ID: 1151798171

View in Genome Browser
Species Human (GRCh38)
Location 17:76360777-76360799
Sequence TCATTTTTACTGATGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151798171 Original CRISPR TCATTTTTACTGATGGGTCA GGG Intronic
904403465 1:30271970-30271992 TAATTTTTTCAGATGGTTCAAGG - Intergenic
904989681 1:34581896-34581918 TCACTATTACTCATGGTTCATGG - Intergenic
906075375 1:43048288-43048310 GCTTCTTTACTGATTGGTCATGG + Intergenic
907663006 1:56410872-56410894 TCATTTTTATTGCTTCGTCAAGG + Intergenic
908470741 1:64441541-64441563 TCATTTTCACTGGGTGGTCAGGG + Intergenic
909559305 1:76992073-76992095 TGATGATTACTAATGGGTCATGG - Intronic
909592262 1:77363801-77363823 GCATTTTTAATAGTGGGTCAAGG - Intronic
910042373 1:82868159-82868181 TAATTTTTACTGCTGCTTCAGGG + Intergenic
910155129 1:84208596-84208618 TTATTTTTACAGATGCGCCAAGG - Intronic
911727959 1:101262280-101262302 TCATGTTTCCTGATTCGTCAAGG - Intergenic
912216205 1:107615903-107615925 CCATTCTTACTGATGTGACATGG - Intronic
913710249 1:121475858-121475880 TCATGTTAACTGATGAATCAGGG - Intergenic
914408359 1:147400331-147400353 ACCTTTTTACTGCTGGGTGATGG + Intergenic
915463943 1:156085025-156085047 TCATTCTTGTTGGTGGGTCAGGG - Intronic
915592736 1:156879910-156879932 TTATTTTTAATGATGGGGCTGGG + Intronic
916456043 1:164971965-164971987 CTTTTTGTACTGATGGGTCAGGG + Intergenic
917173640 1:172206485-172206507 TAATTTTTACTGTTGTATCAAGG + Intronic
920086515 1:203421468-203421490 TCATATTTAGTTATGGGTAAAGG - Intergenic
920130957 1:203731486-203731508 TCCTTGTTACTTAGGGGTCAGGG + Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921400314 1:214715025-214715047 TCCTTTTTACTGCTGGGCAATGG + Intergenic
921896462 1:220406637-220406659 TCCTAGTTACTGATGGGGCAGGG - Intergenic
923008727 1:230071929-230071951 TCATTTTTGCTCAAGGGTCTAGG - Intronic
924555978 1:245118962-245118984 TCATTCTTGATGATGGGGCAGGG + Intronic
924575598 1:245277965-245277987 TCAATTTCACTGACGGCTCATGG + Intronic
924667892 1:246092301-246092323 TCCTCTTTTCTGATGGGTCTTGG - Intronic
1063254576 10:4312102-4312124 TCATTTTTACTGCTTCATCAGGG - Intergenic
1063768275 10:9168288-9168310 AGATTTTTACTGATAGTTCAAGG + Intergenic
1064503152 10:15996827-15996849 ACATATTTTCTTATGGGTCAAGG - Intergenic
1065043423 10:21721100-21721122 GCATTTTTAATCATGTGTCAGGG + Intronic
1065447451 10:25817925-25817947 TCATTTCTACAGATTGGGCAAGG + Intergenic
1066002828 10:31120196-31120218 TTGTTTTTTCTCATGGGTCATGG + Intergenic
1070642085 10:78177558-78177580 TCATTTTTCCTGAAGGGCTAGGG + Intergenic
1071199367 10:83201218-83201240 TCATTTTGACTGATGTGACATGG + Intergenic
1071206393 10:83284483-83284505 TTATTTTTCCTCATGGGGCAAGG + Intergenic
1071952477 10:90720586-90720608 TCATTTTCACTGATGGCTTCTGG - Intergenic
1072078789 10:92007177-92007199 TCATTTTTACTGCTCTATCAAGG + Intronic
1073622096 10:105060493-105060515 TCATTTTTACAGCAGGGTGAAGG + Intronic
1074367955 10:112875200-112875222 TCATTTTGACAAATGGATCATGG - Intergenic
