ID: 1151790809

View in Genome Browser
Species Human (GRCh38)
Location 17:76304682-76304704
Sequence GCTCACATGGGACAGATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151790809_1151790812 -6 Left 1151790809 17:76304682-76304704 CCAGTTATCTGTCCCATGTGAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1151790812 17:76304699-76304721 GTGAGCACCCAGCAGAGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 207
1151790809_1151790815 0 Left 1151790809 17:76304682-76304704 CCAGTTATCTGTCCCATGTGAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1151790815 17:76304705-76304727 ACCCAGCAGAGCGCTGGGCAGGG 0: 1
1: 0
2: 2
3: 32
4: 329
1151790809_1151790813 -5 Left 1151790809 17:76304682-76304704 CCAGTTATCTGTCCCATGTGAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1151790813 17:76304700-76304722 TGAGCACCCAGCAGAGCGCTGGG 0: 1
1: 0
2: 0
3: 32
4: 299
1151790809_1151790820 6 Left 1151790809 17:76304682-76304704 CCAGTTATCTGTCCCATGTGAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1151790820 17:76304711-76304733 CAGAGCGCTGGGCAGGGCTGGGG 0: 1
1: 1
2: 11
3: 71
4: 740
1151790809_1151790823 29 Left 1151790809 17:76304682-76304704 CCAGTTATCTGTCCCATGTGAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1151790823 17:76304734-76304756 CAGATTTCCCTCCAACCCTGGGG 0: 1
1: 0
2: 2
3: 17
4: 192
1151790809_1151790814 -1 Left 1151790809 17:76304682-76304704 CCAGTTATCTGTCCCATGTGAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1151790814 17:76304704-76304726 CACCCAGCAGAGCGCTGGGCAGG 0: 1
1: 0
2: 5
3: 45
4: 306
1151790809_1151790822 28 Left 1151790809 17:76304682-76304704 CCAGTTATCTGTCCCATGTGAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1151790822 17:76304733-76304755 GCAGATTTCCCTCCAACCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 137
1151790809_1151790821 27 Left 1151790809 17:76304682-76304704 CCAGTTATCTGTCCCATGTGAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1151790821 17:76304732-76304754 GGCAGATTTCCCTCCAACCCTGG 0: 1
1: 0
2: 0
3: 14
4: 143
1151790809_1151790818 4 Left 1151790809 17:76304682-76304704 CCAGTTATCTGTCCCATGTGAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1151790818 17:76304709-76304731 AGCAGAGCGCTGGGCAGGGCTGG 0: 1
1: 0
2: 9
3: 82
4: 774
1151790809_1151790819 5 Left 1151790809 17:76304682-76304704 CCAGTTATCTGTCCCATGTGAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1151790819 17:76304710-76304732 GCAGAGCGCTGGGCAGGGCTGGG 0: 1
1: 1
2: 6
3: 80
4: 720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151790809 Original CRISPR GCTCACATGGGACAGATAAC TGG (reversed) Intronic
903327825 1:22581391-22581413 GTTCACCTGGGACAAATAATTGG - Intronic
903513925 1:23897233-23897255 AATCACATGGGGCAGAAAACAGG + Intronic
905111057 1:35594880-35594902 GCACACATGAGACAAATACCTGG - Exonic
912833107 1:112971015-112971037 GCTCAGATGGGCTAGATAATGGG + Intergenic
914871122 1:151474867-151474889 GCTCACTTGACACAGATCACGGG + Intergenic
921542550 1:216433959-216433981 GGCCAAATGGGACAGATAACAGG + Intergenic
922003365 1:221503628-221503650 CCTGACCTGGGACAGAGAACAGG + Intergenic
1063663586 10:8049463-8049485 GCTCGCAAGGGAAAGAAAACGGG + Intergenic
1064003274 10:11681060-11681082 CCTCAGATGGGAGAGATCACTGG - Intergenic
