ID: 1151797821

View in Genome Browser
Species Human (GRCh38)
Location 17:76358165-76358187
Sequence GTACCTGAGGAGGGAAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 324}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151797816_1151797821 3 Left 1151797816 17:76358139-76358161 CCCACAGAAGCATTGCAGGGGTC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797817_1151797821 2 Left 1151797817 17:76358140-76358162 CCACAGAAGCATTGCAGGGGTCT 0: 1
1: 0
2: 1
3: 7
4: 172
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797811_1151797821 7 Left 1151797811 17:76358135-76358157 CCCTCCCACAGAAGCATTGCAGG 0: 1
1: 0
2: 2
3: 21
4: 196
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797808_1151797821 10 Left 1151797808 17:76358132-76358154 CCCCCCTCCCACAGAAGCATTGC 0: 1
1: 0
2: 1
3: 8
4: 237
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797809_1151797821 9 Left 1151797809 17:76358133-76358155 CCCCCTCCCACAGAAGCATTGCA 0: 1
1: 0
2: 0
3: 20
4: 231
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797813_1151797821 6 Left 1151797813 17:76358136-76358158 CCTCCCACAGAAGCATTGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797804_1151797821 28 Left 1151797804 17:76358114-76358136 CCACGTTTCCCCTGCAGTCCCCC 0: 1
1: 0
2: 1
3: 25
4: 357
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797803_1151797821 29 Left 1151797803 17:76358113-76358135 CCCACGTTTCCCCTGCAGTCCCC 0: 1
1: 0
2: 2
3: 36
4: 393
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797807_1151797821 18 Left 1151797807 17:76358124-76358146 CCTGCAGTCCCCCCTCCCACAGA 0: 1
1: 0
2: 4
3: 51
4: 735
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797806_1151797821 19 Left 1151797806 17:76358123-76358145 CCCTGCAGTCCCCCCTCCCACAG 0: 1
1: 0
2: 5
3: 47
4: 462
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797810_1151797821 8 Left 1151797810 17:76358134-76358156 CCCCTCCCACAGAAGCATTGCAG 0: 1
1: 0
2: 1
3: 12
4: 190
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324
1151797805_1151797821 20 Left 1151797805 17:76358122-76358144 CCCCTGCAGTCCCCCCTCCCACA 0: 1
1: 0
2: 7
3: 92
4: 732
Right 1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG 0: 1
1: 0
2: 5
3: 36
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151797821 Original CRISPR GTACCTGAGGAGGGAAGTGA AGG Intronic
901402855 1:9026221-9026243 AGACCTGTGGAGGGAGGTGAAGG - Intronic
901524005 1:9807902-9807924 GTACCAGAGAAGGGTTGTGAAGG - Intronic
902283028 1:15388294-15388316 GGGCCTGGGGAGGGAAGGGAAGG - Intronic
902549635 1:17211704-17211726 GTAAGTGAGGGGTGAAGTGAAGG + Intronic
902797122 1:18807182-18807204 GCACAGGAGGAGGGAAGGGAGGG + Intergenic
903033154 1:20477553-20477575 CTAACCGGGGAGGGAAGTGAGGG - Intergenic
904229102 1:29052275-29052297 GTAACAGAGGAGGGGAGAGACGG - Intronic
904240685 1:29142840-29142862 GTACCGGAAGAGTGAAGAGAAGG - Intergenic
904389746 1:30174466-30174488 GTAGATGAGGAGGGAAGAAATGG + Intergenic
904400722 1:30254751-30254773 GAACCTGAGGAGGAAAGTGAGGG + Intergenic
904725084 1:32540582-32540604 GTGCCTTAGGAGGGAAGGCAGGG - Intronic
905405631 1:37730525-37730547 GAACCAGGGGAGGGAAGTAAAGG + Intronic
905481782 1:38266746-38266768 GTTCCAGAGGAGGGATGTGGAGG - Intergenic
905838211 1:41149150-41149172 GTCCCAGAGGAGAGAAGTGATGG - Intronic
906163140 1:43665884-43665906 TTACCTTAAGAGGGCAGTGACGG + Intronic
907278963 1:53332496-53332518 GTAAGTGAAGAGGAAAGTGAAGG - Intergenic
907921775 1:58920714-58920736 GAAACTGAGGAGCAAAGTGATGG + Intergenic
