ID: 1151786151

View in Genome Browser
Species Human (GRCh38)
Location 17:76275993-76276015
Sequence GAGCTCTGTGGGAACCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151786142_1151786151 23 Left 1151786142 17:76275947-76275969 CCTGATGGGGGACAGGAGGGAAG 0: 1
1: 0
2: 2
3: 39
4: 369
Right 1151786151 17:76275993-76276015 GAGCTCTGTGGGAACCCCTGGGG 0: 1
1: 0
2: 3
3: 12
4: 233
1151786139_1151786151 29 Left 1151786139 17:76275941-76275963 CCTGAGCCTGATGGGGGACAGGA 0: 1
1: 0
2: 2
3: 31
4: 261
Right 1151786151 17:76275993-76276015 GAGCTCTGTGGGAACCCCTGGGG 0: 1
1: 0
2: 3
3: 12
4: 233
1151786137_1151786151 30 Left 1151786137 17:76275940-76275962 CCCTGAGCCTGATGGGGGACAGG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 1151786151 17:76275993-76276015 GAGCTCTGTGGGAACCCCTGGGG 0: 1
1: 0
2: 3
3: 12
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151786151 Original CRISPR GAGCTCTGTGGGAACCCCTG GGG Intronic
900142884 1:1145870-1145892 GGGCTCTGCGGGATCCCCTGTGG - Intergenic
900421212 1:2556782-2556804 GAGATCTGTGGGAGGCCCTGGGG - Intronic
900467528 1:2833061-2833083 GAGCTCTGTGGGGCCCCCTGGGG - Intergenic
900582066 1:3414291-3414313 GAGGTGTGAGGGAACCACTGAGG + Intronic
900584011 1:3423739-3423761 GGCCTCTGTGGGAGCCTCTGTGG - Intronic
900740591 1:4328565-4328587 GAGCTGGGTGGGGACCACTGCGG + Intergenic
901531844 1:9858648-9858670 GAGCTCTGTGGGTAGCACTGAGG - Intronic
902414219 1:16229661-16229683 GAGGTCTCTGGGCAGCCCTGTGG - Intergenic
902568692 1:17332699-17332721 GAGATCTGTGGGAACCCCAGAGG - Intronic
904585873 1:31580332-31580354 GACCTGTGTGGGCAGCCCTGGGG + Intronic
904680606 1:32226454-32226476 GTGCTGTTTGGGGACCCCTGGGG + Exonic
907241633 1:53084292-53084314 GGGCTCTGGGAGAAGCCCTGGGG + Intronic
909713605 1:78680254-78680276 GATCTCTGTGGTAACTCTTGAGG - Intergenic
911200332 1:95037513-95037535 CAGCACTGTGGGAAGCCCGGTGG + Intronic
913075522 1:115338079-115338101 GAGCTCTCTGGTTACCCCCGAGG - Intronic
913112138 1:115666296-115666318 GAGCGATGTGGGAGCCCATGGGG - Intronic
914321583 1:146567888-146567910 CAGGTCTTTGGGACCCCCTGAGG + Intergenic
919794307 1:201311970-201311992 GAGCTCTGTGTGAGCCCAAGTGG - Intronic
919917431 1:202147406-202147428 GCTCTCTGTGGAAACCCCCGAGG - Exonic
920192516 1:204202621-204202643 GAGCTCTGGGCGAGACCCTGGGG - Intronic
920343622 1:205291893-205291915 AACCCCTGGGGGAACCCCTGGGG - Intergenic
920708845 1:208275806-208275828 GAGCTCTGGGGGAGCCTGTGTGG + Intergenic
920828377 1:209443587-209443609 AAGCTCAGTGGGAATCTCTGGGG + Intergenic
922199989 1:223393513-223393535 GGGATCTCTGGGAACCCCCGCGG + Exonic
922798025 1:228351160-228351182 GGGCTCTCTGAGGACCCCTGGGG + Intronic
