ID: 1151789290

View in Genome Browser
Species Human (GRCh38)
Location 17:76293894-76293916
Sequence CAGGCTCTGGATTCTGCCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151789290_1151789295 25 Left 1151789290 17:76293894-76293916 CCACTGGCAGAATCCAGAGCCTG 0: 1
1: 0
2: 1
3: 23
4: 246
Right 1151789295 17:76293942-76293964 TCTCCGCTTAGAGTCCCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 85
1151789290_1151789294 -3 Left 1151789290 17:76293894-76293916 CCACTGGCAGAATCCAGAGCCTG 0: 1
1: 0
2: 1
3: 23
4: 246
Right 1151789294 17:76293914-76293936 CTGCTCAATACTTGGTTGCTTGG 0: 1
1: 0
2: 1
3: 12
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151789290 Original CRISPR CAGGCTCTGGATTCTGCCAG TGG (reversed) Exonic
900365779 1:2311427-2311449 CAGTCTCAGGGTCCTGCCAGCGG - Intergenic
902604915 1:17563768-17563790 CCGGCTCTGGAGTCAGACAGTGG - Intronic
902704870 1:18197652-18197674 CAGGCTCTGGAGGCAGCCTGTGG + Intronic
902955346 1:19921424-19921446 CAAGCTCTGGATTCTACCCAGGG - Intronic
903190528 1:21653302-21653324 CAGGCTCTGAACCCTGCAAGGGG - Intronic
904402099 1:30263643-30263665 CAGGCTCTGTCCTCTGTCAGTGG + Intergenic
905474727 1:38217927-38217949 CAGGCTGTTGATTCTGCAGGAGG + Intergenic
905772744 1:40648943-40648965 CAGGCACTGGCCTCTGACAGGGG - Intronic
907769820 1:57449919-57449941 CAGGCTCTGTATCCAGCCACTGG + Intronic
909169200 1:72273024-72273046 CAGGTTCTGAATTCTGACAGAGG - Intronic
909600790 1:77459064-77459086 CAGCCTCTGGATTCCCTCAGAGG + Intronic
910391845 1:86753854-86753876 CAGGTCCTGGAATCTGTCAGGGG + Intergenic
912443267 1:109714636-109714658 CAGCCTCTGGATCCAGACAGGGG - Intronic
913413991 1:118584563-118584585 CAGGGTCTGGAGTCTGTAAGGGG - Intergenic
914508576 1:148310216-148310238 CAGGATCCGGATTCTTCCCGCGG + Intergenic
914802404 1:150971282-150971304 CAGGCTCTGTCTTCAGTCAGTGG - Intronic
915396849 1:155591236-155591258 CAGGATCTGCATTCTGGCAGAGG + Intergenic
915773916 1:158461683-158461705 CAGGCTCTGATTTGTGGCAGTGG + Intergenic
916817054 1:168364364-168364386 CAGGCTCTGGAGTCAGACAAAGG - Intergenic
916989309 1:170225493-170225515 CAGACTCCGGAGTCTGACAGTGG - Intergenic
917846119 1:179021937-179021959 CGGGCTGTGGATTCTGAAAGTGG - Intergenic
917977233 1:180248044-180248066 CAGGCTGTGGATTCTGGCTTGGG - Intronic
918149061 1:181782636-181782658 CAGGCTGGTGGTTCTGCCAGAGG + Intronic
919892989 1:201989633-201989655 AAGGCTCTGGACTCAGACAGAGG - Intronic
921861501 1:220046582-220046604 CAGGCTCTGGAACCTGCGGGCGG - Exonic
922425465 1:225488325-225488347 AAGGTTCTGAAATCTGCCAGAGG + Exonic
922471693 1:225881167-225881189 CTGCCTCTGGTTTCAGCCAGGGG - Intronic
924370857 1:243348428-243348450 CACATTCAGGATTCTGCCAGGGG + Intronic
1063494559 10:6494985-6495007 CAGGTTCTGGCTTCTGCCCGAGG - Intronic
1067055086 10:43045446-43045468 CAGGCCCTGGATGCTGCCGGGGG - Intergenic
