ID: 1151795957

View in Genome Browser
Species Human (GRCh38)
Location 17:76345931-76345953
Sequence CTGGCTTTGGAGGGAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 1, 2: 4, 3: 50, 4: 550}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151795957_1151795969 11 Left 1151795957 17:76345931-76345953 CCTGCTCCTCCCTCCAAAGCCAG 0: 1
1: 1
2: 4
3: 50
4: 550
Right 1151795969 17:76345965-76345987 AAAAAGGCCACTGCAAAGAAGGG 0: 1
1: 15
2: 18
3: 29
4: 344
1151795957_1151795972 28 Left 1151795957 17:76345931-76345953 CCTGCTCCTCCCTCCAAAGCCAG 0: 1
1: 1
2: 4
3: 50
4: 550
Right 1151795972 17:76345982-76346004 GAAGGGAGAGAAGGTACCCAAGG 0: 1
1: 0
2: 2
3: 37
4: 449
1151795957_1151795973 29 Left 1151795957 17:76345931-76345953 CCTGCTCCTCCCTCCAAAGCCAG 0: 1
1: 1
2: 4
3: 50
4: 550
Right 1151795973 17:76345983-76346005 AAGGGAGAGAAGGTACCCAAGGG 0: 20
1: 12
2: 15
3: 26
4: 307
1151795957_1151795963 -5 Left 1151795957 17:76345931-76345953 CCTGCTCCTCCCTCCAAAGCCAG 0: 1
1: 1
2: 4
3: 50
4: 550
Right 1151795963 17:76345949-76345971 GCCAGAGCCCAGGCCTAAAAAGG 0: 3
1: 16
2: 21
3: 21
4: 229
1151795957_1151795971 19 Left 1151795957 17:76345931-76345953 CCTGCTCCTCCCTCCAAAGCCAG 0: 1
1: 1
2: 4
3: 50
4: 550
Right 1151795971 17:76345973-76345995 CACTGCAAAGAAGGGAGAGAAGG 0: 1
1: 22
2: 14
3: 52
4: 576
1151795957_1151795968 10 Left 1151795957 17:76345931-76345953 CCTGCTCCTCCCTCCAAAGCCAG 0: 1
1: 1
2: 4
3: 50
4: 550
Right 1151795968 17:76345964-76345986 TAAAAAGGCCACTGCAAAGAAGG 0: 1
1: 16
2: 16
3: 47
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151795957 Original CRISPR CTGGCTTTGGAGGGAGGAGC AGG (reversed) Intronic
900269396 1:1779159-1779181 CTGGCAGTGGAGGGAGGACCCGG + Intronic
900529048 1:3143860-3143882 CTGTCTGTGGATGGAGGAGGAGG + Intronic
901165465 1:7218462-7218484 CTGGTTTTTGGGGGAGGGGCGGG + Intronic
901229410 1:7633599-7633621 CTGGCCTTGGCTGGGGGAGCTGG - Intronic
901425584 1:9180774-9180796 CTGGATTGGGAGGGGAGAGCAGG + Intergenic
901466106 1:9422181-9422203 ATGGCTTTGCAGAGAGCAGCCGG - Intergenic
901909125 1:12440353-12440375 ATGGCTGTAGAGGGAAGAGCAGG + Intronic
902217445 1:14943503-14943525 GTGGTTCTTGAGGGAGGAGCAGG + Intronic
902783998 1:18721347-18721369 CTGGCTTGGGGAGGAGGGGCTGG - Intronic
903044679 1:20555762-20555784 GGGGCTTTGGAGGGAAAAGCTGG + Intergenic
903794954 1:25921773-25921795 CTGTCTCTGGAGAGAGGGGCGGG - Intergenic
904371445 1:30050026-30050048 CTGGGGTTGGAGGGGTGAGCAGG - Intergenic
904470268 1:30731720-30731742 ATGGCATTGGGGAGAGGAGCTGG - Intergenic
904651558 1:32009755-32009777 CTTGTTTTGGGGGGAGGAGGAGG - Intergenic
904826058 1:33274545-33274567 GTGCCTGTGGATGGAGGAGCAGG + Intronic
905022317 1:34826439-34826461 CCTGCTTTGGATGGAGGAGGGGG - Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905291465 1:36924478-36924500 CTGGCTGTGGAGAGGGGAGGGGG + Intronic
905451421 1:38059290-38059312 CTGCCTTGGGAGGGCAGAGCAGG + Intergenic
906141127 1:43534086-43534108 CTAGGTTTGGAGGGATGAGTAGG + Intronic
906294471 1:44640904-44640926 CTGGTTTTGTTGGGAGCAGCAGG + Intronic
906553480 1:46687436-46687458 TTGGCTTTGAAGGGTGGAGTTGG - Intronic
907120700 1:52005652-52005674 CTTGCTCTGGAGGGAGGGGGTGG - Intergenic
907438610 1:54464891-54464913 CTGACTATGCAGGGAGGAGAGGG - Intergenic
907459319 1:54595965-54595987 CTGGGCTTGGAGGCCGGAGCTGG + Intronic
907587722 1:55636025-55636047 CTGGCTATAGAAGGAGGAGCAGG - Intergenic
910094469 1:83505251-83505273 ATGGCTCTGGAAGGAGGAGGAGG - Intergenic
910635618 1:89404808-89404830 CAGCTTTTGGAGGAAGGAGCAGG - Intergenic
910832829 1:91477786-91477808 CTGGCTTTGGAGGTAGAGGAAGG + Intergenic
910876759 1:91885718-91885740 CGGCCTTGGGAGGGAGGCGCTGG - Intronic
910984199 1:92989773-92989795 CTGTCTTGGGAGGGAAGACCGGG - Intergenic
911648137 1:100357091-100357113 TTGGCTTTGGTGGGAAGATCAGG + Intronic
912499978 1:110115177-110115199 CTGCTTTTGAAGGGAGGAACAGG - Intergenic
912692636 1:111815920-111815942 CTGGCAGTGGAGGTAGGGGCTGG - Intronic
913228644 1:116722261-116722283 CTGGCTTAGAAGGTAGGAGTTGG - Intergenic
913304226 1:117408044-117408066 CTGGCTCTGGAGCCAGGAGAGGG + Intronic
913331793 1:117673870-117673892 CTGTCTGTGGAGGGAAGAGATGG - Intergenic
913968367 1:143395181-143395203 CTGTCCTTGGAGGTAGGATCTGG + Intergenic
913973147 1:143431922-143431944 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914062745 1:144220777-144220799 CTGTCCTTGGAGGTAGGATCTGG + Intergenic
914067531 1:144257529-144257551 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914111622 1:144708825-144708847 CTGTCTCTGGGGAGAGGAGCAGG + Intergenic
914116405 1:144745577-144745599 CTGTCCTTGGAGGTAGGATCTGG - Intergenic
914802954 1:150974142-150974164 GTGGCTTGGGTGGGAGGAGAGGG - Intronic
914933097 1:151951830-151951852 CGGGCTTTGGAGGGTGGAGTGGG - Intergenic
915230760 1:154443840-154443862 CTGGCACAGGAGGGAGGATCTGG - Intronic
915278630 1:154807344-154807366 GTGGCTTGGGAAGGAGCAGCTGG - Intronic
915474884 1:156147470-156147492 CTGGGGTGGGAGGGAGGGGCGGG + Intronic
915944492 1:160140029-160140051 GTGGTCCTGGAGGGAGGAGCTGG - Intronic
916059140 1:161086884-161086906 CTGGCTGTGGAGATAGGAGGAGG - Intronic
916551856 1:165857541-165857563 CTGGAGCTGGAGGGATGAGCAGG + Intronic
916961170 1:169891483-169891505 CTGGCTTTTCAGGCAGGAGTTGG - Intronic
917533324 1:175856184-175856206 CTGGCTTTGGAGGCAGGTGGAGG + Intergenic
919894446 1:202000440-202000462 CTGAATTTGGAGAGAGGACCCGG - Intronic
920355930 1:205372522-205372544 CTTGCTCTGGAGGAAGGAGTGGG + Intergenic
920949848 1:210562451-210562473 CATGATTTGGAGAGAGGAGCGGG + Intronic
