAGTGTAGTGGTCAGG + Intergenic
1012411421 6:98962408-98962430 CAGTATACAGAGAAGATGTCTGG + Intergenic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1015593239 6:134842577-134842599 CAATACACAGAGAAGTGGAGAGG - Intergenic
1016289066 6:142507422-142507444 CTGCAACCAGGGAAGTGGTCTGG - Intergenic
1018039517 6:159909670-159909692 CAGCACACACAGGAGAGGACAGG - Exonic
1018175234 6:161172566-161172588 CCACCCACAGAGATGTGGTCAGG + Intronic
1018395077 6:163372212-163372234 TAGCTCACAGAAAAGTGGTGAGG + Intergenic
1022814196 7:33898438-33898460 CAGCAAACACAGAAGTCGTAAGG - Intergenic
1023056722 7:36296500-36296522 CAGCACAGGGAAAGGTGGTCAGG - Intronic
1023445013 7:40222358-40222380 GAGAACACAGAGAAGAGGTATGG - Intronic
1024056083 7:45660589-45660611 CTGCCCAGAGAAAAGTGGTCTGG + Intronic
1024677315 7:51648383-51648405 CAGCACAGAGGGAAGTTGTTTGG + Intergenic
1024710711 7:52011702-52011724 CAGCACACCTGGAAGTGGGCGGG + Intergenic
1030333269 7:108295871-108295893 CAGGGCACAGAGGAGTGGTGAGG + Intronic
1031584872 7:123522102-123522124 CAGAACCCTGAGAAATGGTCTGG - Intronic
1035901867 8:3465479-3465501 CAGCACACACAGTAATGGTGAGG - Intronic
1036371950 8:8169670-8169692 CGGGACACAGAGATGAGGTCAGG - Intergenic
1036878954 8:12495973-12495995 CGGGACACAGAGATGAGGTCAGG + Intergenic
1039922278 8:41901735-41901757 CAGCATGCAGGGAAGTGGTGTGG + Intergenic
1045051214 8:98327619-98327641 CACAACACAGAGATGTGGTGGGG - Intergenic
1045480693 8:102589674-102589696 GAGCTCACAGAGCAGTGGTGAGG - Intergenic
1045578630 8:103453680-103453702 CTGCAGACAGAGAAGAGGGCTGG - Intergenic
1047542527 8:125784629-125784651 CAGCACACAGAGAGCTGAGCAGG - Intergenic
1048179934 8:132185278-132185300 CTGCACACAGGGCAGTGGTGTGG - Intronic
1049594199 8:143475961-143475983 CAGCACACAGCCAGGTGGTCAGG - Intronic
1050132419 9:2426574-2426596 CAGTACACAGAGAAATGTGCTGG - Intergenic
1052367263 9:27626741-27626763 GAGCACAGAGAGAAGTGTTGGGG - Intergenic
1053602880 9:39628649-39628671 AAGCTCAAAGAGAAATGGTCTGG - Intergenic
1053860528 9:42382395-42382417 AAGCTCAAAGAGAAATGGTCTGG - Intergenic
1054250657 9:62713787-62713809 AAGCTCAAAGAGAAATGGTCTGG + Intergenic
1054564765 9:66748299-66748321 AAGCTCAAAGAGAAATGGTCTGG + Intergenic
1055345448 9:75331713-75331735 AAGAAAACATAGAAGTGGTCAGG + Intergenic
1055626498 9:78181709-78181731 GGGCACACAGATAAGAGGTCAGG - Intergenic
1055749673 9:79491093-79491115 CAGCTGACAGAGAAGTAGTTTGG + Intergenic
1057840600 9:98482980-98483002 CAGCACACAGAGAACAGTTGTGG - Intronic
1058289901 9:103226700-103226722 CTGCAGACAGAGAAGTGATTTGG - Intergenic
1058901501 9:109446353-109446375 CAGCACACAGTGCAGTGGACAGG - Intronic
1059537341 9:115093680-115093702 CAACACACAGAAAAGTGTTGGGG - Intronic
1060924762 9:127448596-127448618 CAGCCAACAGAGACCTGGTCAGG + Intronic
1061432011 9:130537046-130537068 GAGGAGACAGAGAAGTGGCCAGG + Intergenic
1061644545 9:131990130-131990152 CAGCAAACAGAGAAGCTGTGGGG - Intronic
1061864293 9:133484665-133484687 CAGCAGAAAGAGAGCTGGTCTGG + Intergenic
1061999078 9:134207061-134207083 CCGCACACAGGGAAGTTGACAGG - Intergenic
1062402527 9:136378774-136378796 CAGCTCACAGAGATCTGGCCGGG + Exonic
1062740743 9:138173838-138173860 CAGCATACATAGAACTGGGCCGG + Intergenic
1203493753 Un_GL000224v1:131372-131394 CAGACCACAGAGGATTGGTCTGG - Intergenic
1203494549 Un_GL000224v1:138756-138778 CAGAACCCACAGAAGTGTTCTGG - Intergenic
1203506373 Un_KI270741v1:73247-73269 CAGACCACAGAGGATTGGTCTGG - Intergenic
1203507168 Un_KI270741v1:80631-80653 CAGAACCCACAGAAGTGTTCTGG - Intergenic
1186113405 X:6279047-6279069 CAGCACACAGGGCAGAGGACTGG + Intergenic
1187671086 X:21666447-21666469 CAGCCCACAGTGAAGTGGCTTGG + Intergenic
1189007970 X:37014793-37014815 CAGCAGACTGAGAGGTGCTCAGG - Intergenic
1189040502 X:37537736-37537758 CAGCAGACTGAGAGGTGCTCAGG + Intronic
1191613506 X:63142257-63142279 TAGTACAGAGAGAAGTAGTCTGG - Intergenic
1191622791 X:63236670-63236692 TAGTACAGAGAGAAGTAGTCTGG + Intergenic
1192738907 X:73874713-73874735 CATGATACAGAGGAGTGGTCAGG + Intergenic
1195930058 X:110065424-110065446 CAGTACACAGAGAAGAGGAAGGG - Intronic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197089905 X:122523831-122523853 CAGCCCTGGGAGAAGTGGTCAGG - Intergenic
1199182955 X:144879454-144879476 CACCTCACAGAAAAGTAGTCAGG + Intergenic
1199866198 X:151852321-151852343 CAGCACACAGAGCAGTCTTTAGG + Intergenic
1200018878 X:153185324-153185346 CAGGACACATGGAAGTGGCCAGG - Intergenic
1200084470 X:153596831-153596853 CAGCACATTGAAAAGTGGGCTGG + Intronic
1201227153 Y:11829309-11829331 CAGCACACACTGCAGTGGTGAGG - Intergenic
1201958379 Y:19650768-19650790 CAGCTCTCAGAGAGATGGTCTGG - Intergenic