1071738568 10:88330280-88330302 CGTGCTTTGGTTTCTGCCAGAGG + Intronic
1073538360 10:104297913-104297935 CAGGCTCTGAAGTCTGCGGGAGG - Intronic
1073583486 10:104687749-104687771 CAGGCTCTGGAGTCTGACTCTGG + Intronic
1073610603 10:104939126-104939148 TAGACTCTGGATTTTGGCAGAGG - Intronic
1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG + Intronic
1078514956 11:12014149-12014171 CAGGCTGTGGCTTCAGCGAGTGG + Intergenic
1078527974 11:12114943-12114965 CAAGCTTTGAATTCTGCCACAGG + Intronic
1080429331 11:32184237-32184259 GAGGCTCTGGACACTCCCAGGGG + Intergenic
1082350626 11:51500970-51500992 CATTCTTTGGATTCTGCAAGTGG + Intergenic
1082366975 11:51739020-51739042 CTGTCTTTGGATTCTGCAAGTGG + Intergenic
1082368959 11:51767918-51767940 CTGTCTTTGGATTCTGCAAGTGG + Intergenic
1082406304 11:52310343-52310365 CTTTCTTTGGATTCTGCCAGTGG + Intergenic
1082425613 11:52589375-52589397 CTTTCTTTGGATTCTGCCAGTGG + Intergenic
1082453079 11:52986311-52986333 CATTCTTTGGATTCTGCAAGTGG + Intergenic
1082454166 11:53002463-53002485 CTTTCTTTGGATTCTGCCAGTGG + Intergenic
1082468790 11:53214137-53214159 CATTCTTTGGATTCTGCAAGTGG + Intergenic
1082486125 11:53464284-53464306 CATTCTTTGGATTCTGCAAGTGG + Intergenic
1082519207 11:53942201-53942223 CATTCTTTGGATTCTGCAAGTGG + Intergenic
1082537965 11:54213588-54213610 CTTTCTCTGGATTCTGCAAGTGG + Intergenic
1082542383 11:54277523-54277545 CTTTCTTTGGATTCTGCCAGTGG + Intergenic
1082543787 11:54297933-54297955 CTTTCTTTGGATTCTGCCAGTGG + Intergenic
1082758594 11:57103682-57103704 CAGCCTCAGGTTTCTTCCAGAGG - Intergenic
1083793164 11:64999064-64999086 CAGACCCTGGCTTCTGGCAGAGG + Intergenic
1087842722 11:102936525-102936547 CAAGTTCTGGTTCCTGCCAGAGG - Intergenic
1089052684 11:115559303-115559325 CAGGCTCAGGATCTTCCCAGAGG - Intergenic
1089167079 11:116485578-116485600 GAGGCTTTGGACTTTGCCAGAGG - Intergenic
1089613596 11:119683085-119683107 CAAGCCCTGGACCCTGCCAGTGG - Intronic
1090385813 11:126356931-126356953 CTGGCCCTGGCATCTGCCAGGGG + Intronic
1092877884 12:12864341-12864363 CAGGCTCTGCATGGTGCCACAGG + Intergenic
1096408708 12:51362080-51362102 GAGGCTCTGGCCTCTCCCAGGGG + Intronic
1098356559 12:69617871-69617893 AAGGCCCAGGATTCTGCCTGTGG - Intergenic
1101986808 12:109453529-109453551 CAGTCTCTGGTTGCTGCCACAGG - Intronic
1103381613 12:120497995-120498017 CAGGCTCTGGCTTATCCAAGAGG + Intronic
1103532424 12:121611628-121611650 GTGGCTCTGGCTTCTGCCTGAGG + Intergenic
1104926246 12:132315450-132315472 CGGGGTCTGAATTCTGCAAGGGG - Intronic
1106080385 13:26495829-26495851 CAAGCTCTGGATTCTGCTCCTGG - Intergenic
1110278445 13:73664301-73664323 AAGGTCCTGAATTCTGCCAGTGG - Intergenic
1111764802 13:92514635-92514657 CAGGCTCTGGATTGGGCAAATGG - Intronic