1078237120 11:9495800-9495822 TCATTGTTACTCATTTGTCATGG + Intronic
1078284806 11:9941313-9941335 TTATTTTTACTGAAGAGACAGGG - Intronic
1078982141 11:16548446-16548468 TCATTTTTATGGAAGGGGCAGGG - Intronic
1081357462 11:42129824-42129846 TCATTTTTAACGATGGGAAATGG - Intergenic
1082616514 11:55367754-55367776 TCATTTTTACAAATGGGACATGG - Intergenic
1084011586 11:66353053-66353075 TCCTTTTTACTTCTGGGTAAAGG + Intronic
1085741527 11:79081740-79081762 TCAATTTTGCTGGTGGGGCAGGG + Intronic
1086118100 11:83275953-83275975 TTATTATTACCGATGGGACAGGG + Intronic
1086743023 11:90391463-90391485 TCATTTTTTCAGCTGTGTCATGG - Intergenic
1086862431 11:91940632-91940654 TCACTCTTATTGATGGGCCATGG - Intergenic
1086908385 11:92443728-92443750 TCATTTGTTCTGAAGTGTCATGG + Intronic
1087768281 11:102179870-102179892 TCATTTAAACTGAAGGGACAGGG - Intronic
1088206697 11:107400183-107400205 TCATTTTTTCTGCTGGGTTTGGG - Intronic
1088389746 11:109300867-109300889 TCATTTTTAAAGATGGGTGATGG + Intergenic
1088891177 11:114045718-114045740 TTATTTTTAGTCATGGGTGAGGG + Intergenic
1088950927 11:114569146-114569168 CCATTCTTACTATTGGGTCAGGG + Intergenic
1089615763 11:119693842-119693864 TCATTTTTAATGCTGGGAAAGGG + Intronic
1091812567 12:3411687-3411709 TCATCTTATCTAATGGGTCAAGG + Intronic
1095619470 12:44231987-44232009 TCATTTTTACAGAAGAGGCATGG - Intronic
1096731391 12:53615873-53615895 TTATTTTTAGAGATGGGTCTGGG - Intronic
1099708040 12:86181819-86181841 TGATTTTTATTGATGTGTTATGG + Intronic
1101440704 12:104702534-104702556 TGATGTTGACTGATGGGACATGG + Intronic
1102419230 12:112791005-112791027 TCATTTTCACAGATGGGACTTGG + Intronic
1102622483 12:114207350-114207372 TCAGTTTTACTGAAGGGTTTGGG + Intergenic
1103571692 12:121849135-121849157 TTATTATTATTGAGGGGTCATGG - Intronic
1103874143 12:124114392-124114414 TCACTTTAACAGATGCGTCAAGG + Intronic
1104359677 12:128121026-128121048 ACATTTTTACCCATGGGTTACGG - Intergenic
1104501504 12:129290650-129290672 TCATTTCTAATGAGGGGACAAGG + Intronic
1105656901 13:22451568-22451590 ACATTTTGACTGCTGGGACAGGG + Intergenic
1107004608 13:35594637-35594659 TCATTTTAAATGATGGCTTATGG - Intronic
1107582933 13:41811421-41811443 TCATTATTACTGAAGGGGTAAGG + Intronic
1108834582 13:54526883-54526905 TCATTATTTCTGATGGCTGAGGG + Intergenic
1109568782 13:64157732-64157754 TCATTTTTAATTTTGTGTCATGG - Intergenic
1114382041 14:22216875-22216897 CCATTTTTACTGATGTGAGAAGG - Intergenic
1115041979 14:28941514-28941536 GCATTTTTACCAATAGGTCATGG - Intergenic
1116244480 14:42392280-42392302 ACATTTTTACTAACTGGTCAAGG - Intergenic
1116774091 14:49159801-49159823 CCATCTTTGCTGATGGATCAGGG + Intergenic
1121970994 14:98355685-98355707 TCATTTCTTCTGAAGGTTCAGGG + Intergenic
1121999199 14:98632635-98632657 TGCTCTTTCCTGATGGGTCAGGG - Intergenic
1122127230 14:99585994-99586016 TCATTGTTACTGCTTGGTCTGGG - Intronic
1124682991 15:31753027-31753049 TCATTTTTACTGTTTCATCAGGG + Intronic