1063112079 10:3046369-3046391 GAGGTCAGTGGGAACCACGGAGG - Intergenic
1063572994 10:7233810-7233832 GGGCTCTGTGGCAACCCTTCAGG + Intronic
1068455704 10:57251022-57251044 GATCTCTCTGGGAGCCCCTATGG - Intergenic
1070838814 10:79469011-79469033 GAGCTCTGTGGGAACTGATGAGG + Intergenic
1070855609 10:79606158-79606180 GAGCTGTCTTGGAATCCCTGAGG + Intergenic
1072618554 10:97065332-97065354 GAGCTCTGTGGGAAAGAATGTGG + Intronic
1073839793 10:107485072-107485094 AAGGTCTCTGGGAGCCCCTGGGG + Intergenic
1075689839 10:124387431-124387453 GAGCCCTCTGGGATCACCTGAGG - Intergenic
1075702940 10:124481074-124481096 AAGCCCTGTGGGAAGCCCTGGGG + Intronic
1076086184 10:127634300-127634322 GAGGTCTGGGGGACCCTCTGGGG + Intergenic
1076254591 10:129012140-129012162 TGGGTCTGTGGGAATCCCTGGGG - Intergenic
1076598542 10:131641608-131641630 GAGTCTTGTGGGAGCCCCTGGGG - Intergenic
1076879918 10:133235272-133235294 GAGCACTCTGGGACCACCTGAGG - Intergenic
1077114013 11:874983-875005 GAGCCCTGTGGGGGCTCCTGAGG - Intronic
1077185630 11:1234242-1234264 CAGCTCGGCGGGCACCCCTGGGG + Exonic
1077358624 11:2130009-2130031 AAGCTCTGTGGGACCTCTTGGGG - Intronic
1077540432 11:3144080-3144102 CAGGGCTGTGGGACCCCCTGAGG - Intronic
1078084583 11:8225962-8225984 TAGCCCTGTGGGAGTCCCTGGGG - Intronic
1079403236 11:20123353-20123375 CAGCTCTGTGGGAAACCCTGAGG - Intergenic
1079985490 11:27196479-27196501 GAGCTCTGTTTGAAACCATGAGG - Intergenic
1080756676 11:35206870-35206892 GAGCTCTGAGGACACCCATGGGG + Intronic
1081988769 11:47326386-47326408 GGGCTGAGTGGGGACCCCTGGGG + Intronic
1083755582 11:64790035-64790057 GAGGTCAGTGAGGACCCCTGTGG - Intronic
1083887162 11:65578482-65578504 GTGATGTGAGGGAACCCCTGGGG - Intronic
1084226029 11:67715365-67715387 GGGCTCTGTGGACACCCCTTAGG - Intergenic
1084263860 11:67995239-67995261 GGGCTCTGTGGACACCCCTTAGG - Intronic
1085845307 11:80058371-80058393 AAGCTTTGTAGGAACCCCTTGGG - Intergenic
1086207136 11:84272792-84272814 TAGCTCTGGGGGAACCAATGGGG + Intronic
1086942900 11:92816587-92816609 GACCTCTTTGGGACCCACTGTGG - Intronic
1090854669 11:130601220-130601242 GAGCTCAGTGGGAGGGCCTGTGG + Intergenic
1090995265 11:131860390-131860412 GGGCTCTGTGGGACCCTCTTGGG - Intronic
1091148765 11:133305743-133305765 CTGCTCTGAGGGAACGCCTGCGG - Intronic
1092253763 12:6915471-6915493 GAGATCTGGGGGAACCCCACCGG + Exonic
1092480446 12:8854665-8854687 CAGTTCTGAGGGAAGCCCTGGGG + Intronic
1094021288 12:25917126-25917148 TGGCTCTGTGGGATCTCCTGAGG + Intergenic
1101005045 12:100393253-100393275 GATCCCTGTGGAAATCCCTGTGG - Intronic
1103953071 12:124562304-124562326 GGGCTGTCTGGGAACTCCTGCGG - Intronic