1112015203 13:95325737-95325759 CTGGCTCTGGATACTTTCAGTGG + Intergenic
1113158410 13:107351886-107351908 CCGCTTCTGGTTTCTGCCAGTGG - Intronic
1114187431 14:20413441-20413463 TTCGCTCTGGATTCTGCCGGTGG + Intergenic
1115899637 14:38130142-38130164 CAGGCTCTGAAAACTGTCAGAGG + Intergenic
1116050746 14:39800649-39800671 CAGCCTCTGTATTCTCCCACTGG + Intergenic
1116272488 14:42789323-42789345 CACACTCTGGAGCCTGCCAGAGG - Intergenic
1116484977 14:45436751-45436773 CAGACTGTGGGTTCTGCAAGGGG + Intergenic
1117071715 14:52063405-52063427 CAGGCTCTGGTTTCTGCAGAGGG - Intronic
1118714225 14:68547946-68547968 TTTGCTCTGGATTCTTCCAGTGG - Intronic
1119808994 14:77500400-77500422 CTGGGTCTGGATTCGGCCATGGG + Intergenic
1120775391 14:88430232-88430254 CAGGCTCTGGCTTCTCCCTCAGG + Intronic
1121840798 14:97132184-97132206 CATGGTCTGAATTCTCCCAGGGG + Intergenic
1122811009 14:104287881-104287903 CTGGCTCTGGAAGCTGCCATGGG - Intergenic
1122918634 14:104870532-104870554 CTGACTCTGGCTTCTTCCAGAGG - Intronic
1123049001 14:105531660-105531682 CCGGCACTGGCTTCAGCCAGGGG - Intergenic
1126388556 15:48120374-48120396 TAGGCTGTGCTTTCTGCCAGAGG - Intergenic
1126406331 15:48326459-48326481 CATACTCTGAATTATGCCAGTGG - Intergenic
1128933275 15:71724741-71724763 CTGGCCCTGGATTATGACAGTGG + Intronic
1129387354 15:75203110-75203132 CAGCATCTGGATTCTCCCGGAGG - Intronic
1132463883 16:68744-68766 CAGGCTCTGCAGGCAGCCAGAGG - Intronic
1133032097 16:3015995-3016017 CAGGATCTGCATTCCGGCAGAGG + Exonic
1133276038 16:4638982-4639004 CAGGCTCTGGAGTCTGCCCAGGG + Intronic
1133478642 16:6148004-6148026 CAGCCTTTGGCTTCTGCCAAAGG - Intronic
1133697389 16:8277829-8277851 CAGGCTCTGCAAACAGCCAGTGG - Intergenic
1135564159 16:23499069-23499091 AAGGCTCTGGATTCTGTGAGGGG - Intronic
1135772687 16:25229228-25229250 CAGACCCTGGACTCTGCCTGGGG - Intergenic
1135815163 16:25625883-25625905 CTGACTCTGGGTTCTGCCTGTGG + Intergenic
1136237467 16:28923853-28923875 GAGTCTCTGGCTTCTGCTAGAGG + Intronic
1136629760 16:31483085-31483107 CAGCCCCTGGATTCCCCCAGGGG - Intronic
1137060188 16:35786584-35786606 CTGGATCTGGATTCTCACAGGGG + Intergenic
1139571268 16:67814178-67814200 CAGGCTCTGGGTGCTGCCTCCGG - Intronic
1139659348 16:68410262-68410284 CAGGCTCCAGATGCTCCCAGGGG + Intronic
1142199519 16:88754438-88754460 CAGGAACTGGATCCTGGCAGGGG - Intronic
1142290341 16:89191377-89191399 CTGGGTCTGGATCCGGCCAGTGG - Exonic
1142497499 17:314168-314190 CAGGCCCTGGACTGTCCCAGGGG + Intronic
1143003198 17:3808659-3808681 CAGGCCAGGGATACTGCCAGAGG + Intergenic
1143015250 17:3888185-3888207 CAGCCTGTGGCTTCTGCCTGTGG - Intronic
1143336948 17:6178590-6178612 CAGGCTGTGGACTCTGTTAGAGG - Intergenic
1143854572 17:9839245-9839267 AAGGGTCTGGATTCTGGCAAGGG + Intronic
1144946053 17:18970105-18970127 CAGGCTCTGTATTCAGACCGAGG - Exonic