909042992 1:70675917-70675939 GTTCCTGAGGGGGTATGTGACGG + Intergenic
910165853 1:84326555-84326577 TGACCTGAGGAGGCAAGTGGGGG + Intronic
910471457 1:87557607-87557629 GTACCAGAAGAGGGAAGTGAAGG - Intergenic
910555915 1:88532636-88532658 GTATCTAGGCAGGGAAGTGAAGG + Intergenic
911069384 1:93820444-93820466 GAACCTGAGGAGGGAATTTGGGG - Intronic
913052501 1:115129842-115129864 CTACATGAGGTGGGAAGAGAAGG - Intergenic
913300066 1:117360929-117360951 GTAGGGGAGGAGGGAAGGGAAGG - Intergenic
915130439 1:153692033-153692055 GTGGCTGAGGAGGTCAGTGATGG - Intronic
915545321 1:156593770-156593792 GTTCCTCAGGTGGGAACTGAGGG + Intronic
916070324 1:161166225-161166247 GGTCCTGAGGAGGGCAGTGACGG + Intergenic
916584003 1:166134037-166134059 GAACCTGAGGAGGGAGGTAGTGG - Intronic
916832564 1:168508035-168508057 TTACCTGGGGAGGGAATTCAGGG - Intergenic
917243345 1:172973430-172973452 GTACCTGCTGAGGGAAGAGAAGG + Intergenic
920312239 1:205055365-205055387 GTAGCTGAAGAGGCAAGTGTGGG + Intronic
920364329 1:205440164-205440186 GTCCCTGAGGAGGGGAGTCAGGG + Intronic
922941302 1:229469471-229469493 GTAGCTGAGGAGTTCAGTGAAGG + Intronic
924548390 1:245051492-245051514 GGAGATGAGGAGGGAAGGGAGGG + Intronic
924609508 1:245562192-245562214 GGACCTGGGGAGGGTAGGGAAGG + Intronic
1062951095 10:1504152-1504174 GGACCTCAGCATGGAAGTGAAGG - Intronic
1064418845 10:15173017-15173039 GTAACTGATGAAGAAAGTGAGGG + Intergenic
1066302500 10:34109199-34109221 GCACCTGAGGAGAGAGGGGAAGG - Intergenic
1067483751 10:46625631-46625653 GTAGCTGAGGAGGGAAGGGAAGG - Intergenic
1067611004 10:47716011-47716033 GTAGCTGAGGAGGGAAGGGAAGG + Intergenic
1068931651 10:62596480-62596502 GTAGTTGAGAAGGGAAATGAAGG - Intronic
1069844580 10:71362223-71362245 GTACAGGAGGAAGGTAGTGAGGG - Exonic
1070908083 10:80092166-80092188 GTACCACAGAAGGGAAATGAGGG - Exonic
1071613682 10:87055296-87055318 TTAGATAAGGAGGGAAGTGAGGG + Intronic
1071626419 10:87176249-87176271 GTAGCTCAGGAGGGAAGGGAAGG + Intronic
1071803620 10:89092697-89092719 CTACCAGGGCAGGGAAGTGAGGG - Intergenic
1071820671 10:89277148-89277170 GAAACAGAGGAGGAAAGTGATGG + Intronic
1072003344 10:91219163-91219185 GTACCTGAGGATGAATGTGGAGG - Intronic
1072590362 10:96823426-96823448 TTACCTGAGGAGTGAAGTAAAGG + Intergenic
1072898612 10:99388192-99388214 GTACCTGAGGATGGAGGAGCTGG + Exonic
1073573864 10:104604657-104604679 GTACCTGCTGAGGAAAGTGATGG - Intergenic
1074498136 10:113997692-113997714 GCACGTGGGGAGAGAAGTGAGGG - Intergenic
1074697486 10:116063250-116063272 ATACCTGTGGAGGGAACTGGTGG - Intronic
1074981176 10:118621080-118621102 GCCCCAGAGGAAGGAAGTGAGGG - Intergenic
1075133355 10:119759838-119759860 GTACCTGAGGAGAGAAGAAAAGG - Intronic
1076068759 10:127469390-127469412 GTACCTGTGGAAGGAGGTGATGG - Intergenic
1076889371 10:133276397-133276419 TTAGCCGAGGAGGGAAGGGAGGG - Intronic
1076931417 10:133534319-133534341 GGACGTGAGGAGGGAAGTCCAGG + Intronic
1077468164 11:2743537-2743559 GAACTTGAGCAGGGAAGGGAAGG + Intronic
1077898650 11:6473343-6473365 GTACCAGAGGATGGAAGGGGCGG + Intronic
1079225652 11:18602523-18602545 TTTCCTGAGAAGGGAAGAGAAGG - Intergenic
1079537816 11:21536256-21536278 CTGCCTGAGGAGGGAAGAAAGGG - Intronic
1083023759 11:59532565-59532587 GTCCGTGGGGAGGGCAGTGAAGG - Intergenic
1083438103 11:62656905-62656927 GGCCCTGAGAAGGGAAGTGTTGG - Intronic
1083588221 11:63875851-63875873 GTGTATGGGGAGGGAAGTGATGG - Intronic
1085081498 11:73638345-73638367 GTTCCAGAGGAGGGAATGGAGGG + Intergenic
1089246573 11:117125135-117125157 GGAGATGAGGAGGGAAGAGAGGG + Intergenic