1070680873 10:78448206-78448228 GCTCACATGGGTCAGGAACCTGG + Intergenic
1075904160 10:126066012-126066034 GCTCACGTGGGGCAGCTAAGAGG + Intronic
1076514547 10:131036519-131036541 GCTCACCTGGGACAGAAGACAGG - Intergenic
1084700454 11:70783460-70783482 ACTCACATGGCCCAGATACCAGG + Intronic
1084990639 11:72921494-72921516 GCTCACATGGGGGAAACAACAGG - Intronic
1088813977 11:113409336-113409358 CCTGACATGGGACAGAAGACAGG + Intergenic
1092353084 12:7771952-7771974 GCTCTCCTGGGATTGATAACCGG - Intronic
1096334571 12:50743712-50743734 GCTCTTATGGGGCAAATAACAGG + Intronic
1097078828 12:56414377-56414399 CCTCTCATGAGACAGAGAACTGG - Intergenic
1106816314 13:33411263-33411285 GCGTATGTGGGACAGATAACAGG + Intergenic
1108381487 13:49859081-49859103 TCTCACAAGGGACAGAAACCAGG - Intergenic
1114799601 14:25758587-25758609 GATTACATGGTACAGAAAACAGG - Intergenic
1115503392 14:34069523-34069545 GATCACATGTGACAGATGAATGG - Intronic
1116706196 14:48304770-48304792 GCTCTCATTGGACAGAGGACCGG - Intergenic
1119131027 14:72173402-72173424 GCTCTCATGGGCCAGAAAAAGGG - Intronic
1125973448 15:43930747-43930769 CCTCACTTGGGTCAGAGAACTGG + Intronic
1126883047 15:53119772-53119794 ACTCACATGGGACAGATCAGAGG - Intergenic
1126903471 15:53338633-53338655 GCTCAGAAGTCACAGATAACTGG - Intergenic
1137737985 16:50739211-50739233 GATGAGATGGGAAAGATAACTGG - Intergenic
1140700704 16:77579108-77579130 GCTCAGAGAGGACAGAAAACTGG + Intergenic
1142619698 17:1157120-1157142 GCTCAGATAGGTCAGATGACTGG + Intronic
1150410129 17:64935458-64935480 GCTGGCATGGGCCAGACAACTGG + Intergenic
1151790809 17:76304682-76304704 GCTCACATGGGACAGATAACTGG - Intronic
1157014143 18:43689690-43689712 GCTCACATTTGCCAGATAAGAGG + Intergenic
1161456243 19:4371025-4371047 GCTCACAGGTGACAGAGTACAGG - Intronic
1161922503 19:7277111-7277133 GCTCAGATGGGAGACAGAACAGG - Intronic
1161937443 19:7380888-7380910 GATCAGAGGGGACAGATACCTGG - Intronic
1162345604 19:10116358-10116380 GCAGACATGGGACACACAACAGG + Intronic
1163129924 19:15265939-15265961 GCTGACAGGGGACAGAGAGCGGG + Intronic
1167754511 19:51403583-51403605 GCTCCCATGAGGCAGAAAACGGG + Intergenic
929851863 2:45598773-45598795 AATCACATGGGACAGATAACAGG + Intronic
932504492 2:72215596-72215618 GCTTACCTGGGACAGATGATGGG + Intronic
933838381 2:86264451-86264473 GGTCACATGGGAGAGATAAAAGG - Intronic
947324013 2:228955168-228955190 GACCACATGGAACAGATAAAGGG + Intronic
947668302 2:231920677-231920699 CCTAACAGGGGACAGATGACAGG + Intergenic
948132774 2:235612890-235612912 CCTCACATTGGAGAGATAAAAGG - Intronic
1168981636 20:2009004-2009026 GCTCACATTGATCAGATACCTGG + Intergenic
1170476813 20:16723111-16723133 GCTCAGATGGGACTGTCAACTGG - Intergenic
1171994080 20:31718829-31718851 GCTCACTCTGGACTGATAACTGG - Intronic
1172818557 20:37711112-37711134 GATCAGATGGGCCAGATAATGGG - Intronic
1174538142 20:51268695-51268717 GTTCAAATGGGACAGAAAAGTGG + Intergenic
1178080159 21:29055150-29055172 GCTGACTTGGGACAGTTCACAGG - Intergenic
1179121498 21:38550195-38550217 GCCCTCCTGGGACAGGTAACAGG + Intronic
1179995512 21:44972255-44972277 GTTCACATGGGACAGCGACCTGG - Intronic
1183077153 22:35434435-35434457 GCTCCCCTGGGACCGATAAATGG - Intergenic
1183773847 22:39949653-39949675 GCTCAAAGGGGGCAGATGACTGG - Intronic
949802658 3:7920603-7920625 GCTCATATGGAACTCATAACTGG - Intergenic