1146059250 17:29595940-29595962 CAGGCTCTGTTTTCTGCAAGGGG + Intronic
1146476488 17:33166711-33166733 CAGGTTCTGGGCTCTGCCTGTGG - Intronic
1147532847 17:41296119-41296141 CAGCATCTGGATTCTCCCAGAGG - Intergenic
1148385070 17:47228381-47228403 GAGGCTCTGGCCTCTGTCAGGGG - Intergenic
1150325543 17:64253746-64253768 CAGCCTGTGCTTTCTGCCAGAGG - Intronic
1150610149 17:66727149-66727171 CAGGCTCTTGATACTGCCACGGG + Intronic
1151224685 17:72639811-72639833 AAGTGTCTGGACTCTGCCAGTGG - Intergenic
1151789290 17:76293894-76293916 CAGGCTCTGGATTCTGCCAGTGG - Exonic
1152754259 17:82080562-82080584 CAGGCTGTGGATGCTGTCAAGGG + Exonic
1155686574 18:28559791-28559813 CATGCTCTGCTTTCTGCCTGTGG - Intergenic
1156477650 18:37416341-37416363 CAGGAGCTGGGTTCTGACAGGGG - Intronic
1157193533 18:45600964-45600986 CATGCTCTGTATTCTGCCCAGGG + Intronic
1157633568 18:49126205-49126227 CATGCTCTGGATCCTCCCATTGG + Intronic
1160039835 18:75335348-75335370 CAGGCGATGGATTCTGCCCTGGG + Intergenic
1160509640 18:79446101-79446123 CAGGTTCTGTACTGTGCCAGAGG + Intronic
1163133241 19:15289812-15289834 CAGCCTCTGGGTTCTGCCCACGG + Intronic
1164521768 19:28985112-28985134 CAGGCGCTGGATGCTGACAGTGG - Intergenic
1165307497 19:35011527-35011549 CAAGCAGTGCATTCTGCCAGAGG - Exonic
1166091983 19:40515301-40515323 CAGGCTCTCGAATCTGCAGGAGG - Exonic
1167160898 19:47766468-47766490 AAGGGTGTGGATTCTGGCAGTGG + Intergenic
925939390 2:8801511-8801533 CAGGCTGTAAATTCTTCCAGAGG - Intronic
926699697 2:15795561-15795583 CAGGCCCTGGCTGCAGCCAGCGG + Intergenic
929807700 2:45161754-45161776 CAAGCTTTGGCTTCTCCCAGGGG + Intergenic
932700224 2:73986390-73986412 CTGGCTCATGATGCTGCCAGAGG - Exonic
933554217 2:83811429-83811451 CAGCCACTGGATTTTGCCAGTGG - Intergenic
933994905 2:87661113-87661135 CAGGATCTGGAAGCTTCCAGTGG - Intergenic
936298953 2:111289800-111289822 CAGGATCTGGAAGCTTCCAGTGG + Intergenic
937080933 2:119139243-119139265 TGGGCTGTGGATTCTGCCATGGG + Intergenic
937152206 2:119693539-119693561 CAGCCTCTGGATCTTGCCTGTGG - Intergenic
937480428 2:122252605-122252627 CAAGCTTTGGATTCTGACAGTGG + Intergenic
937591134 2:123614623-123614645 CAAGCTCTGAATTCTGGGAGGGG - Intergenic
938114610 2:128594758-128594780 CTGGCCCTGGGTTCTGACAGGGG + Intergenic
938364924 2:130727103-130727125 CAGGCTCTGTATCATCCCAGCGG + Intergenic
939170551 2:138690169-138690191 GAGGCTCTGGGTTGAGCCAGTGG - Intronic
939861171 2:147422318-147422340 AAGGGTCTAGATTCTTCCAGAGG + Intergenic
941463475 2:165798327-165798349 CTGGCTCTAAATTCTGACAGTGG + Intergenic
944412486 2:199457913-199457935 CCGGCTCTGGCTGCTGGCAGAGG - Exonic
946759410 2:222978203-222978225 ATTGCTCTGGATTCTGACAGTGG + Intergenic
947088094 2:226478288-226478310 CATGCTTTAGATTCTGCCTGTGG + Intergenic
947173245 2:227334271-227334293 CAGGATCTGGCTCCTGCCACAGG - Intronic