1125093518 15:35824506-35824528 ACATTTTTACTTATGGGACCAGG + Intergenic
1125680966 15:41529945-41529967 CCATTCTTTCTGAGGGGTCACGG + Exonic
1133334304 16:4996793-4996815 TAATTTTATCTGCTGGGTCAGGG + Intronic
1135634837 16:24066542-24066564 TCATTTTGACGGATGTGTCATGG - Intronic
1137731660 16:50694369-50694391 TCTTTTTCACTAAGGGGTCAGGG - Intronic
1138862082 16:60770963-60770985 TCATATTTACTGATTGTGCAAGG - Intergenic
1138902079 16:61285024-61285046 ATATTTGTACTGATGGTTCAAGG - Intergenic
1139086699 16:63595634-63595656 CCATTTTTGCTGTTGGGTAAAGG - Intergenic
1140675940 16:77329659-77329681 TCATTTTTAATTATGGGATATGG + Intronic
1141360810 16:83393496-83393518 TCATCTTTACTGACGTGCCATGG + Intronic
1144222753 17:13114808-13114830 TCATGTTTACTGAAGGGAAAGGG + Intergenic
1145857557 17:28176503-28176525 TCCTTTTTACAGATGGGAAATGG + Intronic
1148399608 17:47344641-47344663 ACATTTTTCCTGATAGGTGATGG + Intronic
1148598485 17:48876082-48876104 TCCATTTCACAGATGGGTCACGG + Intergenic
1148894051 17:50829857-50829879 TCATTTTTATTTTTGAGTCAGGG + Intergenic
1149457857 17:56802912-56802934 GCATTTTCACTGATGTGCCAAGG + Intronic
1151606340 17:75139214-75139236 TCATTTCTGCTGGTGGGACATGG + Intronic
1151798171 17:76360777-76360799 TCATTTTTACTGATGGGTCAGGG + Intronic
1152232932 17:79123932-79123954 CCATTTTTACAGAGGGGCCAAGG + Intronic
1152325907 17:79636344-79636366 CCAATTTTACTGCTGGGCCATGG + Intergenic
1156595378 18:38542497-38542519 TCATTCCTATTGATGGCTCAAGG - Intergenic
1156928854 18:42616786-42616808 TCTTTCTTTCTGGTGGGTCAAGG + Intergenic
1156951242 18:42900995-42901017 GCATTTTTACTGATGGTGCAAGG + Intronic
1158569764 18:58588194-58588216 CCATTTTTACTGATGCATCAAGG + Intronic
1168008122 19:53507590-53507612 CCAGGTTCACTGATGGGTCAGGG + Intergenic
926505326 2:13707332-13707354 TAATTTTTACTGCTGTGTCAGGG - Intergenic
926653675 2:15374460-15374482 TCATTTAAAATAATGGGTCAAGG + Intronic
927264605 2:21130855-21130877 TCATTTTTACTGCTAGATCAAGG - Intronic
927765503 2:25803597-25803619 TTTTTTTCACTGAAGGGTCAGGG + Intronic
929654187 2:43714008-43714030 TCTTAGTTACTGATGGGTTAGGG + Intronic
931725215 2:65103395-65103417 TCATTTTAACTGTTTTGTCAAGG + Intronic
933045602 2:77532885-77532907 CCATTTTTACTGATGTGAGATGG - Intronic
933402275 2:81813614-81813636 TCATTTTTACTGGAGGTTCCAGG + Intergenic
934697329 2:96409383-96409405 CCATTATTATTAATGGGTCATGG + Intergenic
936503880 2:113089063-113089085 TAATTTTTACAGAAAGGTCATGG + Intergenic
939739642 2:145889852-145889874 TCATTTTTTCTCATCTGTCAAGG - Intergenic
940214173 2:151287717-151287739 ACATGTTTACTGATGTGTCACGG - Intronic
941125381 2:161578314-161578336 TCCTTATTACTGCTGGGTGAGGG + Intronic
941472672 2:165908581-165908603 TCAGTTTTATTGATGTGTCCAGG - Intronic
941620247 2:167769573-167769595 TCAGTGTTAATGATGGGTGAAGG - Intergenic
942326147 2:174778670-174778692 TCACATTTACAGAAGGGTCATGG + Intergenic
943431538 2:187808995-187809017 TCATTTCTACTGCTGTGCCATGG - Intergenic