1090075915 11:123579936-123579958 GGAACTGAGGAGGGAGGTGCTGG + Intronic
1090119991 11:124015945-124015967 GTACCTGAGCGGGTAACTGATGG - Exonic
1090120636 11:124023383-124023405 GTACCTGAGCGGGTAACTGATGG - Exonic
1090121203 11:124029993-124030015 GTACCTGAGCGGGTAACTGATGG - Exonic
1090121876 11:124038609-124038631 GTACCTGAGCGGGTAACTGATGG + Exonic
1090706026 11:129337723-129337745 ATACCTGAGGAGGGGATTGTGGG - Intergenic
1090967443 11:131611168-131611190 GCACCTGAGGAGGGAAAAGGTGG + Intronic
1092245284 12:6860629-6860651 GCACCTGAGGAGGACAGTGAAGG + Intronic
1092807350 12:12236667-12236689 GAACCTGAGGAGGGGATTGTGGG - Intronic
1094023773 12:25941477-25941499 GGGCCTGGGGAGGGAAGAGAAGG + Intergenic
1094549251 12:31435126-31435148 GTACGGGAATAGGGAAGTGAGGG - Intronic
1095726485 12:45459058-45459080 GTACCTTATGAGGGCTGTGAAGG - Intergenic
1096604187 12:52753298-52753320 GTACAAGAGGAGGTAAGTGATGG - Intergenic
1097008132 12:55933352-55933374 AAACCAGAGGAGGGAAGGGAAGG + Intronic
1097499147 12:60379993-60380015 ATACCTAACAAGGGAAGTGAAGG + Intergenic
1098728959 12:74008267-74008289 GAAGCTGAGAAGGGTAGTGAGGG + Intergenic
1098886866 12:75969383-75969405 GTGCTTGAGGAAGGAAGTGATGG - Intergenic
1099930564 12:89069399-89069421 GAAGCTTGGGAGGGAAGTGAGGG - Intergenic
1101376425 12:104175253-104175275 GAAATTGAGGAGGGAGGTGATGG + Intergenic
1101732552 12:107438683-107438705 GAACCTGAGAGGGGGAGTGAGGG - Intronic
1102677621 12:114669050-114669072 GTACAGGATGAGGGAAGGGAGGG + Intergenic
1104058270 12:125246760-125246782 GTTCCTGTGGACAGAAGTGATGG + Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106436763 13:29730223-29730245 CTACCAGAGGAAGGAAGAGAAGG - Intergenic
1106549640 13:30760243-30760265 GAACCTGGGGTGGGAAGTGGAGG + Intronic
1108185079 13:47880576-47880598 GTGGCTCAGGAGGAAAGTGATGG + Intergenic
1108540530 13:51440507-51440529 GTTCGTGATGAGTGAAGTGAAGG - Intronic
1112386708 13:98946562-98946584 GTCTCTGGGGAGGGAATTGAGGG - Intronic
1113619168 13:111701339-111701361 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1113624697 13:111786600-111786622 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1113770248 13:112903688-112903710 GTCACTGACAAGGGAAGTGATGG - Intronic
1114314922 14:21500909-21500931 GTACCTGAGGTGGGAAGAGTCGG + Exonic
1114522478 14:23347932-23347954 GTAGTTGAGGAGGGAAGCAAAGG + Exonic
1115026956 14:28757190-28757212 GGACGTGAGGAGGAAAGGGAGGG + Intergenic
1115437582 14:33393129-33393151 GTACCTGTTGAGGGAAGTGAGGG + Intronic
1116024653 14:39500325-39500347 GAAACTGGGGAGGGAAGGGAGGG - Intergenic
1116040955 14:39686070-39686092 GTTTTGGAGGAGGGAAGTGAAGG - Intergenic
1116807724 14:49510031-49510053 TTACCTTAGAAGGGAAGAGAGGG - Intergenic
1117328200 14:54687999-54688021 ACACCTGAGGAGGGAAGAAAAGG + Intronic
1118629998 14:67694228-67694250 TTTTCTGAGGAGGGAGGTGATGG - Intronic
1118810419 14:69269183-69269205 GTTCCTAAGGAGGTAAGTGTAGG + Intronic
1119113936 14:72000678-72000700 GTACCAGAGGAGTCAAGTTAGGG + Intronic
1119612461 14:76075083-76075105 GTCCCTGAGGAGGCATGCGATGG - Intronic
1120458453 14:84762542-84762564 ATACCTGAGCAGGAATGTGAAGG + Intergenic
1121519100 14:94573698-94573720 GAACCTGAGGAGGGAGTTGTGGG - Intronic
1124465372 15:29934521-29934543 GGGGCTGAGAAGGGAAGTGAGGG - Intronic
1125196066 15:37047415-37047437 GTATCACAGGAGGGAAATGATGG - Intronic
1125305069 15:38302685-38302707 GTGCCTGAGGAGAGAAGAGTTGG + Intronic
1125556228 15:40587641-40587663 GTTCCTTAGGAGGGGTGTGAGGG - Intergenic