921230119 1:213061459-213061481 GTGGCTCTGCAGGGAAGAGCGGG + Intronic
922597361 1:226824254-226824276 CTGGCTTTGGTGTGAGTGGCAGG + Intergenic
922606458 1:226892642-226892664 GTGGGTCTGGAAGGAGGAGCAGG + Intronic
1062878557 10:960408-960430 CTGGGTATGGTGGGAGGCGCTGG + Intergenic
1062922230 10:1289079-1289101 CAGGCTTTGGAGGGAACAGATGG - Intronic
1062965176 10:1601709-1601731 CTGGCTTTCGGGGGAGCAGGTGG - Intronic
1065011858 10:21428112-21428134 CTGCTTTTGATGGGAGGAGCAGG + Intergenic
1065289766 10:24218333-24218355 CTGGCTTTGAAGGGACAAGTTGG - Intronic
1066216817 10:33296397-33296419 CTGGCTTGGGTGTAAGGAGCAGG - Intronic
1066703504 10:38154344-38154366 CTGGCTTTGTAGGGAGAAAGAGG - Intergenic
1066987270 10:42478928-42478950 CTGGCTTTGTAGGGAGAAAGAGG + Intergenic
1067061987 10:43082298-43082320 CTGGCCCTGGAGGGAGCAGGTGG + Intronic
1067460857 10:46457226-46457248 CTGGACCTGGAGGCAGGAGCTGG + Intergenic
1067626334 10:47927374-47927396 CTGGACCTGGAGGCAGGAGCTGG - Intergenic
1067837553 10:49651001-49651023 CAGCCTCTGGAGGGTGGAGCTGG - Intronic
1068767416 10:60778756-60778778 CTGGCTTTAGAGGGAGGCTATGG + Intronic
1069321059 10:67172137-67172159 CTGGCTTTTGAAGGAGAAGTAGG - Intronic
1069795746 10:71050762-71050784 CCAGCTTTGGAGGGAGGTGGAGG - Intergenic
1069808205 10:71139092-71139114 CTGGCTTTGAAGACAGGAGGGGG + Intergenic
1069942478 10:71964788-71964810 CAGACTTTGGAGGGAGAAGGGGG + Intronic
1070485330 10:76924987-76925009 CTGGGTTGGGAGGGAAGAGGGGG - Intronic
1070721094 10:78757801-78757823 CTGGCTTTGGGAGGAGTGGCAGG - Intergenic
1072008753 10:91285433-91285455 GGGGCTTTGTAAGGAGGAGCAGG - Intergenic
1072008808 10:91285780-91285802 CAGGCTCTGTAGAGAGGAGCAGG - Intergenic
1072204279 10:93188660-93188682 ATGGCCATGGAGGAAGGAGCTGG + Intergenic
1073064088 10:100748275-100748297 CGGGGTTTGGAGGGAGGGGAGGG + Intronic
1073452991 10:103620344-103620366 TTGGTTTTGGAGGCAGGGGCTGG + Intronic
1074878342 10:117631972-117631994 TTGGCTGTGGAGGGAGGAGCAGG + Intergenic
1075498942 10:122954309-122954331 CTTGCTTTGGTGGGGAGAGCAGG + Exonic
1075538823 10:123295176-123295198 CTCATTTTGGAGGGAGGAGATGG + Intergenic
1075657961 10:124174311-124174333 CAGGGTTGGGAGGGCGGAGCAGG + Intergenic
1075734530 10:124655706-124655728 CTGGCGTGTGTGGGAGGAGCTGG - Intronic
1076289330 10:129332175-129332197 ATGGCTATGGAAGGAAGAGCAGG + Intergenic
1077169878 11:1161413-1161435 TTGGCTTCGGAGCCAGGAGCTGG + Intronic
1077301403 11:1848814-1848836 CTGGATTTGAGGGGAGAAGCCGG - Intergenic
1077540709 11:3145294-3145316 CTGGTGGTGGAGGGAGGGGCAGG - Intronic
1077549368 11:3193265-3193287 CCGGGCTTGGAGGGAGGAGGGGG - Intergenic
1078084207 11:8224159-8224181 CTGGCTTTAGGGGAAGAAGCTGG - Intergenic
1078721053 11:13883463-13883485 CAGGCGTTGGAGAGTGGAGCAGG + Intergenic
1080617239 11:33955361-33955383 ATGGGTTTGGAGGGAGAAACTGG + Intergenic
1081701737 11:45156818-45156840 CTGGACCTTGAGGGAGGAGCGGG + Intronic
1082080830 11:48011329-48011351 CTGGACTTGGAGGCAGGAGGTGG + Intronic
1082711524 11:56559147-56559169 CTGGCTTTGGAGGTAGAATGCGG - Intergenic
1083287090 11:61667051-61667073 CTGGCCTTGGGGGGTGCAGCAGG + Intergenic
1083331024 11:61898435-61898457 GTGGCTTTGGACAGAGCAGCTGG + Intronic
1083613312 11:64014637-64014659 CTGGCCATGGAGGCAGGTGCTGG + Intronic
1083658461 11:64241435-64241457 CTGGCTCTTGAAGGAGGAGCTGG + Intronic
1083744217 11:64726294-64726316 CAGGCTCAGGAGGGAAGAGCTGG + Intergenic
1083944275 11:65915475-65915497 CTGGCTGTGGAGAACGGAGCGGG + Intergenic
1084358347 11:68653819-68653841 CTGCCTCTGGAGGCAGGAGCAGG + Intergenic
1084600992 11:70145408-70145430 CTGGCTTTTAAAGGAGAAGCAGG + Intronic
1084698177 11:70768740-70768762 CTGGAGATGGAGGGAGGAGGCGG + Intronic
1085134416 11:74072992-74073014 CTGGGTCTGAAGAGAGGAGCTGG + Intronic
1085168144 11:74423381-74423403 CTGGCTTTAGAGAGAGAAGAAGG + Intergenic
1085316723 11:75549536-75549558 CTGGCTTTGAAGGTAGAGGCAGG + Intergenic
1085342235 11:75740153-75740175 CTGGGTGTGGAGGGAGGGACAGG + Intergenic
1085414271 11:76309971-76309993 CTGGGTGTTGAGGGAGGAGAGGG - Intergenic
1085454242 11:76656760-76656782 GTGGCCTGGGAGGGAGGAGATGG + Intergenic
1085740936 11:79077898-79077920 CTGCCTTGGGAGGCTGGAGCTGG + Intronic
1086331252 11:85756390-85756412 CTGGCAATGGAGGAAGGGGCTGG - Intronic
1087749440 11:101990571-101990593 CTGTCATGGGAAGGAGGAGCAGG + Intronic
1087789521 11:102391757-102391779 CAGTCTTGGGAGGGATGAGCAGG + Intergenic
1087992218 11:104758660-104758682 CTGGCTGTGGTGGCAGTAGCAGG - Intergenic
1088165546 11:106931815-106931837 CTGCAGTTGGAGGTAGGAGCAGG + Intronic
1088564745 11:111157813-111157835 CTGGGTTTGGACGGCGGAGGTGG - Intergenic
1088764245 11:112961328-112961350 CTGGGATGGGAGCGAGGAGCGGG - Exonic
1089350493 11:117819220-117819242 CAAGCTTTTGAGGGAGGAGAGGG - Intronic
1089460091 11:118647914-118647936 TTGGCTTTGGGGGCAGGAGCGGG + Exonic
1089624896 11:119745153-119745175 AGGGCTATGGAGGGAGGATCAGG + Intergenic
1089764284 11:120751752-120751774 AGGGCTTGGGAGGAAGGAGCAGG - Intronic
1090153832 11:124414713-124414735 CTGACTTTGGGGGAAGGAGGAGG + Intergenic
1090168955 11:124581406-124581428 TTGGCTCTGGATGGAGGAGGGGG + Intergenic
1090184228 11:124725746-124725768 CTGGCTGGGAAGGGAGGAGGAGG - Intergenic
1090277465 11:125430015-125430037 TTGGCTTTGGGGGCAGGATCTGG - Exonic
1090277804 11:125431977-125431999 AGGGCCTTGGAGGGATGAGCTGG - Exonic
1090339479 11:126003868-126003890 CTTCCTTTGGAGGAATGAGCTGG - Intronic
1090666482 11:128918176-128918198 CTGCCTGTGGAGGGAGGCCCAGG - Exonic