951631969 3:24731846-24731868 GCTCTCCTAGGACAGATAAATGG - Intergenic
952474849 3:33697838-33697860 GGTCACATGTGACAGAGGACAGG + Intronic
953167178 3:40475940-40475962 AGTCTCATGTGACAGATAACAGG - Intergenic
954754622 3:52832415-52832437 GCACACAGGGGACAGAGGACTGG + Intronic
964980052 3:162667256-162667278 GCTCTCAGGGGATAGATGACTGG + Intergenic
969251200 4:5969970-5969992 GCTCACCTGGGACACAGCACTGG - Intronic
969346210 4:6571778-6571800 GCCCACATGGGGCAGACCACAGG - Intergenic
970592319 4:17570212-17570234 GCTCACATGTGCCTGACAACAGG - Intergenic
975210753 4:71697239-71697261 GCTCACATGGGACAGCCAGAAGG - Intergenic
981074937 4:140581300-140581322 GCTCCCCCGGGACTGATAACTGG + Intergenic
982097374 4:151935253-151935275 GCTCTCTAGGGACAGAAAACTGG + Intergenic
982147158 4:152407520-152407542 GCTAACATTGGAAATATAACAGG - Intronic
982741041 4:159057227-159057249 GCCCAGATGGGACAGTTAGCAGG + Intergenic
985124657 4:186681170-186681192 GCTGAGTTGGGACAGTTAACAGG - Intronic
986021024 5:3802722-3802744 GGTCACATGGGATTGATCACAGG - Intergenic
991012638 5:61899963-61899985 TCTCACAAGGGACACATAAACGG - Intergenic
991127068 5:63081366-63081388 GATCACCTGGGACAGAGAATGGG - Intergenic
992720910 5:79560432-79560454 TCTCACAGGGGACAGATATAAGG - Intergenic
994145305 5:96388117-96388139 GCACACATGGTAGAGAGAACCGG + Intergenic
1004735442 6:18401496-18401518 GCTCACAGGTAACAGGTAACAGG - Intronic
1010094893 6:72031127-72031149 GGTCACATGGGAGTGATCACAGG - Intronic
1018576643 6:165266573-165266595 GCTTACATGTGACAGATCATGGG + Intergenic
1020525222 7:9250987-9251009 GCTCAAATGGCTCAGACAACAGG - Intergenic
1027660787 7:80986112-80986134 GTCCACATGGCACAGATAAAAGG + Intergenic
1030084281 7:105803621-105803643 GCTCTTAGGGGACAGATGACTGG + Intronic
1030638083 7:111972513-111972535 CCTCACATAAGACAGATAAGTGG - Intronic
1031419768 7:121537485-121537507 GCTCACATGGGACACAAGGCAGG - Intergenic
1035832759 8:2715248-2715270 GCTTCCATGGGACCGTTAACTGG - Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037579050 8:20233924-20233946 GCTGAGAAGGGACAGATAAAGGG + Intergenic
1037616101 8:20520204-20520226 GCTCCCATGGGACACAGAATAGG + Intergenic
1042907918 8:73792756-73792778 ACTCACATGGTACTGAGAACTGG + Exonic
1044185346 8:89244006-89244028 GCTCCCATGGGACAAAGAATTGG - Intergenic
1044703570 8:94986784-94986806 GCTCTCATGTGACAGGTAATAGG - Intronic
1047201951 8:122774769-122774791 CCTCACATGGGATATATAGCAGG - Intergenic
1055445007 9:76374011-76374033 GCCTACCTAGGACAGATAACAGG - Intergenic
1057840456 9:98481917-98481939 GCTCTCATGGGTCAGGTAAATGG + Intronic
1057901653 9:98953648-98953670 GGTCACTTGGGAGAGATACCAGG - Intronic
1058329604 9:103742964-103742986 TCTGACAAGGGACAGATAACAGG - Intergenic
1059999499 9:119945245-119945267 GCTCACATGAGACAGAGAAATGG + Intergenic
1185723456 X:2400499-2400521 GCTCACCTGTGACACATGACTGG - Intronic
1185825472 X:3245088-3245110 ACTCACTTTGGACAGATAATGGG + Intergenic
1192559403 X:72115795-72115817 GCTCACATGTTAGAGATACCTGG - Intergenic
1196740922 X:119025176-119025198 GCTCCCATTGGACAGAGAAAAGG + Intergenic
1198331801 X:135629250-135629272 GCTCTCAGGGGAAAGAAAACAGG - Intergenic
1198334455 X:135653091-135653113 GCTCTCAGGGGAAAGAAAACAGG + Intergenic
1199976415 X:152897472-152897494 GCTCACAAGGCACAGCAAACGGG - Intergenic