1126341500 15:47645785-47645807 GAACCTGAGGAGGGAGTTGTGGG - Intronic
1127398406 15:58562212-58562234 GAGGCTGAGGAGGGACGTGAGGG - Intronic
1127988087 15:64090561-64090583 GAACTAGAGGAGGGAAGAGAGGG + Intronic
1128742656 15:70095057-70095079 ATCCCTGAGGAGGGGAGTGGAGG + Intronic
1130297011 15:82654512-82654534 GTACCTTCAGAGGGAAGTCAGGG - Intergenic
1130774296 15:86961881-86961903 ATTCCTGAAGAGGGCAGTGAAGG + Intronic
1131146700 15:90018659-90018681 GTAGCTGAGTGGGGAGGTGAGGG - Intronic
1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG + Intronic
1133478107 16:6142917-6142939 GTAACAGAGGAGGGAAGAGAGGG - Intronic
1134857327 16:17531280-17531302 GTACATGGGGAGGGGGGTGAGGG - Intergenic
1135261848 16:20987846-20987868 GTACCTTGGGAGGAAAGGGATGG + Exonic
1135489002 16:22891733-22891755 GTCTCTGAGGAGGGAACTGAAGG - Intronic
1135502493 16:23008752-23008774 ATAATTGGGGAGGGAAGTGAGGG + Intergenic
1136014110 16:27383896-27383918 GGATCTCAGGAGGGGAGTGATGG - Intergenic
1136445112 16:30312425-30312447 AAACCTGATGAGGGAAGTGTGGG - Intergenic
1137389272 16:48067874-48067896 GTTCCTGAGGGGAGAAGTCAAGG + Intergenic
1139332292 16:66202735-66202757 GTCCTGGAGAAGGGAAGTGATGG + Intergenic
1141197237 16:81869125-81869147 CTGCCTGAGGTGGGAACTGATGG + Intronic
1142121697 16:88389737-88389759 TTCCCTGAGTAGGGAAGTCAAGG + Intergenic
1143139714 17:4734806-4734828 GAAGCTGTGGAGGGAGGTGAGGG - Intronic
1143313644 17:6014377-6014399 AAGCCTGAGGAGGGAGGTGAGGG + Intronic
1143900656 17:10172242-10172264 GGACCTGAGGAGTGGAATGAGGG - Intronic
1144213745 17:13036479-13036501 ATACCTGTGGAAGGAAGGGAAGG + Intergenic
1147338986 17:39742724-39742746 GTCCCTCAGAAGGGAAGGGAGGG + Intronic
1148399706 17:47345894-47345916 GTATTTGAGGAGAGTAGTGAAGG - Intronic
1149348997 17:55768412-55768434 GTATGTGAGGAGGTAAGAGAGGG + Intronic
1149745483 17:59093554-59093576 GTATCTGAAGGGGGAAGTGTAGG - Intronic
1150210781 17:63440370-63440392 GATGCTCAGGAGGGAAGTGAGGG - Intronic
1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG + Intronic
1152142918 17:78548974-78548996 GGACGTGATGAGGAAAGTGATGG + Intronic
1152489319 17:80618912-80618934 GTGCTTGGGGATGGAAGTGAGGG + Intronic
1156160177 18:34350322-34350344 ACACCTAACGAGGGAAGTGAAGG + Intergenic
1156267562 18:35502259-35502281 ATAACTGAGGAGGGAACTTAGGG - Intergenic
1156446313 18:37239567-37239589 GAACTTGAGGAGAGAAGGGAGGG + Intergenic
1156603544 18:38639105-38639127 GAACCTGGGGAGAGAAGGGATGG + Intergenic
1157325864 18:46668508-46668530 TTACTTGGGGAGGGAAGTGGCGG + Intronic
1160812600 19:1019445-1019467 GCACCTGAGCAGGGCTGTGAAGG - Intronic
1160965367 19:1744939-1744961 GTCCCTGATGTGGGAAATGAAGG + Intergenic
1161355075 19:3814520-3814542 GGCCCTGAGAAGGGAAGGGATGG - Intronic
1162535946 19:11262732-11262754 GAGGCTGAGGAGGGAAGTTAGGG + Intergenic
1163109100 19:15147615-15147637 GCACCTGGGGTGGGAAGAGAAGG - Intergenic
1164756837 19:30695925-30695947 GTTCCTAAGGAGGGAAGCGAGGG + Intronic
1165812946 19:38623293-38623315 GTACCTGTTGCGGGAAGTCAGGG - Intronic
1166052028 19:40266083-40266105 GTCCCTGAGGACAGAAGTGAAGG - Intronic
1166676786 19:44745945-44745967 GCATCTGAGGAAGGAGGTGAGGG - Intergenic
1166912225 19:46167220-46167242 GTACCTGTTGCGGGAAGTCAGGG - Intergenic
1167298810 19:48667475-48667497 TTACCTAAGCAGGGGAGTGAGGG - Intronic
1167591355 19:50406163-50406185 GTACCTGAGGAGGAGAGGCAGGG - Exonic
1168283701 19:55320219-55320241 GGACCCAGGGAGGGAAGTGAGGG + Intronic
924998392 2:384731-384753 GAACCTGAGGTGGGCAGTGGTGG + Intergenic