1090968484 11:131619081-131619103 CTGCCTTTGGAGGGCGTAGCTGG + Intronic
1091588287 12:1828228-1828250 CTGGCCTCGGAGGGGGGTGCGGG + Intronic
1092069522 12:5621487-5621509 CTGGAGTTGGAGGCAGGACCCGG + Intronic
1092120290 12:6038877-6038899 CTGACTTGGGAGAGAAGAGCAGG + Intronic
1092125813 12:6074298-6074320 CTGTCCTTGCAGTGAGGAGCTGG - Intronic
1092141783 12:6189066-6189088 CTGGCTTCAGGTGGAGGAGCAGG - Intergenic
1093416236 12:18924163-18924185 CTTCCTTAGGAGTGAGGAGCAGG + Intergenic
1093934810 12:24989183-24989205 CTGGGTTTGGTGGGAGGATTGGG + Intergenic
1094011787 12:25817397-25817419 CTGGCTCTTGGGGGAGGAGGAGG - Intergenic
1096075511 12:48801401-48801423 CTGCCTTTGCAGCAAGGAGCAGG + Intergenic
1096656951 12:53097903-53097925 CTGTCTCAGGAGGGAGGGGCAGG + Exonic
1096986922 12:55765777-55765799 CTGGGTGGGGAGGGAAGAGCAGG - Intronic
1097186927 12:57201015-57201037 ATGTCTGTGGAGGGAGGAGGAGG - Exonic
1097193323 12:57230648-57230670 CTGGCTTTTGAAGGTGGAGGTGG + Intronic
1097245253 12:57604587-57604609 CAGTCTTTGGAGGGAGGGGGTGG - Intergenic
1097449545 12:59719750-59719772 CTGTTTTTGGAGGGTGGAGGTGG - Intronic
1098450205 12:70610397-70610419 CTGGGTGTGGAGGGAGGAAAGGG - Intronic
1098901116 12:76112852-76112874 CTAGCTTGGGAGGTAGGGGCTGG - Intergenic
1099300484 12:80888480-80888502 CTGACTTTGGAGGGAATAACAGG + Intronic
1099534618 12:83828505-83828527 CTGACTGTGAAGAGAGGAGCAGG + Intergenic
1100089801 12:90955122-90955144 CTGGGTTGAGAGGGAGCAGCAGG - Exonic
1100174084 12:92009751-92009773 CTGTATTTGGAGGGAGAAGTTGG - Intronic
1101575297 12:105991650-105991672 CAGACTTTGGATGGAGCAGCTGG + Intergenic
1102942518 12:116956211-116956233 CTGCCTTTGCTGGAAGGAGCAGG + Intronic
1102976653 12:117211590-117211612 CTGGCTTTGGAAGGCTGAGGAGG - Exonic
1103942640 12:124509225-124509247 CTGGCTTTGGTGGGGGGGGGGGG + Intronic
1104473999 12:129055195-129055217 CTGGCTCTGGTGGGTGGAGGGGG + Intergenic
1105642753 13:22282983-22283005 ATAGCTTTGGAGGGCTGAGCAGG - Intergenic
1105912671 13:24885419-24885441 CTGGCTTTGGAAGTAAGAGTAGG - Intronic
1107307923 13:39042843-39042865 CTAGTTTTGGTGGGAGGAGAGGG + Intronic
1108072442 13:46642033-46642055 CTGGCTCTGCAGCGTGGAGCTGG - Intronic
1108095578 13:46897342-46897364 TTGGCTTTGGATGGAAGTGCCGG - Intergenic
1108793145 13:53997029-53997051 CTGGCTTTGAACAGAGGAGGAGG + Intergenic
1108818763 13:54320700-54320722 CAGGCTTTGCAGGAAGGTGCTGG - Intergenic
1109630179 13:65034628-65034650 CTGGCTGCAGAGGCAGGAGCGGG - Intergenic
1110746987 13:79065468-79065490 CTTGCCTTGGAGGCAGGAGATGG - Intergenic
1111863042 13:93732214-93732236 CTGGCTGTGCAGCAAGGAGCCGG - Intronic
1112449850 13:99498657-99498679 CTGGGTCTGGTGGGAGGGGCCGG - Intergenic
1112734664 13:102402425-102402447 CAGGCATTAGAGGGAGGAGGAGG + Intergenic
1112834221 13:103493878-103493900 CTGGCTTTGGAGGTTGAAGAAGG + Intergenic
1113182613 13:107648340-107648362 GTGGATTTGGAGGGAGAAGAGGG - Intronic
1113618482 13:111697312-111697334 TTGGCTTTGGAGGGAGGGAGAGG - Intergenic
1116945465 14:50831236-50831258 CAGGCAGCGGAGGGAGGAGCGGG + Intergenic
1117074886 14:52092215-52092237 ATGGCTTGGGAGGGAGAAGGAGG - Intergenic
1117298452 14:54399305-54399327 CTGGGTTTTGAAGGAAGAGCAGG - Intronic
1117666481 14:58061510-58061532 CTGGCTTTGGAGAGGATAGCAGG - Intronic
1118909704 14:70050968-70050990 CTGGCCTTGCTGGGAGAAGCAGG - Intronic
1119616029 14:76099621-76099643 GTGGCTTTGGCTGGAGCAGCTGG + Intergenic
1119775348 14:77244621-77244643 CTGTCTTTGGAAGGAGGGTCTGG + Intronic
1119784928 14:77305956-77305978 GTGGCTGTGAGGGGAGGAGCAGG + Intronic
1120847326 14:89138130-89138152 GTGGCTTTGGAAGCAGAAGCGGG + Intronic
1121100963 14:91249972-91249994 CTGCCTGGGGAAGGAGGAGCTGG + Intronic
1122136407 14:99635386-99635408 GTGGCTTTGGACTGAGAAGCCGG + Intergenic
1122258837 14:100500393-100500415 CTGGCTGTGGAGGGTGGAGAAGG + Intronic
1122370388 14:101226136-101226158 CTGGCCTTGAAGGGAGGGGGAGG + Intergenic
1122606145 14:102948443-102948465 GTGGGTTTGGAGGGAGGTGAGGG + Intronic
1122651249 14:103228363-103228385 CAGCCTTTGCAGGGATGAGCGGG + Intergenic
1122870598 14:104636389-104636411 TTGGCTCTGGAGGAAGGAGATGG + Intergenic
1122929385 14:104926368-104926390 CTTGCTTTGGGGGTAGGAGTGGG + Intronic
1123115407 14:105892173-105892195 CTGGCTCTGGGAGGAGAAGCAGG - Intergenic
1123412568 15:20072709-20072731 CTGGCTTTAGCAAGAGGAGCAGG - Intergenic
1123521910 15:21079822-21079844 CTGGCTTTAGCAAGAGGAGCAGG - Intergenic
1125070266 15:35546079-35546101 CTGGCCTAGGAGGAAGGAGGCGG + Intronic
1125933603 15:43616691-43616713 CTGGGTGCAGAGGGAGGAGCAGG + Intronic
1125946701 15:43716153-43716175 CTGGGTGCAGAGGGAGGAGCAGG + Intergenic
1126096360 15:45093631-45093653 CTGACATTTGAGGGAGGAGGAGG - Exonic
1126541759 15:49831787-49831809 CTGGCCCTGGGGGGAGGAGAAGG - Intergenic
1127648040 15:60976809-60976831 TTGGCTTAGGAGGGAGGACATGG + Intronic
1128295609 15:66516341-66516363 TTGGTTTTGGAGGCAGGAGGAGG - Intronic
1130001645 15:80053024-80053046 CTGGGTTTTGAGGGATGAGTGGG + Intergenic
1130905081 15:88234571-88234593 CTGGAACTGGAGGGATGAGCAGG - Intronic
1132149754 15:99451218-99451240 CTAGCTTAGGGGGAAGGAGCGGG - Intergenic
1132323745 15:100948138-100948160 CTGGCTTTGGGGGTAGCACCTGG - Intronic
1132988256 16:2779242-2779264 CGGGCTTTGCCGGTAGGAGCTGG - Intergenic
1133292292 16:4730407-4730429 CTGCGGTTGGAAGGAGGAGCAGG - Intronic
1134275939 16:12776200-12776222 CTGGCTTTGAAGGCAGAAGAAGG + Intronic
1135403346 16:22181283-22181305 CTGGGAAGGGAGGGAGGAGCGGG + Intronic
1136070903 16:27786423-27786445 CTGGCTTTGGCGGGGGTGGCGGG + Intergenic