943923938 2:193746516-193746538 CCATTCTTACTGATGTGTGATGG - Intergenic
944916635 2:204367599-204367621 TCATTGTTTATGAAGGGTCAAGG + Intergenic
945245846 2:207716233-207716255 TCTTTTCCACTGATGGGTGAAGG + Intronic
945492602 2:210474366-210474388 ACATTATTACTCTTGGGTCAGGG + Intronic
945500160 2:210562823-210562845 TCATTTTTACTACTAGCTCAAGG + Intronic
946469931 2:219949671-219949693 TCATCAATACTGATGGCTCATGG - Intergenic
946581261 2:221130337-221130359 TCCTATTAACTGATAGGTCATGG - Intergenic
948088946 2:235274977-235274999 TCATTTTTAATGATTGGTGTAGG - Intergenic
1169077769 20:2772003-2772025 TCCTTTTTACTGATGGGCAAAGG - Intergenic
1171089632 20:22271657-22271679 TCATTTTCACTGAGGGATGAGGG - Intergenic
1173640174 20:44596305-44596327 TCATCTCTTCTGGTGGGTCAGGG + Intronic
1173905295 20:46623830-46623852 TCTATTTTACTGATGGGACATGG + Intronic
1175147460 20:56907690-56907712 TCATTTTGACTGGTGGATCAGGG - Intergenic
1176265902 20:64209216-64209238 TCATTGTTACTGGGGTGTCAGGG + Intronic
1177796641 21:25785488-25785510 TAATATTTACTGATAGGGCAGGG - Intergenic
1179204463 21:39261532-39261554 ACATTTGTACTGATGGATCATGG - Intronic
1180257183 21:46638676-46638698 TCAATTTTGCTGACTGGTCATGG + Intronic
1182462923 22:30495104-30495126 TCACTTTTACGGGTGGGTAAGGG + Intronic
1183874694 22:40769711-40769733 TCACTTCTTCTCATGGGTCAGGG + Exonic
949623856 3:5846734-5846756 TCATTTTTACTGTTGAGTTTTGG + Intergenic
951629589 3:24705148-24705170 TCTTTTTGACTCATTGGTCACGG - Intergenic
952305910 3:32145936-32145958 TCATTTCTAAAGATGGGTGACGG - Intronic
953243115 3:41167091-41167113 TCATTTTTCCTGATGGGTTTGGG - Intergenic
953340440 3:42130012-42130034 TCATTTTTTTTCATGGCTCAGGG + Intronic
955560614 3:60185293-60185315 TCATTGTTACTGAAGGTTCTGGG - Intronic
955990137 3:64617822-64617844 TCATTTTGAATGATGATTCATGG - Intronic
956316470 3:67943235-67943257 TCTTTTTTATTGTAGGGTCATGG + Intergenic
957382746 3:79454301-79454323 TCATTTTTATTTATTTGTCAAGG + Intronic
957443270 3:80280848-80280870 TCATTTTTACTGATGTGAGATGG + Intergenic
958499740 3:94889706-94889728 TCATTTTCATTGATTGTTCATGG + Intergenic
960460121 3:117923596-117923618 TGGTTTTCAGTGATGGGTCAAGG - Intergenic
960589337 3:119350433-119350455 TCAATTTTACTGACGGGAGATGG - Intronic
960794652 3:121472815-121472837 ACATTTTTACAGATGTTTCAGGG - Intronic
960873441 3:122273993-122274015 TCATTTTTACTGAGGCCTTAAGG - Intronic
962852184 3:139316433-139316455 TCATTTATACTGAACGGTCCAGG + Intronic
965177083 3:165348718-165348740 TTATTCTTATTAATGGGTCAGGG - Intergenic
967615643 3:191562174-191562196 GTATCTTTTCTGATGGGTCATGG + Intergenic
968436932 4:597847-597869 TATTTTTTTCTGATGGGTCTTGG + Intergenic
968964153 4:3761115-3761137 TCATTTTTAAAGACGAGTCAGGG - Intergenic
969541461 4:7792795-7792817 TCATTTTTACTGCTTCCTCAAGG + Intronic
972936291 4:44139974-44139996 GAATTTTCAGTGATGGGTCAAGG - Intergenic
973733581 4:53847770-53847792 TCATTGGTATTGCTGGGTCAAGG - Intronic
976487164 4:85621456-85621478 CCATTTTGACTGATGGGAGATGG + Intronic