925099266 2:1231620-1231642 GAAACAGAGGAGGGAGGTGAAGG - Intronic
926162666 2:10499860-10499882 GACCCTGAAGAAGGAAGTGAAGG + Intergenic
926673743 2:15601456-15601478 GAACCTGAGGAAGGAATTGTAGG - Intronic
926900695 2:17748677-17748699 GTAACTGAGAAGGGAATAGAGGG - Intronic
926956800 2:18310733-18310755 GTGCCTATGGAGGGAAGTGGTGG + Intronic
927277223 2:21272357-21272379 GTGGGTGAGGAGGGACGTGATGG + Intergenic
929092819 2:38236444-38236466 GTACTTGAGGATGGAAGAGAAGG + Intergenic
932824230 2:74925271-74925293 GGACCTGAGAGGGGAAGAGAAGG + Intergenic
933720128 2:85392424-85392446 GTACCTGAGCTGGGGAGTGGGGG + Intergenic
934662459 2:96150348-96150370 GTATCTAAGGAGGGAAGAGGAGG + Intergenic
937314181 2:120920497-120920519 GTTAGTGAGGAGGGCAGTGAGGG - Intronic
937422741 2:121772029-121772051 GTGCCTGAGGCTGGAGGTGAGGG + Intergenic
937834995 2:126462575-126462597 GAACCTGAGGAGGGAGTTGTGGG - Intergenic
938096020 2:128464688-128464710 CTTCCTGAGAAGTGAAGTGAGGG - Intergenic
938391781 2:130912321-130912343 GTCCCAGAGGAGAGAAGTGAAGG - Intronic
940129788 2:150368486-150368508 GTATCTGACCAGGGAACTGAGGG + Intergenic
941765187 2:169289015-169289037 GTACCTGTGTTGGTAAGTGATGG - Exonic
941872191 2:170397837-170397859 CAACCTGAGGAGGGAATTGTGGG - Intronic
942037651 2:172026309-172026331 ATACTTCAGGAGGGAAGTGATGG - Intronic
942871746 2:180742625-180742647 GTCCCTGAGGTGGGAGATGAAGG - Intergenic
943707126 2:191047336-191047358 GAACCTGAGGAGGGAATTGTGGG + Intronic
945947968 2:216012949-216012971 CTACCTGGGCAGGGAAGTAAGGG - Intronic
946391042 2:219417373-219417395 GTACCTGAGGAGGCATGGGTGGG - Intergenic
946569255 2:221003994-221004016 AGGCCTGAAGAGGGAAGTGAGGG + Intergenic
946663534 2:222026614-222026636 GTACGTGGGAAAGGAAGTGAGGG + Intergenic
947817033 2:233044506-233044528 ATACCTGGGGTGGGAGGTGATGG + Intergenic
948519160 2:238524630-238524652 GCTCTTGAGGTGGGAAGTGACGG - Intergenic
948818571 2:240526557-240526579 GTACCTGAGGAGTGAACAGTGGG - Intronic
1168770085 20:408907-408929 GTACCAAAGGAGGAAACTGATGG - Intronic
1169125306 20:3122987-3123009 GTATCTGGGGAGAGAAGTGCAGG + Intronic
1170075066 20:12410292-12410314 GAACCTGAGGAGGGGAGGGTGGG + Intergenic
1170282516 20:14666474-14666496 GTACCTTAGAAGGTAAATGAGGG - Intronic
1171284074 20:23923485-23923507 GAACGTGAGCAGGGAAGAGAAGG + Intergenic
1171498816 20:25577417-25577439 TGACCTGAGGAGGGATGTGCTGG - Intronic
1172023752 20:31934303-31934325 GGAGCTGGGGAGGGAAGAGAAGG - Intronic
1172113920 20:32562873-32562895 GTTCCTAAGGAGGGCAGGGAGGG + Intronic
1172656765 20:36542465-36542487 GCACCTGAAGGGGGAAGCGATGG + Intronic
1172835684 20:37871686-37871708 ATACATGAGGGCGGAAGTGAAGG + Intronic
1173435267 20:43026733-43026755 GAAGCTGGGAAGGGAAGTGAGGG - Intronic
1173453806 20:43188723-43188745 GTAGCGGCGGAGGGAAGAGAAGG - Intronic
1173530827 20:43768135-43768157 GTCCCTGAGGAGGAGAGAGAGGG + Intergenic
1173747163 20:45446624-45446646 AGCCCTGAGGAGGGAAGTGTGGG - Intergenic
1173765038 20:45599565-45599587 GGACCTGAAGAGGGGAGAGAAGG - Intergenic
1173800623 20:45892254-45892276 GGACCTGAGGAGGAAAGAGATGG - Exonic
1174168570 20:48602026-48602048 GCACCAGGGGAGGGAGGTGAAGG + Intergenic
1175210316 20:57350202-57350224 GCATCTGAAGAAGGAAGTGAAGG - Intergenic
1175767468 20:61601402-61601424 GCACCAGAGGAGGGAAGCCAGGG - Intronic
1176071631 20:63229668-63229690 GTAACTGAGGAGATCAGTGAGGG + Intergenic
1177676398 21:24306598-24306620 ATAGCTGAGGAGTGAGGTGATGG + Intergenic
1178411164 21:32364890-32364912 GCACCTGTGGAGGGAAGGCAAGG + Intronic