948864197 2:240767209-240767231 CAGGCCCTGGGATCTGGCAGGGG - Intronic
1170153774 20:13251267-13251289 CAGGCATTGAATTCTGGCAGTGG + Intronic
1170605633 20:17873558-17873580 CAGGATCTGGAATCAGCCATGGG - Intergenic
1171238755 20:23548362-23548384 CAGGCTCTGGATTAGGGGAGGGG + Intergenic
1171242850 20:23585876-23585898 CAGGCTCTGGATTAGGGGAGGGG - Intergenic
1172008715 20:31834145-31834167 CAGGCTAAGGACTCTCCCAGTGG - Exonic
1172603510 20:36199657-36199679 CAGGGTCTTGCTTGTGCCAGAGG - Intronic
1173146402 20:40528381-40528403 CAGGCCCTGGAGCCTGCCTGAGG - Intergenic
1174326352 20:49781823-49781845 CTGGCTCTGGGTTCTGCCTTGGG + Intergenic
1174854193 20:54027503-54027525 CTGGCTCTGAAGTCTGCTAGTGG + Intronic
1177950909 21:27535689-27535711 CTGGCTCTGGATGCTTTCAGTGG - Intergenic
1179516505 21:41912022-41912044 TAGGTTCTGGATTCAGTCAGAGG + Intronic
1179646560 21:42779520-42779542 CAGGCCCTGGACCCTGCCTGAGG - Intergenic
1181236027 22:21448155-21448177 CAGGCACTGGGTGCTGACAGGGG + Exonic
1181643631 22:24218463-24218485 CTGTCTCTGGTCTCTGCCAGAGG + Intergenic
1184244534 22:43229115-43229137 CAGGCACTGGAAGCTGCCCGGGG + Exonic
1184469946 22:44690770-44690792 CAGGCTCTGCCCTCTGCCTGGGG - Intronic
1184981182 22:48097001-48097023 CAGGCTCTGGGTCCTGCCTGAGG + Intergenic
1184996455 22:48210736-48210758 AAGGCTCTGACTTCTGGCAGAGG - Intergenic
1185242513 22:49754307-49754329 CAGGCTCTGAGAGCTGCCAGAGG - Intergenic
949485436 3:4533327-4533349 CAGGCTCTGGAGTCAGTCATGGG + Intronic
951137925 3:19125958-19125980 CAGACACTGGGTCCTGCCAGAGG + Intergenic
953018899 3:39101327-39101349 CAGGCTCTGGAATCTGACCCCGG + Intronic
953448254 3:42985758-42985780 GAGGATCTGGATTCTGTCAAGGG + Intronic
953918008 3:46932948-46932970 CAGGGTGTGGATTCTGCCTCCGG - Intronic
954752363 3:52820866-52820888 CAAGCTCCAGATTCTCCCAGAGG - Intronic
955073055 3:55588087-55588109 CAGGCTCTGGGTTCAGCCTAGGG - Intronic
955246589 3:57230168-57230190 AAGGCTTTGCATTCTGCCACAGG - Intronic
956027246 3:64996371-64996393 TAGGCTATAGATTTTGCCAGTGG - Intergenic
958762833 3:98329045-98329067 CAGGCCCTGCTTTCTCCCAGGGG - Intergenic
959827076 3:110810728-110810750 CAGGCTCTGGAATCATACAGAGG - Intergenic
961207676 3:125099134-125099156 AAGGCTCTGCTCTCTGCCAGTGG - Intronic
961633075 3:128315542-128315564 CAGGCCCTGGCTTCTGGCAGAGG - Intronic
962372849 3:134835108-134835130 CAGGTTCTCAATTCTGTCAGAGG + Intronic
964358364 3:155870597-155870619 CGGGCTCTGGCTCCTCCCAGTGG + Exonic
967159453 3:186722596-186722618 CAGGCTCTGCTTGCTCCCAGAGG + Intronic
968597538 4:1493158-1493180 CAGGCTCTGGCGTGTGGCAGCGG - Intergenic
969032528 4:4226398-4226420 CAGCCTCAGGATGCAGCCAGCGG + Intronic
969205777 4:5644132-5644154 CATGTTCTGGATTTGGCCAGTGG + Intronic
969410358 4:7024243-7024265 CAGGCACTGGACTCGGCCTGAGG - Intronic