1136585757 16:31183597-31183619 CTGGGTTTAGAGGGTGGTGCTGG + Intronic
1137559422 16:49493238-49493260 CTTGGTTGGGAGGGAGGAGAAGG - Intronic
1137635621 16:49983927-49983949 CTGGCTTTGAAGACAGGAGAAGG + Intergenic
1137636996 16:49995634-49995656 TTTGCTTTGAGGGGAGGAGCAGG - Intergenic
1137762000 16:50948425-50948447 CTCCCTTTGGAGAAAGGAGCTGG + Intergenic
1138393262 16:56685147-56685169 CTGGCTGTGGAGGGAGAGTCTGG + Intronic
1138396080 16:56705677-56705699 CTCTTTTTGGAGGGAGGGGCTGG + Intronic
1138527511 16:57617667-57617689 CTGGCTTGTGATGGAGCAGCAGG - Intronic
1138536538 16:57663378-57663400 ATGGCTGGGGAGGGAGGAGGAGG + Intronic
1138728167 16:59163500-59163522 CTGATTTTGTAGGGAGGAGTAGG + Intergenic
1139319146 16:66099346-66099368 CTGGATTTGGAGTTAGGAGACGG - Intergenic
1139364555 16:66425886-66425908 CTGGCCTTGCAGGGAGGATGGGG - Intergenic
1139477076 16:67208153-67208175 CTGGCTGGGGTGGGAGGATCTGG - Intronic
1140380864 16:74486242-74486264 CTGGCTTTGCCGGGAGCACCAGG - Intronic
1140476397 16:75241474-75241496 CTGGCTTTAGCAAGAGGAGCAGG - Intronic
1141748143 16:85939939-85939961 CTGGCTTTGGAAGTAGGGGGAGG - Intergenic
1142001750 16:87668227-87668249 CTGGATCTGGAGGCCGGAGCCGG + Intronic
1142134776 16:88446661-88446683 CTGGCCTCAGAGTGAGGAGCTGG - Intergenic
1142138562 16:88462490-88462512 CTGGCTGTGGAGGCAGCGGCAGG + Intronic
1142307413 16:89293470-89293492 GTGGCTGCGGAGGGAGGAGCTGG + Intronic
1142307432 16:89293534-89293556 GGGGCTGCGGAGGGAGGAGCTGG + Intronic
1142307443 16:89293566-89293588 GGGGCTGCGGAGGGAGGAGCTGG + Intronic
1142307453 16:89293598-89293620 GGGGCTGCGGAGGGAGGAGCTGG + Intronic
1142307486 16:89293695-89293717 GGGGCTGCGGAGGGAGGAGCTGG + Intronic
1142307497 16:89293727-89293749 GGGGCTGCGGAGGGAGGAGCTGG + Intronic
1142867553 17:2799880-2799902 CAGGCTGGGGATGGAGGAGCTGG + Intronic
1143480778 17:7226310-7226332 CTGCCTGTGGAGGGAGGGGAGGG + Exonic
1143531741 17:7509105-7509127 CTGGCTGTTGCGGGTGGAGCTGG + Exonic
1144635009 17:16900532-16900554 CTGGCATGGGAGGCAGGCGCAGG - Intergenic
1145018090 17:19411800-19411822 CAGGCTGTGGAGGGAGGGACAGG + Intronic
1145915325 17:28570778-28570800 CTGAGTTGGGTGGGAGGAGCGGG - Intronic
1145968188 17:28936300-28936322 CTGGAATTGGAGGGGAGAGCGGG + Intronic
1146445538 17:32929778-32929800 CTGGGTTTTGAAGGATGAGCAGG - Intronic
1147613084 17:41812854-41812876 CTGGCCTGGCCGGGAGGAGCGGG - Intronic
1147672511 17:42184699-42184721 CTGGGTCTTGAAGGAGGAGCAGG - Intronic
1147845933 17:43403874-43403896 CTGGCCTGGGAGGAAGGAGCTGG - Intergenic
1147940425 17:44043153-44043175 CTGTCTTAGGAAGGAGGAGCAGG + Intronic
1148098902 17:45075099-45075121 CAGGAGTTGGAGGCAGGAGCTGG + Intronic
1148183219 17:45621053-45621075 CCGGATTTTGGGGGAGGAGCGGG - Intergenic
1148265631 17:46224638-46224660 CCGGATTTTGGGGGAGGAGCGGG + Intronic
1148467028 17:47871370-47871392 CTGGACTTGGAGGGAGAAGTGGG - Intergenic
1148469267 17:47883455-47883477 CTGGCTTGGGAAGGAGGAAGAGG - Intergenic
1148666148 17:49376511-49376533 CTGGCTTTGAAGGTGGGAGAAGG + Intronic
1148868003 17:50639173-50639195 CTGGCCTTGCAGGGAGGACTGGG - Intronic
1148974035 17:51511184-51511206 CTGGGTTTGGAGGGAGGAAGAGG + Intergenic
1149661225 17:58335022-58335044 GTGGCTTTGGAGGCAGGAGTGGG - Intergenic
1150281128 17:63930257-63930279 CTGGCTCTGGAAGCAGGAGATGG - Exonic
1151319362 17:73343317-73343339 TTGGCTTTGGAAGGCGGAGCGGG - Intronic
1151577300 17:74959153-74959175 CTGGCTCTGGAGGTGGGATCTGG - Intronic
1151719072 17:75845417-75845439 TTGGCCTTGAAGGGAGGAGTTGG - Intergenic
1151795957 17:76345931-76345953 CTGGCTTTGGAGGGAGGAGCAGG - Intronic
1151993926 17:77596773-77596795 CTGGCTATGGATGAAGGTGCAGG - Intergenic
1152350898 17:79783735-79783757 TTGGATTTGGAGGGAGCATCGGG - Exonic
1152649326 17:81484628-81484650 CCGGCCTTGCAGGGAGGGGCGGG - Intergenic
1152766827 17:82145923-82145945 ATGGCTGTGGGGGGAGGTGCCGG - Intronic
1152900630 17:82939161-82939183 GTGTCTGTGGAGGGAGGAGGTGG + Intronic
1155368877 18:25077400-25077422 CTTGCTCTGTAGGGAAGAGCTGG - Intronic
1155925713 18:31652780-31652802 GTGGCGTTGGAGAGAGGAGAAGG - Intronic
1155999748 18:32371634-32371656 CTGGCTATAGAGAGTGGAGCTGG + Intronic
1156966060 18:43093979-43094001 CAGAATTTGGAGAGAGGAGCAGG + Intronic
1157143719 18:45138850-45138872 CTGGTTGGGGAGGGAAGAGCAGG + Intergenic
1157410181 18:47457156-47457178 TTAGCTTTGCAGGGAGTAGCAGG + Intergenic
1157716178 18:49888904-49888926 CAGGCTCTGGAGGGATGTGCAGG - Intronic
1157790650 18:50528218-50528240 CTGGCTTTTGAAGGAGGAGCAGG + Intergenic
1158391953 18:57051498-57051520 CTTTCCTTGGAGGGATGAGCTGG - Intergenic
1158490185 18:57902966-57902988 CTGGATCTTGTGGGAGGAGCAGG - Intergenic
1159022579 18:63155602-63155624 TTGGCTTGGGAGGGAAGAGTAGG + Intronic
1160271272 18:77386542-77386564 CTGGCTTTGGAGATAGAAGAAGG + Intergenic
1160316363 18:77851445-77851467 TTGGCTGTCAAGGGAGGAGCAGG + Intergenic
1160560136 18:79750968-79750990 CAGGCTTGGGAGGGAGGGGCTGG + Intronic
1160560207 18:79751173-79751195 CAGGCTTGGGAGGGAGGGGCTGG + Intronic
1160560217 18:79751206-79751228 CAGGCTAGGGAGGGAGGGGCTGG + Intronic
1160784642 19:893982-894004 CTGGCTTTTGGAGGAGGAGGTGG - Intergenic
1160803270 19:980039-980061 CTGGCTGGGGAGGGAGGTGGGGG - Intergenic
1161400035 19:4063204-4063226 GTGGCTTTGCAGGCAGCAGCTGG + Intronic
1161458509 19:4382135-4382157 CTGACAATGGAGGGAGGAGGGGG - Intronic
1161489108 19:4552187-4552209 CTGCCTTTGGGGAGAGGAGCAGG - Intronic
1162110071 19:8395210-8395232 CTGGCTTGGTTGGGAGGTGCTGG + Intronic
1162920669 19:13900421-13900443 CTGACCTTGGAGGGGGAAGCTGG - Intronic