1179767157 21:43582438-43582460 GTACCTGTTGAGGGAGATGAGGG + Intronic
1179767247 21:43582844-43582866 GTACCTGTTGAGGGAGATGAGGG + Intronic
1179767356 21:43583348-43583370 GTACCTGTTGAGGGAGATGAGGG + Intronic
1180040794 21:45278502-45278524 GTGCCTGAGGAGGGGAGGGTGGG + Intronic
1180857767 22:19059115-19059137 GTAGGTGATGAGGGTAGTGAAGG + Intronic
1181527330 22:23497519-23497541 GCACCTGAGCAGGGCATTGAGGG - Intergenic
1183014844 22:34977587-34977609 GTCACTGAGGTGGGAAGGGAGGG + Intergenic
1183284473 22:36953480-36953502 GTGCAGGAGGAGGGAAGTGAAGG + Intergenic
1183641744 22:39097037-39097059 GTACCTGGAGAGGGAATTGGGGG + Intergenic
1183925913 22:41205714-41205736 TTACATGAGGTGGGAAGTGAAGG + Intronic
1184217456 22:43077189-43077211 GTACCTGGGGAAGCAGGTGAGGG - Intronic
1184219274 22:43088909-43088931 GTACCTGTGGAGAGAACTCAGGG - Intronic
1184459041 22:44626857-44626879 TCACCTGAGGAGGGAAGAGCTGG - Intergenic
1184491880 22:44814653-44814675 GTACCTGAGGAGGGAAACGGGGG - Exonic
1185176891 22:49332945-49332967 CTACATGAGGAAGGAACTGATGG + Intergenic
1185270847 22:49928821-49928843 GTACCTGGGGGAGGAAGAGAGGG + Intergenic
949953145 3:9246067-9246089 GTATCTGATGAGGCAAGAGAAGG + Intronic
953008138 3:38996986-38997008 GTAACTGAGCGGGGAACTGATGG - Intergenic
954101114 3:48373334-48373356 TTACCTGTGGAGGTAAGGGAAGG + Exonic
955778925 3:62462999-62463021 GTCACTAAGGAGGGAAGTTACGG + Intronic
959998439 3:112704203-112704225 ATACCTAAGGAAGGAGGTGAAGG + Intergenic
960603601 3:119482130-119482152 GTACCTGAGGAGGGGGGGAAAGG - Intronic
960941913 3:122940579-122940601 TCAGCTGAGGAGGGAAATGAGGG + Intronic
961058352 3:123807944-123807966 ATATCTCAGGAGGGCAGTGAGGG - Intronic
961651813 3:128420706-128420728 GTACCGGAGGGGAGAAGTGGGGG + Intergenic
962422313 3:135239429-135239451 GTAAATGAGGAGGGGAGTGAGGG + Intronic
966574774 3:181488035-181488057 GAACCTGAGGTGGGCAGAGAAGG - Intergenic
966598921 3:181755464-181755486 CTACCTGAGGAGGCAGGTGATGG + Intergenic
966942712 3:184757053-184757075 CTGCCTGTGGGGGGAAGTGAGGG + Intergenic
968028355 3:195462091-195462113 TCAGCTGAGGAGGAAAGTGAGGG - Intergenic
968954656 4:3712087-3712109 GTCCCTGAGCTGGGAAATGACGG + Intergenic
969064703 4:4469530-4469552 GTACCTGAGAAGCGGTGTGAGGG + Intronic
970163220 4:13209901-13209923 GAACCTGAGCAGGGAAAGGAGGG + Intergenic
970950469 4:21749675-21749697 GCACATGTGGAGGGCAGTGATGG - Intronic
971234229 4:24826863-24826885 GTAGCTTAGCAGGGAAGAGAAGG + Intronic
971299591 4:25430850-25430872 GGCCCAGAGGAGGGAAGGGAGGG - Intergenic
973897543 4:55429840-55429862 TGACTTGAGGAGGGAAGTGCAGG + Exonic
974104726 4:57456763-57456785 CTACCTGATGACTGAAGTGAGGG + Intergenic
976392799 4:84523214-84523236 GTACCTGGGGAGGGTAAGGAGGG + Intergenic
977544321 4:98359016-98359038 GTACCTGAGGTGGGAGGTGGGGG + Intronic
978115513 4:105015819-105015841 TTACCTGAGAAGGGAAGTACAGG + Intergenic
978630151 4:110734675-110734697 GTGTCAGGGGAGGGAAGTGATGG + Intergenic
979268483 4:118731857-118731879 TAACCTGAGGAGGTAAGAGAAGG + Intronic
979479483 4:121199829-121199851 GTACCTGAGGACGGTTGTGTAGG + Intronic
981338965 4:143598295-143598317 GTACCTGGGCAGGGAAGAAAAGG - Intronic
982484553 4:155951895-155951917 GGACGGGAGGAGGGAAGTGGGGG - Intronic
984768207 4:183415631-183415653 GAAACTAAGGAGGGAAGGGAGGG - Intergenic
984816502 4:183842384-183842406 GTACTTGAGGAGGTAATTAAAGG - Intergenic
984959262 4:185078629-185078651 GTCCCTTGGGAGGCAAGTGAGGG + Intergenic
986278645 5:6304479-6304501 GGTCCAGAGGAGGGAAGGGAAGG + Intergenic