1104003513 12:124875607-124875629 GAGCTCAGAGGGAATACCTGGGG - Intronic
1104929201 12:132329371-132329393 GCGCTCTGGGGGACCCCCGGCGG - Intergenic
1106186299 13:27412777-27412799 CAGATCTCTGGGACCCCCTGTGG - Intergenic
1106758660 13:32846775-32846797 GAGCTCAGTGGGGTGCCCTGGGG + Intergenic
1110450787 13:75636103-75636125 GGGCTGTGCGGGAACCCCAGCGG + Intronic
1112504762 13:99969174-99969196 CAGCGCTGTGGGATCCCCAGAGG + Intronic
1112788640 13:102979639-102979661 GGGCTCTGTGGGCAACCATGTGG + Intergenic
1113049051 13:106188169-106188191 GGGCTCAGTGAGAACCCATGGGG + Intergenic
1118850608 14:69580436-69580458 CAGCTGTGTGGGAACGTCTGTGG + Intergenic
1119860721 14:77934066-77934088 GATCTCCCTGGGAAACCCTGAGG - Intronic
1120240489 14:81944092-81944114 GACCTCTGTGCTCACCCCTGAGG + Intergenic
1120933069 14:89867832-89867854 GAGGACACTGGGAACCCCTGTGG + Intronic
1121042037 14:90757611-90757633 GAGCTGTGTGGCAACTGCTGTGG - Intronic
1122091601 14:99344362-99344384 GAGCTTTCTGAGAAGCCCTGAGG - Intergenic
1122367170 14:101201024-101201046 GAGCTGTGTGGGGAGTCCTGAGG - Intergenic
1122996878 14:105269855-105269877 GAGCTGTGTGGGGACTGCTGTGG - Intronic
1125925166 15:43557195-43557217 CAGCACTGTGGGAACCCAAGGGG + Intronic
1126686563 15:51253353-51253375 TAGCTCTTTAGGGACCCCTGAGG - Intronic
1126725663 15:51628905-51628927 GAGTTTTGTTGGAACCCCAGAGG + Intergenic
1129663622 15:77567135-77567157 GAGCTCTGGGGGTCTCCCTGGGG - Intergenic
1131017256 15:89068094-89068116 ATGCTCTGTGGGAGACCCTGAGG - Intergenic
1131182396 15:90249597-90249619 GAGCTAGGAGTGAACCCCTGCGG + Exonic
1132234370 15:100208035-100208057 GAGTTCTTTGGGATTCCCTGGGG - Intronic
1132699210 16:1215151-1215173 GACCTCCGTGGGAAAGCCTGCGG - Intronic
1132737307 16:1393386-1393408 GGACTCAGTGGGAACCCATGCGG - Intronic
1132831167 16:1929266-1929288 AAGGACTGTGGGAACCTCTGAGG + Intergenic
1133236681 16:4390619-4390641 GTGCTCAGTGGCAGCCCCTGGGG - Intronic
1133803857 16:9107930-9107952 GACCTCTGTGATAACCCCAGTGG - Intronic
1135096469 16:19568644-19568666 GAGCTCTGTGGGAGGAACTGGGG + Intronic
1136667201 16:31822346-31822368 GAGAACTGCTGGAACCCCTGAGG - Intergenic
1136676560 16:31913738-31913760 TAGCCCAGTGGAAACCCCTGTGG - Intronic
1137565228 16:49528598-49528620 CAGCTCTGCGGGAACCCTTCAGG - Intronic
1137665994 16:50249509-50249531 GGGCTCAGGGGGAACCCATGAGG - Intronic
1138124068 16:54424331-54424353 CAGCTCTTTGGGAAACCCTGGGG + Intergenic
1138572415 16:57884324-57884346 GAGCTCGGTGGAGACCCCGGGGG + Exonic
1138888761 16:61115005-61115027 TAGCTCTGTGAGACCCACTGTGG + Intergenic
1140012047 16:71143255-71143277 CAGGTCTTTGGGACCCCCTGAGG - Intronic