969995899 4:11312873-11312895 CAGGCTCTGGATTAAGAGAGTGG - Intergenic
973206243 4:47563654-47563676 CAAGATCTGGATGCTGACAGGGG + Exonic
973987797 4:56372375-56372397 CAGAATAAGGATTCTGCCAGAGG - Intronic
977531000 4:98200445-98200467 TAGGCTCCTGATTATGCCAGGGG - Intergenic
979274253 4:118797106-118797128 CAGTGTCAGGATGCTGCCAGTGG - Intronic
983240499 4:165226830-165226852 GAGGCTCTGGAGTCAGCCTGTGG + Intronic
986272649 5:6247259-6247281 CTGGCTTTGGAGTCAGCCAGAGG + Intergenic
986349293 5:6862423-6862445 CAGGCACTGGAATCATCCAGAGG + Intergenic
987010309 5:13756131-13756153 AAGGCACTGGATTCTGCATGGGG + Intronic
987672967 5:21036973-21036995 CAGGCTCTGCCTTCTCCCAGTGG - Intergenic
990548087 5:56843634-56843656 CAGACTCTGGCCTCTGCTAGTGG + Intronic
992366272 5:76093329-76093351 CAGAGTCTTGCTTCTGCCAGTGG + Intronic
995060081 5:107803975-107803997 CAGTCTCTGGATTAAGCCAGAGG + Intergenic
997865876 5:137462310-137462332 CAGGCTCTGGCTGCTGCCAGAGG - Intronic
997977076 5:138446778-138446800 CAGAGGCTGGGTTCTGCCAGGGG - Exonic
999319106 5:150602224-150602246 CAGGCTCTGGGTTCTGGTGGTGG + Intronic
1000337957 5:160255456-160255478 CAGACTCTGGAAACTGCCCGTGG + Intronic
1001201524 5:169721980-169722002 CAGGTTCTAGCTTCTGCCACAGG + Intronic
1001329296 5:170751166-170751188 CAGGCTCAGGACTCGCCCAGAGG + Intergenic
1002448148 5:179302604-179302626 CAGGGTCTGCATTCAGCCACAGG - Intronic
1003118896 6:3304163-3304185 CAGGCTCTGGTCTGTGCCTGTGG - Intronic
1003398830 6:5775208-5775230 CAGGGTCTTGATGCTCCCAGCGG + Intergenic
1004275741 6:14233713-14233735 CAGTCTGTGTATTCTGCCTGGGG - Intergenic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006105492 6:31713822-31713844 CAGGCTCAGGAATCTGGGAGAGG + Exonic
1007489742 6:42210022-42210044 CAGGACCTGGATTCTGGCATTGG + Intronic
1007664208 6:43505055-43505077 CACTCTCTGGGTACTGCCAGGGG + Exonic
1007706898 6:43796596-43796618 CAGGCTCTGGAAACTTCCAGTGG + Intergenic
1011745531 6:90404182-90404204 CTGTATCTGGATTCTGGCAGCGG + Intergenic
1011774140 6:90709069-90709091 CAGACTCTGTAGTCTGCCAAAGG + Intergenic
1016849193 6:148600013-148600035 CAAACTCTGGAATCAGCCAGTGG + Intergenic
1017001275 6:149999390-149999412 CAGGATCTGGAGTGTGCAAGAGG + Intergenic
1017934623 6:158994191-158994213 CAGACTCAGGAATCTGCCAAAGG + Intronic
1019310718 7:359383-359405 AAGGCTGTGGAATCTGCCCGGGG + Intergenic
1019734086 7:2641901-2641923 CAGGCTCTGCATGCTCGCAGTGG + Intronic
1019891405 7:3950178-3950200 CAGGCTGTGGATTGTGCCTGAGG + Intronic
1020242842 7:6409166-6409188 CTGGCTCTGGGGTCGGCCAGTGG - Exonic
1020270073 7:6589737-6589759 CGGGCTTTGGCTTCGGCCAGCGG - Intergenic
1023230600 7:38023834-38023856 CAGGGTCTGGGTTCTGAGAGGGG - Intronic
1023566625 7:41529746-41529768 AATTATCTGGATTCTGCCAGCGG - Intergenic
1027774266 7:82444252-82444274 CAGGCACTGGATTCTGCGCCTGG - Intergenic