1162971233 19:14182641-14182663 CGGGCTTGGGAGGGAGGGCCGGG + Intronic
1163521560 19:17794968-17794990 ATGGCCGGGGAGGGAGGAGCCGG + Intronic
1163528532 19:17835886-17835908 CTGGGAATGGAGGGTGGAGCAGG + Intronic
1163884017 19:19950166-19950188 CTGTTGTTGGAGAGAGGAGCTGG - Intergenic
1164609076 19:29620173-29620195 CTGGCTTAGGAGGGAGATGGAGG + Intergenic
1164650183 19:29885808-29885830 CTGGAATTGAAGGGAGGAGAAGG - Intergenic
1164759575 19:30718971-30718993 CTGGCTTTTCTGGGAGCAGCCGG - Intergenic
1165109898 19:33496213-33496235 TCGTCTTGGGAGGGAGGAGCAGG + Intronic
1165320863 19:35084407-35084429 CTGGCTTTGGGAGGAGGGGTGGG - Intergenic
1166193820 19:41193582-41193604 CTGGGGTTGGGGGCAGGAGCAGG + Intronic
1166375667 19:42325655-42325677 CCGGCTTCGGAGGGAGGCGAGGG + Intronic
1166529350 19:43533466-43533488 GTGGCCGTGGCGGGAGGAGCCGG + Exonic
1166768522 19:45266400-45266422 CTGGGTGTGGAGGGAAGAGCAGG - Intronic
1166830985 19:45639467-45639489 GTGGCTGTGGAGGGCGGGGCAGG - Intronic
1167284676 19:48592457-48592479 CTGGCTTTGGAGGGAAATCCAGG + Intronic
1167347444 19:48955252-48955274 CTGGCACTGGTGGGAGGGGCGGG + Intronic
1202702154 1_KI270712v1_random:172649-172671 CTGTCCTTGGAGGTAGGATCTGG + Intergenic
925027996 2:624767-624789 CTGACTCTGCAGGGAGGAGCTGG + Intergenic
925309867 2:2874942-2874964 CTGGCTCTGGGCGGAGGTGCTGG - Intergenic
928445408 2:31329479-31329501 CTGGGTTTGGAAAGAGAAGCAGG + Intergenic
928498219 2:31857824-31857846 CTGCCTTTGGGAGGCGGAGCGGG + Intergenic
928522832 2:32107101-32107123 ATTGCTTTGGAGGGTGGAGTGGG - Intronic
928887739 2:36169398-36169420 CTGGCTGTAAAGGGAGGAGGAGG - Intergenic
929287991 2:40157408-40157430 CTGGCTTTGGAGACAGGTGTGGG - Intronic
929429045 2:41871357-41871379 CTGCCACTGGAGGGAGGAGGGGG - Intergenic
929605860 2:43233734-43233756 ATGGGTTTGGAGGGAGGCTCAGG + Intronic
929617684 2:43324941-43324963 GTGGCTTTCGAAGGAGGAGAAGG + Intronic
929900157 2:45993707-45993729 ATGGGTTTGGTGGGTGGAGCAGG + Intronic
932412806 2:71557305-71557327 GTGGACTTTGAGGGAGGAGCAGG + Intronic
932838279 2:75057664-75057686 CAGGAGTTGGAGGGAGGAGATGG + Intronic
932874945 2:75441822-75441844 CTGGCTTTGGAGCTAGGATTTGG - Intergenic
932912859 2:75822515-75822537 CTGGCTTTGGAAGGTGGAGGTGG - Intergenic
933166578 2:79083297-79083319 CTGGCTCTGAAGAGAGCAGCGGG - Intergenic
933762806 2:85684827-85684849 CTGGCTTTGAAGGGATGGACAGG + Intergenic
934173069 2:89556095-89556117 CTGTCCTTGGAGGTAGGATCTGG + Intergenic
934177843 2:89592879-89592901 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934283384 2:91630452-91630474 CTGTCCTTGGAGGTAGGATCTGG + Intergenic
934288141 2:91667180-91667202 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934772404 2:96915472-96915494 CTGGCTGTGGGGGTAAGAGCAGG + Intronic
934880521 2:97972820-97972842 CTGGCTTTGAAGGCAGGGGAAGG + Intronic
935074711 2:99729772-99729794 CTGTCTTTGGATGGTGGGGCGGG - Intronic
935271258 2:101436093-101436115 ACGGGTGTGGAGGGAGGAGCGGG + Intronic
936988085 2:118330880-118330902 CTGGCTTCGGAAGGCAGAGCAGG - Intergenic
937912023 2:127080400-127080422 CTGGGTTTTGAAGGATGAGCAGG + Intronic
939845718 2:147244049-147244071 CAGGCTGGGGAGGGAGGAACGGG + Intergenic
940286522 2:152038103-152038125 CTGTATTTGGAGGCAGGAGGTGG + Intronic
940484628 2:154281833-154281855 CTGACTTTTGAGGGAGCAGCTGG - Intronic
942607629 2:177709382-177709404 CTGGCTTTGAGGGGAGCTGCAGG + Intronic
942688506 2:178560156-178560178 TTGGGTTTGGATGGAGGAGATGG + Exonic
943657081 2:190521285-190521307 GTGGCTTTGCAGATAGGAGCTGG - Intronic
944394735 2:199253826-199253848 CTGGCTTTAGAGGCAAGAGTAGG + Intergenic
945748702 2:213752230-213752252 GTGGCTATGGGGAGAGGAGCTGG - Intronic
946500179 2:220238788-220238810 CTGGCTTTGGACTCAGGTGCTGG + Intergenic
947462902 2:230318506-230318528 ATTGCTTAGGAGTGAGGAGCAGG + Intergenic
947617645 2:231568706-231568728 CTAACTCTGGAAGGAGGAGCAGG - Intergenic
947704706 2:232264891-232264913 CAGGCTGGGGAAGGAGGAGCAGG - Intronic
947733135 2:232441937-232441959 CCGGCTCTGGGGGGAGGAGTTGG - Intergenic
948561692 2:238858004-238858026 TTGGCTTTGGAGGAACCAGCCGG - Intronic
948897522 2:240934230-240934252 CTGGGCTTGGAGGGAGTTGCAGG + Intronic
948947592 2:241228936-241228958 CTGGCAGTGGAGGTAGGGGCAGG + Exonic
1168761808 20:354597-354619 CCGGCTGGGGAGGGAGGGGCTGG - Exonic
1168972822 20:1942479-1942501 CTGCCCTTGGAGGGAGGACCAGG + Intergenic
1169987382 20:11460617-11460639 CTGGCTTGAGAAGGAGGAGATGG - Intergenic
1170765187 20:19283910-19283932 CTCGCTCTGCAGGGAGTAGCTGG - Intronic
1170949590 20:20924726-20924748 CTGCCTGTGGTGGGAGGAGGGGG - Intergenic
1171195489 20:23194400-23194422 CTGGCTTTGGAGGCAAGCCCAGG + Intergenic
1171293318 20:23994857-23994879 CAGGCTTTTGAGGCAGGAGGTGG + Intergenic
1171959253 20:31482218-31482240 CTGGCTGAGGAAGGTGGAGCTGG - Intronic
1172137435 20:32696616-32696638 CTGGCTTGGGGAGGAGGAGCGGG + Intergenic
1172173524 20:32958962-32958984 CCTGATTTGCAGGGAGGAGCAGG + Intronic
1172637111 20:36417328-36417350 ATGGCTTTGGTGGGCTGAGCAGG + Intronic
1172641577 20:36443348-36443370 TTGGCCTGGGAGGGAGGAGAGGG - Intronic
1172657187 20:36544352-36544374 CTGGCCCTGCAGGAAGGAGCTGG - Intronic
1172896609 20:38304657-38304679 CTGGCTTTGGAAAGAAGAGAAGG - Intronic
1173164073 20:40673947-40673969 CTGGCTGTGGAGACTGGAGCTGG - Intergenic
1174082407 20:47979780-47979802 CTGACTTGGGAGTCAGGAGCTGG - Intergenic
1174134144 20:48367458-48367480 CTGATTTTGGAGTCAGGAGCTGG + Intergenic
1174183058 20:48687053-48687075 ATGGCATTGGAAGGAGGAGGGGG - Intronic
1175076967 20:56383561-56383583 CTGGGACTGGAGGGAGCAGCTGG - Intronic