977429039 4:96908423-96908445 TCATTTTTACATATGGTTCCAGG - Intergenic
978214983 4:106189172-106189194 TAATTTTTACAGATGGGTGGGGG + Intronic
978333335 4:107639531-107639553 TTATTTCTCCTGATGGGTCTGGG - Intronic
980087488 4:128406610-128406632 TCATTTTTTCTGCTGGGTTTGGG + Intergenic
982955226 4:161756705-161756727 TTATTTTTACTGATAGGGCCAGG + Intronic
983915674 4:173288360-173288382 TGATATTTACAGATGGGTCATGG + Intronic
986436557 5:7738317-7738339 TTATTTTTAGTGATTGCTCAAGG - Intronic
987693309 5:21296602-21296624 ACATTTTTACTGATGGCGAAAGG - Intergenic
987715419 5:21562777-21562799 TCATTTTTACATGTGGTTCAAGG - Intergenic
987869362 5:23593588-23593610 ATTATTTTACTGATGGGTCAGGG - Intergenic
988112311 5:26838587-26838609 TCATTCTTCCTGATGTCTCATGG - Intergenic
990856942 5:60279140-60279162 TCCTTATTACTGCTGGGTGAAGG + Intronic
991746968 5:69752954-69752976 ACATTTTTACTGATGGCGAAAGG + Intergenic
991750737 5:69802288-69802310 ACATTTTTACTGATGGCGAAAGG - Intergenic
991798570 5:70332896-70332918 ACATTTTTACTGATGGCGAAAGG + Intergenic
991826345 5:70628266-70628288 ACATTTTTACTGATGGCGAAAGG + Intergenic
991830026 5:70677185-70677207 ACATTTTTACTGATGGCGAAAGG - Intergenic
991890901 5:71332219-71332241 ACATTTTTACTGATGGCGAAAGG + Intergenic
992243791 5:74796728-74796750 TCATTTATACTGAAGGACCATGG + Intronic
992471215 5:77056617-77056639 TCATTTTTATAGATGGTTCAAGG - Intronic
992551053 5:77860500-77860522 TCACTGTCACTGATGGGGCATGG + Intronic
993355926 5:86907394-86907416 TCATTTTTATTTATGGGACTTGG - Intergenic
994455097 5:99996019-99996041 TCATCTATACTGTTGGTTCAGGG - Intergenic
997284547 5:132668762-132668784 TCCTTGTTTCTGGTGGGTCACGG - Intergenic
1000820622 5:165978530-165978552 TCATTTTCACTTATCAGTCACGG - Intergenic
1002893865 6:1363067-1363089 TTATATTTAAGGATGGGTCATGG - Intergenic
1003451276 6:6235112-6235134 TCATTTTTACATATGGTGCAAGG - Intronic
1003847944 6:10193236-10193258 TCATTTTTACTGCCGCATCAGGG - Intronic
1004789035 6:19003440-19003462 TCATTTTCTCAGATGGGACATGG - Intergenic
1005586341 6:27279892-27279914 ACATTTTTCCTGGAGGGTCAAGG - Intergenic
1005663803 6:28028310-28028332 TAATTTTTACTCATTGGTTATGG + Intergenic
1005921303 6:30404342-30404364 TCTTTTTTCCTGCTGGATCAGGG + Intergenic
1008410249 6:51169812-51169834 CCATGTTTACTGTTGGGTGATGG + Intergenic
1009001306 6:57719269-57719291 TCATTTTTACATGTGGTTCAAGG + Intergenic
1009573425 6:65420058-65420080 TCATGGTCACTGATGGATCAGGG + Intronic
1010025337 6:71209029-71209051 TTATTTTTAGAGATGGGTGAGGG - Intergenic
1011010666 6:82700347-82700369 TCATTTAAACTTATAGGTCATGG - Intergenic
1011130299 6:84045428-84045450 TCATTTTCAATGAAGGGTGACGG - Intronic
1012321967 6:97860850-97860872 TCATTTTGGCTAATGGGCCATGG - Intergenic
1013013639 6:106142249-106142271 TCATTTTTATAGATTGGACAGGG - Intergenic
1013164489 6:107577453-107577475 TCAGTTTCACTGATTGGTCCAGG + Intronic
1013975917 6:116078368-116078390 TCATTTTCCCAGATTGGTCAAGG - Intergenic