1140137074 16:72216160-72216182 GGGCTCTGAGGAAACCCCAGGGG + Intergenic
1141874799 16:86816430-86816452 GAGCCCTGTGGCAAGCCATGAGG + Intergenic
1142638558 17:1271971-1271993 GAGCACTGTGGGAGCCCAAGGGG + Intergenic
1142670288 17:1484945-1484967 GCCCTCTGGGGGAACCCCTCTGG - Intronic
1144264419 17:13554553-13554575 CAGCTCAGTGCAAACCCCTGAGG + Intronic
1147925969 17:43946157-43946179 GGGCTCTGTGGCAAGCACTGTGG - Intergenic
1148785663 17:50145007-50145029 CAAGTCTGTGGGAGCCCCTGAGG + Intronic
1150276249 17:63899583-63899605 GAGGACTCTAGGAACCCCTGGGG + Intergenic
1150469402 17:65423953-65423975 AAGCTCTGGGGAAACCCCAGGGG + Intergenic
1151118568 17:71766699-71766721 GATCTCTGGAGTAACCCCTGTGG - Intergenic
1151425486 17:74028528-74028550 GAGATTGTTGGGAACCCCTGAGG - Intergenic
1151786151 17:76275993-76276015 GAGCTCTGTGGGAACCCCTGGGG + Intronic
1153195746 18:2594141-2594163 CAGCGCTTTGGGAAGCCCTGAGG - Intronic
1153553199 18:6284337-6284359 GGGCTCCGTGAGAGCCCCTGTGG - Intronic
1157588629 18:48820991-48821013 CAGCTCTCTGGGAGTCCCTGGGG + Intronic
1159931050 18:74313474-74313496 GAGAAATGTGGGAACCCGTGAGG + Intergenic
1160901376 19:1430320-1430342 TAGCCCTGAGGGAAGCCCTGGGG - Exonic
1160907795 19:1459977-1459999 GGGCACTGGGGGTACCCCTGTGG + Intronic
1160941542 19:1622399-1622421 GAGCTGGGTGGGTACACCTGCGG + Exonic
1161205136 19:3036849-3036871 CAGCTCTCTCAGAACCCCTGTGG + Intronic
1161355843 19:3819264-3819286 GTGGTCTGTGGGGACCCTTGGGG + Intronic
1161388641 19:4009908-4009930 GAGATCTGTGCGAAACGCTGTGG - Intronic
1163511883 19:17740339-17740361 TAGCACTTTGGGAACACCTGAGG + Intergenic
1166942503 19:46375299-46375321 GTGCCCTGTGAGAATCCCTGTGG - Intronic
1167114543 19:47480910-47480932 GAGCCCTGTGGGATTCACTGTGG - Intronic
1167671756 19:50857508-50857530 GAGCTGAGTGGGGACCGCTGGGG - Intronic
925598598 2:5584943-5584965 TATCTATGTGGGAAACCCTGTGG + Intergenic
926126005 2:10272281-10272303 GAGCTCTGTGGGAGCTGCAGTGG - Intergenic
927004904 2:18838080-18838102 GAACTTCATGGGAACCCCTGTGG - Intergenic
928444240 2:31318916-31318938 GTGCTCTGTGGTTTCCCCTGTGG - Intergenic
930736698 2:54787057-54787079 GACCTCAGTGGGCACACCTGAGG - Intronic
933857222 2:86427664-86427686 GAGCTCAGTGAGATCCCCTGAGG + Intergenic
934861538 2:97767599-97767621 GAGCTCTGTAGAGATCCCTGAGG - Intronic
935661271 2:105468885-105468907 CAGTGCTGTGGGAACCGCTGGGG - Intergenic
935686648 2:105689357-105689379 GAGCTCTCTGGGAAAGACTGGGG - Intergenic
936090810 2:109500352-109500374 GAGCTCTGAGTGCACCCCAGGGG - Intronic
937201403 2:120206556-120206578 GAGCTTGGTGGGAAACCCTTGGG + Intergenic
943605205 2:189969236-189969258 CAGCTCTCTGGGACCCCATGAGG - Intronic