1029252176 7:99244766-99244788 CAGGCTCTAGGTTCAGCCGGGGG - Intergenic
1035274564 7:157739931-157739953 CTGGCTCTGGCTTCTGGAAGAGG - Intronic
1037588138 8:20292145-20292167 CAGGCTGAGGAATCTTCCAGAGG + Intronic
1038516676 8:28193471-28193493 CAGGCCCTGGACTCTGCCTCAGG + Intergenic
1038610649 8:29057637-29057659 CTGACTGTGGTTTCTGCCAGAGG - Intronic
1040812993 8:51477718-51477740 CATGCTCGGGATGCTCCCAGGGG - Intronic
1042091324 8:65162717-65162739 CTGCCTCTGGAGTCTGCCTGCGG - Intergenic
1042281956 8:67064674-67064696 CAGGCTCTGGAATCTGGGGGTGG + Intronic
1044408982 8:91864115-91864137 CAGGATCTGCACTCTACCAGTGG + Intergenic
1044779310 8:95727529-95727551 CTGGCTCTGGGTTCTCCCATTGG + Intergenic
1044999788 8:97869354-97869376 CAGGCTCGGTATTCTGTCGGTGG - Intronic
1047336329 8:123940209-123940231 CATGCTCTGCCTCCTGCCAGAGG - Intronic
1048277050 8:133074608-133074630 CAGGGGCAGGATGCTGCCAGAGG - Intronic
1049175654 8:141190873-141190895 CAGACTGGGGATTTTGCCAGGGG + Intronic
1049181754 8:141226514-141226536 CAGATTCTGGATTCCTCCAGAGG - Intronic
1049391205 8:142372606-142372628 GAGGCTCGGGAATGTGCCAGGGG - Intronic
1050113810 9:2242579-2242601 AAGGCTCTGGCTGCCGCCAGAGG + Intergenic
1051690920 9:19711215-19711237 CATGCAGTGGATTCTTCCAGAGG + Intronic
1052028144 9:23597495-23597517 CAGCTTCTGGATTCTGTCAGTGG + Intergenic
1052801393 9:32971351-32971373 CAGGCTCTGGATTCAGACCTGGG - Intergenic
1052941293 9:34133589-34133611 CATGGTCTGGATGCTGCCATTGG + Intergenic
1057444235 9:95102875-95102897 CAGGCCCTGTGTGCTGCCAGGGG - Intronic
1058167003 9:101631596-101631618 CAGGCTCAGAATTCTGCTGGAGG + Intronic
1058756544 9:108088037-108088059 CAGGATGTGGCTTCTGCCCGAGG - Intergenic
1058905272 9:109477706-109477728 CAGGCTCTGGGTTTGGCCTGGGG + Intronic
1058981976 9:110178487-110178509 CAGCCTCTGGTGTTTGCCAGTGG + Intergenic
1061012893 9:127965853-127965875 CAGCGTCTGGCTCCTGCCAGGGG + Intronic
1061450816 9:130666134-130666156 CAGGCTCTGGGCACTGGCAGAGG - Intronic
1061539728 9:131271655-131271677 ATGGCTCAGGATTCTGCCAAAGG - Intronic
1187241327 X:17516455-17516477 CAGGGTCTGGCTTCTGCAAATGG + Intronic
1187274114 X:17803739-17803761 CACGCTCTGGATCCTGCCAAAGG - Intronic
1187713417 X:22076986-22077008 CAGGCACTGGCTTCTTCCTGTGG - Intronic
1189659137 X:43278578-43278600 CACGGTCTGGATGCTGCCATCGG + Intergenic
1190456898 X:50635587-50635609 CAGGCTCTCCATGCTGCCAATGG + Exonic
1191107845 X:56783264-56783286 CAGTTTCTGGAGACTGCCAGGGG - Intergenic
1191110329 X:56799204-56799226 CAGTCTCTGGGGGCTGCCAGGGG - Intergenic
1191254684 X:58274651-58274673 CAGTCTCTGGCTTCCTCCAGGGG - Intergenic
1192261199 X:69506594-69506616 CACCCTTTGGCTTCTGCCAGTGG + Intronic
1197849345 X:130841045-130841067 CATGTTCTGGATTCTGACAGTGG + Intronic
1199494957 X:148442513-148442535 GAGGCTCTGCATTCTGCCTAAGG + Intergenic