1175423032 20:58847660-58847682 GCGGCTTTGCAGGGAGGAGGTGG - Intronic
1175856028 20:62121732-62121754 CAGGCTTTGGGAGGAGGGGCAGG + Intergenic
1176041794 20:63069591-63069613 CGGGGTTGGGAGGGAGGACCGGG + Intergenic
1176075475 20:63246376-63246398 CTGGCTTTGGTGGGAGAAACAGG + Intronic
1176101777 20:63367727-63367749 CTGGATTGGGAGGGGGGTGCTGG - Intronic
1176386737 21:6141728-6141750 AGAGCTTTGGTGGGAGGAGCGGG + Intergenic
1177407440 21:20688764-20688786 CTGGTTTCAGATGGAGGAGCTGG + Intergenic
1177667196 21:24175967-24175989 CTGTCATTGGAGGGAGGTGATGG - Intergenic
1177832669 21:26156578-26156600 CTGGCTTTGGATTGCAGAGCTGG - Intronic
1178509801 21:33194887-33194909 GTGGCTTTGGAGGGCAGAGGAGG + Intergenic
1179151712 21:38814785-38814807 CTGGCTGTGGAGTGAGCAACAGG + Exonic
1179223664 21:39432670-39432692 CTGGGTTGGGAGTGAGGCGCAGG - Intronic
1179736736 21:43396524-43396546 AGAGCTTTGGTGGGAGGAGCGGG - Intergenic
1179984607 21:44913585-44913607 CTGGCATTGGGGGGTGGGGCAGG - Intronic
1180008670 21:45035198-45035220 CTGCCTGTGGAGGGTGGGGCAGG - Intergenic
1180233659 21:46443504-46443526 CTGGCTCAGGAGGGAGGGGCAGG - Intronic
1181054992 22:20256655-20256677 CTGGCCTGGGAGGGAGGCACCGG - Intronic
1181538687 22:23561309-23561331 TTGGCTTTTGAGGGAGGTGGGGG - Intergenic
1181582309 22:23835071-23835093 CTGGCTTGTAAGGCAGGAGCTGG - Intronic
1182735980 22:32532609-32532631 CAGGCCTTGGAGGTAGGAGGAGG - Intronic
1183085136 22:35482232-35482254 CTGGCTTTGGAAGGCTGAGTAGG + Intergenic
1184030872 22:41893762-41893784 CAGGCATTGGAAGGAGGTGCTGG + Intronic
1184298118 22:43539006-43539028 CTGGCTTTGGAGAGAGAGGAGGG - Intronic
1184312211 22:43653771-43653793 CTGTCTTTGGAGGAAGGGGCAGG + Intronic
1184318473 22:43719070-43719092 CTGGCTTGGAAGGGTGGAGAAGG + Intronic
1184320105 22:43735226-43735248 CTGCCCTTGGAGTCAGGAGCAGG + Intronic
1184462277 22:44645975-44645997 CTGGCATTGGGGGAGGGAGCAGG - Intergenic
1184496412 22:44844971-44844993 CTGGGTTTTGAGGGATGAGTAGG - Intronic
1185297576 22:50061926-50061948 CTGGCTCTGGGGCGGGGAGCGGG + Intronic
950000810 3:9654927-9654949 CTGGAATTGGAAGGATGAGCAGG + Intronic
950481604 3:13247733-13247755 CTGGATCTGGAGGGAGGGCCGGG + Intergenic
950965313 3:17141991-17142013 GTGGATTTGCAGGAAGGAGCAGG - Intergenic
951772136 3:26270380-26270402 CTGGGGGTGGAGGGAGGAGGTGG + Intergenic
952936136 3:38399765-38399787 TTGGTTTTGGAGGGCAGAGCAGG - Intronic
953032854 3:39189361-39189383 CTGGGGGTGGAGGGAGGGGCAGG + Exonic
953411976 3:42695783-42695805 CTGGCTTCAGTGGGAGGAGGAGG - Intronic
954652265 3:52172309-52172331 CTGCGATTGGATGGAGGAGCAGG - Intergenic
955589159 3:60515319-60515341 CTGGATGTGGTGGGAGGAGGAGG + Intronic
955722892 3:61902342-61902364 ATAGCATTGGAGGGAGAAGCAGG + Intronic
955735353 3:62033088-62033110 CTGGGCTGGGAGGCAGGAGCCGG - Intronic
956011681 3:64838373-64838395 ATGGCTGTGGAGGGAGGGGTGGG - Intergenic
956518744 3:70080587-70080609 AGGGTTTTGGAGGGAGGAGGGGG - Intergenic
956723592 3:72138969-72138991 CTGGGTTTGGAGAGAGGGGCAGG - Intergenic
957278187 3:78115776-78115798 CTGCCTTGGGAGGTTGGAGCTGG + Intergenic
961398511 3:126616174-126616196 CTGGCTGTGTGGAGAGGAGCTGG + Intronic
962236331 3:133710627-133710649 TTGGCTGCGGAGGGAGGAGGTGG - Intergenic
963041189 3:141071251-141071273 CTGCATGTGGAGAGAGGAGCTGG - Intronic
963092028 3:141491262-141491284 CAGGCTTTTGAGGGATGAGTAGG - Intronic
964523825 3:157595734-157595756 CTGTCTTTGGAGGGGAGGGCAGG - Intronic
965909586 3:173755573-173755595 CTGCCTTTGGAGACAGAAGCAGG + Intronic
966130923 3:176638099-176638121 TTGTTTTTGGAGGGAGGAGAGGG - Intergenic
966921618 3:184615522-184615544 CTGGATATGGAGGTAGGGGCGGG - Intronic
968506822 4:974561-974583 CAGTCTGAGGAGGGAGGAGCAGG + Intronic
968603707 4:1521796-1521818 CCGCCCTTGGAGGGATGAGCTGG - Intergenic
969042395 4:4309508-4309530 CTGTCTTTGGGGAGAGGAGTAGG + Intronic
969228070 4:5812022-5812044 CTGGCTGTGGTGAGAGGGGCTGG - Exonic
969228083 4:5812080-5812102 CTGGCTGTGGTGTGAGGGGCTGG - Exonic
969228126 4:5812254-5812276 CTGGCTGTGGTGTGAGGGGCTGG - Exonic
969228154 4:5812369-5812391 CTGGCTGTGGTGTGAGGGGCTGG - Exonic
969228168 4:5812426-5812448 CTGGCTGTGGTGTGAGGAGCTGG - Exonic
969228202 4:5812600-5812622 CTGGCTGTGGTGAGAGGGGCTGG - Exonic
969517481 4:7655652-7655674 CTGGTTTCCGAGGGAGGAACCGG - Intronic
970813446 4:20124632-20124654 CAGGCTTTGGAGAGAAGAGCTGG - Intergenic
973946080 4:55957276-55957298 CTGACTTCAGAGGGAGGAACCGG - Exonic
974782440 4:66570834-66570856 CTGGCTTTGAAGACAGGAGAAGG - Intergenic
978278275 4:106978279-106978301 CTGGCTCTGAAGAGAGCAGCAGG - Intronic
979171895 4:117610663-117610685 GTGGCTCTGGGGTGAGGAGCAGG - Intergenic
979264534 4:118685653-118685675 CGGGGTGTGGAGGGAGGAGGCGG - Intronic
979676350 4:123414068-123414090 CTGGATTAGGAGGGTGGAGTAGG - Intergenic
981617000 4:146652797-146652819 CTGGTCTTGGAGGGTGGTGCAGG + Intergenic
981804054 4:148692255-148692277 CTGGATTTGAAGTGAGGAGTGGG + Intergenic
982216395 4:153086060-153086082 CTGTCTCAGGAGAGAGGAGCTGG + Intergenic
982418240 4:155162542-155162564 CTGGTTTTGCAGTGAGGATCTGG + Intergenic
984013290 4:174398007-174398029 CTGGCTTTGAAGAGAGGAGAGGG - Intergenic
984743968 4:183195742-183195764 CTGGCTGTGAAGGGAAGAGGAGG - Intronic
984875007 4:184359772-184359794 CTGTCTTTGGAAGCAGGACCTGG - Intergenic
985577427 5:679913-679935 TTGGCCTTGGAGGGCTGAGCGGG + Intronic
985592359 5:772009-772031 TTGGCCTTGGAGGGCTGAGCGGG + Intergenic
985907820 5:2854793-2854815 CTGGTCCTGCAGGGAGGAGCTGG - Intergenic