945247614 2:207733782-207733804 CAGCTCTATGGGAAACCCAGTGG - Intronic
947858016 2:233337584-233337606 GAGCTCTCTGGGGAGCACTGTGG + Intronic
948541663 2:238695345-238695367 AAGCGCTGTGGAAACCTCTGTGG + Intergenic
948840363 2:240645669-240645691 CAGCCCTGTGGGAACTGCTGGGG + Intergenic
1169236820 20:3936327-3936349 GAGCTCTGTGAGGAATCCTGAGG - Intronic
1169560935 20:6800008-6800030 GAGCTGTGTGGGAAGACCAGGGG - Intergenic
1169949520 20:11027773-11027795 GAGTCCTGTGGGAGGCCCTGGGG + Exonic
1174264235 20:49319684-49319706 GAGCGCTGTGGGTACCACTCTGG - Intergenic
1174538587 20:51271921-51271943 GAGCTCTGGAGGAACCCAAGGGG + Intergenic
1175110988 20:56647774-56647796 GAGGGCTGAGGTAACCCCTGAGG - Intergenic
1175987919 20:62773240-62773262 GTGCTCTGGGCAAACCCCTGCGG + Intergenic
1176268340 20:64222349-64222371 GAGCTCTGCAGGAAGCCCTCGGG + Intronic
1179999407 21:44988246-44988268 GAGGACTTTGGGAAACCCTGGGG - Intergenic
1180041802 21:45283916-45283938 GAGCGCTGTGGGAAACCAGGGGG - Intronic
1180945402 22:19689617-19689639 GGGCCCTGGGGGAGCCCCTGTGG + Intergenic
1181083175 22:20427249-20427271 CAGCTCTGTGGGCAACCCTCAGG + Intronic
1182524659 22:30907716-30907738 CAGCTCTGTAGGAGCCCCAGTGG - Exonic
1183120935 22:35729490-35729512 ATGGTCTGTGGTAACCCCTGGGG + Intergenic
1184109271 22:42385449-42385471 GAGCTGTGGGGGAAGCTCTGAGG - Intronic
1184263932 22:43336532-43336554 GAGCTCACTGGGAGCTCCTGGGG + Intronic
1185050346 22:48551034-48551056 CTGCTCTGAGGGCACCCCTGGGG + Intronic
949760897 3:7469282-7469304 GAGCACTTAGGGAACCCTTGAGG - Intronic
954331923 3:49895807-49895829 GTGCTCTGTGGGACCCCATCTGG + Exonic
954386510 3:50246700-50246722 GGGCTCCGTGGGAACACGTGGGG - Intronic
957079292 3:75623193-75623215 GGGCTCTGTGGACACCCCTTAGG - Intergenic
960974534 3:123161633-123161655 GACATCTGTGGCAACCCCTTGGG - Intronic
962462662 3:135628910-135628932 GAGCACTTTGGGAAGACCTGTGG - Intergenic
962875453 3:139532695-139532717 AAGCTCTGTGGGAGACCTTGGGG + Intronic
963044186 3:141090530-141090552 GAGCTATGTGGGTATCTCTGGGG + Intronic
963064860 3:141255672-141255694 GAGCTCTGCGCCTACCCCTGGGG - Intronic
963761727 3:149291856-149291878 GGGCTGTCTCGGAACCCCTGAGG - Intergenic
964434111 3:156634334-156634356 GAGGTGTTGGGGAACCCCTGTGG - Intergenic
966264112 3:178017049-178017071 AATCTTTGTGGGATCCCCTGTGG + Intergenic
967041570 3:185698195-185698217 AAGCTTTGTGGGAAACACTGAGG + Intronic
969022376 4:4147147-4147169 GGGCTCTGTGGACACCCCTTAGG - Intergenic
969731495 4:8960245-8960267 GGGCTCTGTGGACACCCCTTAGG + Intergenic
969791098 4:9494353-9494375 GGGCTCTGTGGACACCCCTTAGG + Intergenic