987670308 5:20998608-20998630 GGACCTGAGAAGGGAAGGGCAGG + Intergenic
988713813 5:33804594-33804616 TAGGCTGAGGAGGGAAGTGATGG - Intronic
988821693 5:34892817-34892839 GTACCTAAGGAGGGACGTGCTGG + Intronic
989261315 5:39422958-39422980 TTACCTGAGGATGTAAGTGAGGG - Intronic
991702215 5:69326952-69326974 GAGCCTGAGGTGGGAAGTCAAGG + Intronic
992985387 5:82223870-82223892 GTAGATGAGGAAGGAAATGAGGG + Intronic
993380952 5:87207202-87207224 GGACCTTGGGAGGGAGGTGAGGG - Intergenic
994328400 5:98476655-98476677 GTACCAGAGAAGAAAAGTGATGG + Intergenic
996140478 5:119902951-119902973 GCTCCTAAGGAGGGAAGTTAAGG - Intergenic
996533149 5:124547139-124547161 CTAACTGAGAATGGAAGTGATGG + Intergenic
997115659 5:131123216-131123238 GTACCTGTTGCGGGAAGTCAGGG + Intergenic
997178292 5:131801414-131801436 GTACTTTAGGAGAGAATTGATGG + Intergenic
1001283003 5:170401422-170401444 GTCTCTAAGGAGGGAAGTGAAGG + Intronic
1001561084 5:172669435-172669457 GTAGCTGTGGAGGGATTTGATGG + Intronic
1001671236 5:173475730-173475752 CAAACTGAGGAGTGAAGTGAAGG - Intergenic
1002294199 5:178220622-178220644 GTACCTGAGGGTGGAATTGCTGG - Intronic
1002378746 5:178809135-178809157 ACACGTGAGGAGGGATGTGAAGG + Intergenic
1002453409 5:179332036-179332058 GAACCTGAGGAGGGAGTTGTGGG - Intronic
1003336363 6:5176540-5176562 GTTCCTGAGGAGGGGAGGAACGG - Intronic
1003341124 6:5221738-5221760 CTACCTGAGGAAGGAAGTATTGG - Intronic
1003551714 6:7107340-7107362 GAAACTGCGGAGTGAAGTGATGG + Intergenic
1005583344 6:27253125-27253147 GTGCGTGAGGAGGCATGTGAGGG - Intronic
1005603970 6:27456815-27456837 GTACCTGTGCAGGTAAGTCATGG - Exonic
1005997572 6:30940722-30940744 GCCCCAGTGGAGGGAAGTGAGGG - Intergenic
1006478968 6:34276484-34276506 GCACCTGAGTAGGGAAAGGAAGG - Intergenic
1008935888 6:56991830-56991852 GTACCTGTGGAGGGGAGTGTGGG - Intronic
1009549152 6:65064775-65064797 CTACCTGAGGAGGGAATAGAGGG - Intronic
1009706773 6:67262319-67262341 ATACCTAACCAGGGAAGTGAAGG - Intergenic
1011636935 6:89383227-89383249 TTAACTGAGGAGGGGAGTTAAGG + Intronic
1013383969 6:109605767-109605789 GTACCTGAGGATGCAAGTTTTGG + Intronic
1014847915 6:126302321-126302343 TGACCTTAGGAAGGAAGTGAGGG + Intergenic
1015038990 6:128693434-128693456 GTAGCTGAGGCAGGAAGTGATGG - Intergenic
1016466072 6:144327015-144327037 GTACCTGAGAAGGGATGTTTCGG + Intronic
1016607571 6:145949576-145949598 GAAACTCAGAAGGGAAGTGAGGG + Intronic
1016981083 6:149854786-149854808 GCCCCTGTGGAGGAAAGTGATGG - Intronic
1017072791 6:150591033-150591055 GTCCCTGAAGAGAGAACTGAGGG - Intergenic
1017359235 6:153546523-153546545 GCACATCAGAAGGGAAGTGATGG + Intergenic
1018779724 6:167052318-167052340 GAACCTGAGACTGGAAGTGAGGG + Exonic
1019062374 6:169265682-169265704 GCACTTGAGGAAGGAAGTGCAGG + Intergenic
1019318799 7:405584-405606 CCACCTGCTGAGGGAAGTGAGGG + Intergenic
1019564399 7:1672229-1672251 GGACCAGAGGAGGGGAGGGAGGG + Intergenic
1020934406 7:14443249-14443271 GTAACTTTGGAGAGAAGTGATGG - Intronic
1021602649 7:22379464-22379486 ATGCCTAAGCAGGGAAGTGAAGG - Intergenic
1021760982 7:23903147-23903169 GTGCGTGGGGAGGGAGGTGATGG + Intergenic
1023217218 7:37875802-37875824 GTACCTAAGGAGGGAATTACTGG + Intronic
1023669544 7:42561328-42561350 CTACCTGAGGATGGAGGTGGTGG - Intergenic
1023820045 7:43975513-43975535 TTGCTGGAGGAGGGAAGTGAGGG - Intergenic
1025116018 7:56258925-56258947 GAAAATGAGGAAGGAAGTGAGGG - Intergenic
1028744081 7:94307811-94307833 TTATCTCAGGAGGGAAATGAGGG - Intergenic
1029504070 7:100951517-100951539 TGACCAGAGGAGGGAAGGGAGGG + Intronic