985936469 5:3101502-3101524 CTGGGTTGGGAGAGGGGAGCAGG - Intergenic
986058319 5:4161636-4161658 TTGGCTGTGGAAGGAGGAACAGG + Intergenic
986682885 5:10249857-10249879 CTCGCGATGGAGGGAGGAGGAGG - Exonic
987047846 5:14124271-14124293 GTGGCTTTGGGAGGAGGAACTGG - Intergenic
987159022 5:15120749-15120771 CTGGCTTTGGAAAGAAGAGACGG + Intergenic
989515370 5:42337239-42337261 CTGGCTGTGGAAGCAGGAGCAGG - Intergenic
993492885 5:88573421-88573443 CTTGTTTTGGGGGGAGGATCAGG - Intergenic
993966747 5:94368575-94368597 CAGGCTCTGGAGGCATGAGCAGG + Intronic
994133803 5:96262283-96262305 GTGGGTTGGGAGGGAGGAGAAGG + Intergenic
994296000 5:98089330-98089352 CAGCCTCTGGAGGGAGGAGGGGG - Intergenic
995528524 5:113069959-113069981 CTGCCTTTGAAACGAGGAGCTGG - Intronic
995903269 5:117094056-117094078 CTGCCTTTGGAGGCAGGTCCAGG - Intergenic
997248523 5:132371209-132371231 CCAGCTTTGGAGGCAGAAGCAGG - Intronic
997428886 5:133823798-133823820 CTGGCTTTGGAGGGGGCATGAGG - Intergenic
998001735 5:138631073-138631095 CTGGCTTTGGAGGAGGCAGGGGG - Intronic
998143391 5:139712075-139712097 CTCGGTTTGGAGCGAGGAGCTGG + Intergenic
998252136 5:140560594-140560616 GGGGCTTTGGAGGGGTGAGCAGG - Intronic
999018285 5:148133673-148133695 CTGTATTTAGAGGGAGGATCTGG - Intronic
999191397 5:149750144-149750166 GTGGGTTTGGAAGGAGGAGAAGG + Intronic
999318407 5:150598880-150598902 CTGGCTTGGGAAGGAGGGGGAGG + Intergenic
1000027194 5:157369557-157369579 CTGGCTTTGGATGAAGGTGATGG - Intronic
1001639675 5:173235697-173235719 CTGGCTTTGGGGATAGCAGCAGG + Intergenic
1001781253 5:174370963-174370985 GTGGGTTTGGAGGAAGGAGATGG - Intergenic
1001913761 5:175542345-175542367 CTGGGTTTGGAAGGTGCAGCAGG + Intergenic
1001984327 5:176061067-176061089 CTCTCTTCGGAAGGAGGAGCGGG + Intronic
1002060071 5:176620744-176620766 CTGGCTCTGGGGGGCGGGGCAGG + Exonic
1002105892 5:176879331-176879353 CTGGCTCTGGAGAGTGAAGCGGG + Exonic
1002163887 5:177332850-177332872 CAGGCTGTGGGTGGAGGAGCTGG + Intronic
1002233149 5:177782998-177783020 CTCTCTTCGGAAGGAGGAGCGGG - Intronic
1002262831 5:178006783-178006805 CTCTCTTCGGAAGGAGGAGCGGG + Intronic
1002385018 5:178860141-178860163 CTGGCTGTGCCGGGAGGAGGCGG + Intronic
1002440245 5:179260604-179260626 CTGCATCAGGAGGGAGGAGCAGG - Intronic
1002461979 5:179378408-179378430 CAGGCTTTGGAGAGAGCACCAGG - Intergenic
1002795267 6:466521-466543 CTGGCCAGGGAGGGAGGTGCAGG + Intergenic
1002879556 6:1238771-1238793 CTTGGGTTGGAGGGAGGAGATGG - Intergenic
1004425143 6:15502080-15502102 CACGCTGTGGAGGGAAGAGCTGG + Intronic
1004570527 6:16840344-16840366 CTGACTTTGGGGAAAGGAGCAGG + Intergenic
1005039976 6:21592743-21592765 ATGGCTTTGGGAGGAGGAGAGGG + Intergenic
1005215547 6:23523275-23523297 CTGGGTTTCCAGGAAGGAGCAGG - Intergenic
1005504401 6:26457504-26457526 CTGGCTTTGGAGGTTGGGCCTGG - Intergenic
1006101762 6:31689998-31690020 CAGCCATTGGAGGGAGGAGAGGG - Intronic
1006131359 6:31871209-31871231 CAGGCTTTGGACAGAGGAGGAGG - Intronic
1006393771 6:33773775-33773797 CTGGCCTGGGAAGGAGGGGCTGG - Intronic
1006786030 6:36667894-36667916 CTGCCTCTGGAGAGAGGAGCAGG - Intergenic
1006951736 6:37827867-37827889 CTGGCCTTGGATGGAAGAGGAGG + Intronic
1007282206 6:40720980-40721002 CTGGCTGGAGAGGGAGGAGGAGG - Intergenic
1007394795 6:41571248-41571270 CTGGTTTTGGCTGCAGGAGCTGG + Intronic
1007453392 6:41957429-41957451 CTGGATTTGGAGAAAGAAGCAGG - Intronic
1007920106 6:45599696-45599718 CTTGCTTTGGAGTGAAGTGCAGG + Intronic
1007982253 6:46171116-46171138 CTGGGTTTGGAGGGTGGAGGGGG + Intergenic
1008119497 6:47595926-47595948 CTGGCTTTGGTAGGTGGAGTAGG - Exonic
1010540748 6:77089133-77089155 CTGGCTTTGGAATGAGGCCCAGG - Intergenic
1011042951 6:83051279-83051301 CAGGCCCTGGAGGCAGGAGCAGG - Intronic
1011769067 6:90655400-90655422 CTGGATAGGGAGGGAGGGGCCGG - Intergenic
1012537465 6:100316283-100316305 CTATCTTTGGAAGGAGTAGCTGG + Intergenic
1013035821 6:106381687-106381709 CCGTCTTTGGGGAGAGGAGCTGG + Intergenic
1014674708 6:124349287-124349309 CCGCCTTTGTAGGGGGGAGCAGG - Intronic
1016885115 6:148951616-148951638 CTGGCCATGGGGGGAGGACCAGG + Intronic
1017070652 6:150573129-150573151 CAGTCTTCCGAGGGAGGAGCCGG + Intergenic
1017083699 6:150693680-150693702 CTGGCTCTGGAAGGAGGTGATGG - Intronic
1018214583 6:161514594-161514616 CTGGCTTAGGAGGGAGGTGATGG + Intronic
1018757407 6:166862404-166862426 CTGGCTTGGCAGGGAGGGGACGG - Exonic
1019108516 6:169690358-169690380 GTAGCAGTGGAGGGAGGAGCTGG - Intronic
1019277770 7:184943-184965 CTGGAGGAGGAGGGAGGAGCTGG - Intergenic
1019305772 7:333703-333725 CTGGCTTGGGGGGGTGGGGCGGG - Intergenic
1019373221 7:674456-674478 CTGGGTTTGGTTGGAGTAGCTGG - Intronic
1019373231 7:674520-674542 CTGGGTTTGGCTGGAGTAGCTGG - Intronic
1019648797 7:2145111-2145133 CTGGCTGTGGAGCCAGGAGCAGG - Intronic
1020009554 7:4800640-4800662 CTGGGTGTGGAGGGAGGAGGAGG - Intronic
1020639953 7:10742522-10742544 CTGGCTCTGAAGAGAGCAGCAGG + Intergenic
1021767385 7:23963539-23963561 ATGGCTCTGGAGGCAGGATCTGG + Intergenic
1021879298 7:25078080-25078102 CTGGCTAGGTAGGGAGGAGCAGG + Intergenic
1023743561 7:43302224-43302246 CTGGCTTGGGAGGGAGCCTCAGG - Intronic
1023984788 7:45088351-45088373 ATGGCTCTGGAGGGAGGAGCAGG - Intronic
1025025768 7:55515070-55515092 GTGGCTTGGGAGGCAGCAGCAGG - Intronic
1025195342 7:56928099-56928121 CAGCCTGTGGAGGGAGGTGCAGG - Intergenic
1025676610 7:63648844-63648866 CAGCCTGTGGAGGGAGGTGCAGG + Intergenic
1025929032 7:65980406-65980428 CTGACTGTGGAGAGAAGAGCCGG + Exonic
1027132016 7:75597933-75597955 GTGGCTTTGTAGAGAGGTGCAGG - Intronic
1028196009 7:87908962-87908984 CAGCCTCTGGAGGGAGTAGCTGG - Exonic