970060232 4:12025323-12025345 GAATTCACTGGGAACCCCTGTGG - Intergenic
971473253 4:27049672-27049694 GAGGTCTGTGGGAAATTCTGAGG + Intergenic
972326903 4:38025398-38025420 TAGCTGTGTGAGAATCCCTGGGG + Intronic
972731139 4:41796609-41796631 GAAGTCTGTGGGAATTCCTGAGG + Intergenic
973316686 4:48767916-48767938 GATCTCTGAGGGCACCGCTGGGG - Intronic
976522898 4:86050457-86050479 GAGCACAGTGGAAACCACTGTGG - Intronic
981713682 4:147732589-147732611 CAGCTCTCTCGGAACCCCGGGGG + Intronic
982539079 4:156645000-156645022 GAGAACGGTGGGAACCCCGGAGG - Intergenic
983889903 4:173019994-173020016 GAGCTGTCAGGGAAACCCTGTGG - Intronic
985853941 5:2410632-2410654 GAGCTCAGTGAGCACCACTGGGG - Intergenic
986288140 5:6376113-6376135 GTGCTCAGTGGGCACCACTGAGG - Intronic
986397934 5:7348770-7348792 AAGCCCTGGGGGAACCTCTGTGG + Intergenic
986465862 5:8023389-8023411 AAGCTCTTTGTGAACCTCTGTGG + Intergenic
986866082 5:11989333-11989355 GAGCTTAGAGGGAAGCCCTGAGG + Intergenic
988555922 5:32235949-32235971 GAGCCCTGTGTGAGACCCTGGGG - Intronic
992415040 5:76544287-76544309 GTGGGCTGTAGGAACCCCTGGGG - Intronic
997422277 5:133779033-133779055 GACCTCTGTGGGACCACCAGTGG + Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002641450 5:180632440-180632462 GAGCCCTGTGAGAAGACCTGGGG - Intronic
1003149416 6:3536280-3536302 CAGCTCTGTGGGAGCCCCCTTGG + Intergenic
1003855210 6:10266787-10266809 GAGGTCTGTGGGAGCCTCTCAGG + Intergenic
1005250870 6:23944597-23944619 GATGTCTGTGGGAACACCTAGGG - Intergenic
1005432016 6:25768389-25768411 GAGCTCTGGGGATATCCCTGTGG - Intronic
1006365691 6:33613892-33613914 GAATTCTCTGGGAACCCCAGCGG + Intergenic
1007064778 6:38978691-38978713 CAGCTCTGTGGGAACTGCTGAGG + Intronic
1007410844 6:41660398-41660420 GGGCTCTGTGGCAGACCCTGGGG - Intergenic
1007514980 6:42403936-42403958 GGGCTCTGTGGCAAGGCCTGGGG - Intronic
1007756254 6:44101626-44101648 GACCCCTGGGGGGACCCCTGGGG - Intergenic
1009624067 6:66114502-66114524 TGGCTGAGTGGGAACCCCTGGGG + Intergenic
1015152475 6:130055194-130055216 GTGCTCTCTGCGAACCCCTCAGG - Exonic
1019900092 7:4013770-4013792 GAGCTATTTGTGTACCCCTGGGG - Intronic
1019985321 7:4651141-4651163 GAGCTCTTTGGGGTCCCCAGTGG - Intergenic
1022315993 7:29246250-29246272 GAGATCTCTGGGAACCTCTCCGG - Intronic
1024045508 7:45582829-45582851 GAGGTGTGGGGGAATCCCTGGGG + Intronic
1024196800 7:47067095-47067117 GGGCTCTGTGTGCAGCCCTGTGG - Intergenic
1026894785 7:74003684-74003706 GAGCTCTGGGGACACCCCAGTGG - Intergenic
1028156471 7:87435467-87435489 GAGCTGTGTGAGATCCCTTGAGG - Intronic
1033458576 7:141524879-141524901 GAGCTCTGTGGCAGCAACTGGGG - Intergenic
1034086599 7:148328056-148328078 GAGCTCTGAGGAAACCTCTAAGG + Intronic