1029658239 7:101941634-101941656 CTACCAGATGAGGGAAGAGAGGG - Intronic
1029748324 7:102528966-102528988 TTGCTGGAGGAGGGAAGTGAGGG - Intergenic
1029766271 7:102628053-102628075 TTGCTGGAGGAGGGAAGTGAGGG - Intronic
1030079261 7:105763214-105763236 GAACCTAAGAAGGGAATTGAAGG - Intronic
1031358796 7:120822110-120822132 GTATCTGAGGAGGAAAGGAAGGG + Intronic
1032364342 7:131285251-131285273 TTCCCTGAGGAGTGATGTGAAGG + Intronic
1035059667 7:156059643-156059665 GGACCTGAGCAGGGCACTGAAGG - Intergenic
1035932475 8:3797433-3797455 TTGCCTGTGGAGGGAAGGGATGG - Intronic
1036778118 8:11627694-11627716 ATATCTTAGGAGGGCAGTGAGGG + Intergenic
1037960123 8:23091370-23091392 GTTCCAGACGAGGGAAATGAGGG + Intronic
1039628637 8:39083147-39083169 ATAACTGATGTGGGAAGTGAGGG - Intronic
1039632395 8:39126385-39126407 GCAGCTAACGAGGGAAGTGAAGG - Intronic
1039956724 8:42213243-42213265 GAAACTGCGGAGGGAAGAGAAGG + Intergenic
1040469637 8:47726628-47726650 CTTCCTGAGGAAGGGAGTGAGGG - Intronic
1041224468 8:55684987-55685009 GTACCTGAGGTTGAAGGTGAAGG + Intergenic
1041346499 8:56904223-56904245 GAAACTGAGGATGGCAGTGATGG - Intergenic
1041573929 8:59371083-59371105 GGACGGGAGGAGGGAAGGGAAGG - Intergenic
1041719755 8:60965287-60965309 GAATCAAAGGAGGGAAGTGAGGG + Intergenic
1043377191 8:79663858-79663880 CTTCCTGAGGAGGGAACTGATGG - Intronic
1043658905 8:82709788-82709810 GTACCTGAGGAGACAAGGTAAGG - Intergenic
1044127707 8:88478641-88478663 GTAGCTAACAAGGGAAGTGAAGG + Intergenic
1045273189 8:100679341-100679363 GGACCTGGGGATGGAAATGAGGG + Intergenic
1045532779 8:103000358-103000380 GTGCCAGAACAGGGAAGTGAAGG + Intergenic
1045687873 8:104729858-104729880 GGGCCTGAGAAGGGAAGAGAAGG + Intronic
1047691861 8:127363912-127363934 GTAAATGAGAAAGGAAGTGATGG - Intergenic
1048050537 8:130811934-130811956 GTAACTCAAGAGGGAACTGAAGG - Intronic
1048612585 8:136040019-136040041 ATACCTGAGGAGGCAGGAGAAGG - Intergenic
1048696541 8:137034769-137034791 GTTCCTTAGGAGGGAGGTGAGGG - Intergenic
1049490746 8:142900188-142900210 ATCCCTGAGGAGGACAGTGAAGG - Intronic
1050274323 9:3981088-3981110 GTAGCGGAGGAGAGAAGTTAGGG - Intronic
1051473155 9:17472938-17472960 CTGCATGAGGAGGGAAGTAAGGG - Intronic
1051480397 9:17553971-17553993 GTAAATTAGGAGGGAAGGGAAGG - Intergenic
1053150316 9:35739050-35739072 GTACCTGATGAGTGGGGTGATGG - Exonic
1056093977 9:83232488-83232510 GTACCAAAGGAGGGAATTTAGGG - Intergenic
1056386828 9:86103758-86103780 GTACCTGAGAAAGGAAATAATGG - Intergenic
1056850117 9:90076624-90076646 GTTCCAGAGGAGGGGAGGGATGG - Intergenic
1057794423 9:98145310-98145332 GGACCAGAAGTGGGAAGTGAGGG - Intronic
1059129799 9:111734967-111734989 CTACTAGAGGAGGGAAGTGGGGG - Intronic
1060478959 9:124006548-124006570 CTCCCGGAGGAGGGAAATGAGGG - Intronic
1060867585 9:127012432-127012454 GTCCAAGAGGAGGGAAGGGAAGG - Intronic
1061181079 9:129025658-129025680 AGAGCTGAGGAGGGATGTGAGGG - Intronic
1061273813 9:129558323-129558345 GTGGCTGAGGAGGGGACTGAGGG - Intergenic
1062172504 9:135143234-135143256 GTTCCTCTGAAGGGAAGTGAAGG + Intergenic
1062616588 9:137399358-137399380 GTTCCTGAGGACAGAACTGAGGG - Intronic
1062680301 9:137775524-137775546 AGGCCAGAGGAGGGAAGTGAGGG + Intronic
1187096070 X:16150052-16150074 GTACTTGTGGAGAGAAGAGAAGG + Intronic
1190488852 X:50960705-50960727 GAACCTGAGGGGGGAATTGTAGG - Intergenic
1196228952 X:113198870-113198892 GTAGCTAACAAGGGAAGTGAAGG - Intergenic
1199988186 X:152967466-152967488 GTGACTGAGAAGGGAAGTGGTGG + Intronic
1201751513 Y:17436762-17436784 ATAGCAGAGGAGGGAAGAGAAGG - Intergenic