1028808124 7:95052706-95052728 CTGGCTTTGGAGAGAAGATGAGG - Intronic
1029179199 7:98687788-98687810 CTGGGCTTAGAGAGAGGAGCAGG - Intergenic
1029440681 7:100585225-100585247 CAGGCTTAGGAAGGAGGAGGAGG + Intronic
1029734447 7:102457762-102457784 CTGGCTGTGGGGGGAGCGGCTGG - Exonic
1030247408 7:107398795-107398817 CTGGGTTTGGGGGTAGGAGGAGG + Intronic
1032359728 7:131244314-131244336 CTGGCGTTGGAGGGAGGAGCGGG - Intronic
1032467317 7:132154150-132154172 CGGGGTTTGGAGGGTGGAGTGGG - Intronic
1032883404 7:136114368-136114390 CTGGCTCTGAAGAGAGCAGCGGG - Intergenic
1034295962 7:149972680-149972702 CTGGCTGTGCAGTGATGAGCTGG - Intergenic
1034410118 7:150936425-150936447 CTGGCTCTGGAGGATGGGGCAGG - Intergenic
1034810089 7:154124222-154124244 CTGGCTGTGCAGTGATGAGCTGG + Intronic
1035418125 7:158706149-158706171 CTGTGTATGGAGGGAGGAGGAGG - Intergenic
1035447807 7:158954963-158954985 CTTTCTCTGGAGGGAGGAGAAGG - Intronic
1035701364 8:1641331-1641353 GTGGTTTTGAAGGGAAGAGCAGG - Intronic
1035763139 8:2084748-2084770 TGAGCTTTTGAGGGAGGAGCAGG + Intronic
1035774910 8:2180779-2180801 CTTGCTTTCCAGGGAAGAGCTGG + Intergenic
1036135858 8:6160987-6161009 CAGGCTTGGGAGAGGGGAGCAGG - Intergenic
1036708468 8:11061951-11061973 TTCTCTTTGGAGGGAGGAGCAGG - Intronic
1037418487 8:18676790-18676812 CTGGCTCTGCAGGAAGCAGCAGG - Intronic
1037594496 8:20343532-20343554 CTGTCAGTGGAGGGGGGAGCTGG + Intergenic
1039548248 8:38424994-38425016 CTGGTTTTTTAAGGAGGAGCAGG - Intronic
1040915467 8:52563869-52563891 CTGGGTGTGGAAGGAGGCGCTGG - Intronic
1040951323 8:52940932-52940954 CTGGCCAGCGAGGGAGGAGCCGG + Exonic
1041390599 8:57344123-57344145 CTGGGTTTTGAAGGAGGAGTAGG + Intergenic
1041461482 8:58116393-58116415 CTGGCATGGGAGGAAGGAGATGG - Intronic
1042307895 8:67350810-67350832 CTGCCTTTTGAGGGAGGTGGGGG + Intergenic
1042469928 8:69175186-69175208 CTGGCCCTGGAAGGAGGAGTAGG + Intergenic
1045475239 8:102547006-102547028 CTGGGTTAAGAGGGAGGAGCTGG + Intergenic
1046804405 8:118463850-118463872 CTGGGTTTGGCAGGAGGAGGAGG + Intronic
1049004045 8:139843676-139843698 CTGGCTTTGGTGGAAGGGGCCGG + Intronic
1049277889 8:141729048-141729070 ATGGCTTGGGAGGGCAGAGCAGG - Intergenic
1049379296 8:142304021-142304043 CTGGCTTGGGAAGGAGAACCTGG - Intronic
1049473206 8:142785380-142785402 CTGGCCTTGCAGGGTGTAGCTGG + Exonic
1049476153 8:142797825-142797847 CTGGCTGTGGAGAGAGGAGGAGG + Intergenic
1049528181 8:143139908-143139930 CTGGCCTTGGAGTGAGGGGAGGG + Intergenic
1050046780 9:1554518-1554540 CTGGCTTTACAGGCAGGAGTAGG + Intergenic
1051348892 9:16179756-16179778 CTGGCTTTGAAGGGCTCAGCAGG - Intergenic
1054761977 9:69012384-69012406 CTGACTTTGGAAGGAGGCTCTGG - Intergenic
1055828240 9:80352375-80352397 CTGTCTTTGGAGAGGGGAACTGG + Intergenic
1056580677 9:87886529-87886551 CTGACTTTGCAGGGAAGGGCAGG + Exonic
1056778849 9:89534372-89534394 CTGGCAGTGGAGGGTGGAGTGGG - Intergenic
1057832344 9:98417027-98417049 CAGGGTGTGGAGGAAGGAGCCGG - Intronic
1057834767 9:98435528-98435550 CTGGCTGTGGTGGGGAGAGCAGG - Intronic
1058935630 9:109767240-109767262 CTGGGGTTGGAGGGAGCAGTAGG - Intronic
1059954645 9:119502777-119502799 CTGGCTTTGAAGAGAGCAGCAGG + Intronic
1060893217 9:127201702-127201724 CTGGGAGTGGAGGGAGGACCTGG - Intronic
1061257283 9:129460229-129460251 AGGGCTTTGCGGGGAGGAGCTGG - Intergenic
1061624835 9:131835554-131835576 GTGGCTGTGGAGGGAGGGTCTGG - Intergenic
1061835136 9:133323689-133323711 CTGGATTGGGAGGGTGGGGCTGG - Intergenic
1061965029 9:134008646-134008668 GTGGCTTTGCAGGGAGGGGTGGG - Intergenic
1062091412 9:134680504-134680526 CCCGCTGTGGAGGGCGGAGCTGG + Intronic
1062148809 9:135007047-135007069 CTGGCTGTGGAGGGCCGGGCGGG - Intergenic
1062149967 9:135013042-135013064 ATGGGTTTGGGAGGAGGAGCAGG + Intergenic
1062167995 9:135117982-135118004 CTGGGTTTGGAGGTAGGACGTGG + Intronic
1062168007 9:135118039-135118061 CTGGGTTTGGAGGGAGGACATGG + Intronic
1062212504 9:135372555-135372577 CTGGCGCTGCAGGGAGGAGGCGG - Intergenic
1062395586 9:136351337-136351359 CTGGGCCTGGAGGGAGGAGCAGG + Intronic
1062412516 9:136432206-136432228 CTGGCTGTGTGGAGAGGAGCAGG - Intronic
1062439525 9:136563491-136563513 CTGGCTCTGGACTGAGGAGGTGG - Intergenic
1186506590 X:10098310-10098332 CTGGCTGGGGAGGGGGGAGGGGG - Intronic
1187506487 X:19882478-19882500 CTGGCTTTGGAGAGAGGAAGAGG + Intronic
1188602921 X:31991488-31991510 ATGACTTTGGAGGGGAGAGCAGG + Intronic
1189899912 X:45695886-45695908 CTGGCTGTGGAGGGAGGGGCTGG + Intergenic
1190105293 X:47556346-47556368 CTGGGTTGGCAGAGAGGAGCTGG + Intergenic
1190213783 X:48467290-48467312 CAAACTTTGGAGGGAGCAGCTGG + Intronic
1190380620 X:49836916-49836938 CTGGCCTTGGAGAGAAGAGCTGG + Intergenic
1190385244 X:49878475-49878497 CTGGCCTTGGAGAGAAGAGGTGG + Intergenic
1190904356 X:54711121-54711143 CAGGGTTTCAAGGGAGGAGCTGG - Intergenic
1192955342 X:76064050-76064072 ATGGCTTGGGAAGGAGCAGCTGG + Intergenic
1193640299 X:84003743-84003765 CTGGATTTGGAGGGGGGCGCTGG - Intergenic
1194021309 X:88695116-88695138 CTGGCTCTGAAGAGAGCAGCAGG + Intergenic
1194601325 X:95924587-95924609 CCTGCTTTGGTGGGAGTAGCAGG - Intergenic
1194711527 X:97242219-97242241 CTGGGTTTGGAGGTGGGAGATGG - Intronic
1196614828 X:117756127-117756149 CTGACTGTGCATGGAGGAGCAGG - Intergenic
1196657087 X:118229592-118229614 CTGCCTTGGGAAGGAGGGGCTGG + Intergenic
1200035014 X:153321307-153321329 CTGGCTTTCGGGGGAGGAAGGGG - Intergenic
1200136650 X:153878504-153878526 CTGGCTTTGTAGGGAGAGGCCGG - Intronic
1200150486 X:153949017-153949039 CAGCCTTGGGAGGGCGGAGCTGG + Exonic