1034679781 7:152919866-152919888 GAGACCTGAGGGGACCCCTGGGG - Intergenic
1037812483 8:22095251-22095273 GAAATCTGTGGGACCCTCTGAGG + Intronic
1038494707 8:27993065-27993087 GAGTTCCGTGGAACCCCCTGGGG - Intergenic
1039713760 8:40086797-40086819 GAGCTCTGTGGGAAAGAGTGAGG + Intergenic
1040513868 8:48118874-48118896 GGGATCTTTGGGAACTCCTGGGG + Intergenic
1041744711 8:61196169-61196191 GAGCTCTGTGTTAGACCCTGAGG + Intronic
1045903962 8:107320342-107320364 GAGCTCTGTGAGAATCACTAGGG + Intronic
1048510772 8:135060281-135060303 GATCTCTGTGGGAGTCACTGGGG + Intergenic
1049311435 8:141935884-141935906 GAGCCTCGTGGGAACTCCTGGGG + Intergenic
1049653499 8:143787712-143787734 TTGCTCTGTGGGAACGCCGGCGG + Intergenic
1052782742 9:32797420-32797442 GAGATCTGAGGGAACCCAAGTGG + Intergenic
1053651892 9:40177470-40177492 CAGCTGTGAGGGAGCCCCTGGGG - Intergenic
1053902285 9:42806783-42806805 TAGCTGTGAGGGAGCCCCTGGGG - Intergenic
1054532693 9:66198736-66198758 CAGCTGTGAGGGAGCCCCTGGGG + Intergenic
1056507553 9:87271401-87271423 GTGTTCTGTGGGAAACCCTCAGG - Intergenic
1057843799 9:98506633-98506655 GTGCTCTGGGGGCACCCCTGTGG + Intronic
1058645925 9:107131440-107131462 CAGCTGTGTGGGAAGCACTGGGG + Intergenic
1059436681 9:114281439-114281461 GATCTCTTTGGGAAGCCCTGTGG + Intronic
1059640005 9:116207089-116207111 GGGCTCTGTGAGAACTCCTTGGG + Intronic
1061582429 9:131546041-131546063 GAGCTCTGGGGGCGCCCCTGCGG + Intergenic
1061908163 9:133709236-133709258 GAGCTCTGTGGCTGCACCTGCGG + Intronic
1062001233 9:134216761-134216783 GAGGGCTGTGGGAGGCCCTGGGG - Intergenic
1062525232 9:136975602-136975624 GAGATCCCTGGGAACCCCTCTGG + Intergenic
1203665882 Un_KI270754v1:20459-20481 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203667031 Un_KI270754v1:26098-26120 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203668179 Un_KI270754v1:31737-31759 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1185769417 X:2754186-2754208 GAGGTTTGTTCGAACCCCTGGGG - Intronic
1187506107 X:19879854-19879876 CTGCTCTGGGGGAACCCCGGGGG - Intronic
1189416230 X:40816739-40816761 GAGATCTGGAGGATCCCCTGGGG + Intergenic
1189504217 X:41594750-41594772 AAGCTATGTGGTAACCCCTGGGG + Intronic
1192112947 X:68383722-68383744 GAGCTCTCTGGGGATCCCTAGGG - Intronic
1193098101 X:77576724-77576746 GAGCACTCTGGGAAGCCCCGTGG + Intronic
1196828515 X:119758882-119758904 GAGCGCTGCGGGAACTGCTGGGG + Exonic
1198425381 X:136514261-136514283 GGGCTCTTTGTGAAGCCCTGAGG + Intergenic
1200813024 Y:7504096-7504118 GAGCTATTTGTGAAGCCCTGTGG - Intergenic
1201301088 Y:12505442-12505464 GAGGTTTGTTCGAACCCCTGGGG + Intergenic