1015886247 6:137921705-137921727 TCCTTTAGACTGAAGGGTCAGGG + Intergenic
1017963025 6:159238745-159238767 TCATTTATAATGAATGGTCATGG + Intronic
1021494628 7:21260601-21260623 TCATTTTTGGTGTTGGTTCAGGG - Intergenic
1022254446 7:28641845-28641867 TCGTTTTTATGGATGGATCATGG + Intronic
1023538154 7:41236010-41236032 TCATTTTTACCGATGTGTAATGG - Intergenic
1027175097 7:75898371-75898393 TCATTTTAACTGCTGGGTCTAGG - Intergenic
1027484018 7:78736815-78736837 TTTTTTTTACTGTTTGGTCAGGG - Intronic
1027701318 7:81473179-81473201 CCATTTTTACTGCTGGTGCAGGG - Intergenic
1027871981 7:83718909-83718931 TTATTTTTAGTAATGGTTCAGGG - Intergenic
1028872125 7:95781582-95781604 TCATTTTTGACGATGGGTCAGGG + Intronic
1030683148 7:112453487-112453509 TCATTAATACTGATGAGTTAAGG + Intronic
1033870488 7:145749177-145749199 TCATTGCTTCTGATTGGTCATGG - Intergenic
1035131129 7:156654677-156654699 TCTTCTTTACAGATGGGGCATGG - Exonic
1038903753 8:31873968-31873990 ACATTTTCATTGATGGATCAAGG - Intronic
1041531857 8:58877912-58877934 TCATTTGTTCTGATTGCTCAGGG + Intronic
1041557998 8:59180972-59180994 TTATTTTTACTGCTTAGTCAAGG - Intergenic
1042575247 8:70210970-70210992 TTATTTATGCTGATTGGTCAGGG + Intronic
1042708171 8:71684493-71684515 ACATTCTTACTGATGTGACATGG + Intergenic
1043941210 8:86197747-86197769 TCATTTTTAGCGACGGGTAATGG - Intergenic
1044489448 8:92794937-92794959 ACATTTTAACTGATGGGAAATGG - Intergenic
1044490520 8:92808936-92808958 TCCTTTTAACTGGTGGGTCCAGG + Intergenic
1046389555 8:113551934-113551956 TCACTCTTAATGATGGGTCAAGG - Intergenic
1046846694 8:118924385-118924407 TTATTTTTACTGATTGGACCTGG + Exonic
1047887985 8:129274118-129274140 TGATATTTATTGATGGATCATGG - Intergenic
1048514044 8:135089059-135089081 TCATTTTCAAAGATAGGTCACGG + Intergenic
1048650888 8:136475826-136475848 TCATTTTTCCTGATTTGTAAAGG - Intergenic
1050597050 9:7214388-7214410 CCATATTCAGTGATGGGTCAGGG - Intergenic
1051646833 9:19277057-19277079 TCCTTTTTACAGAAGAGTCAAGG - Intronic
1052777501 9:32747360-32747382 ACATTTTTACCAATGGCTCATGG + Intergenic
1055876754 9:80952727-80952749 TGATTATTGCTGATGGGTGAAGG - Intergenic
1056653688 9:88491314-88491336 TCATTTGTACTGATGCCTGAAGG - Intergenic
1058564274 9:106264595-106264617 TAATTTTTGCAGTTGGGTCATGG + Intergenic
1059097065 9:111429208-111429230 TCATTTTTACTGCTTCATCAAGG + Intronic
1060582495 9:124763212-124763234 TCATTTTTACTGCTTCATCAAGG + Intronic
1186141657 X:6580853-6580875 TAAGTTTTACTGATGTGACAGGG - Intergenic
1186336004 X:8589280-8589302 CCTTTATTACTGATGGGTCATGG + Intronic
1187840175 X:23478921-23478943 TCATTTTTACTCTTGGGCCCAGG - Intergenic
1188406469 X:29816724-29816746 TCATTTTTAAAGAGTGGTCATGG - Intronic
1188466268 X:30485194-30485216 TCATTTTTCCTTAGGGGACATGG + Intergenic
1192134699 X:68586211-68586233 TCATTGTTAATGCTGGGTAACGG + Intergenic
1194113191 X:89863472-89863494 TTATTTTTATTGATTTGTCAAGG + Intergenic
1194829266 X:98600529-98600551 TTATTTTTACTCATGGGATATGG - Intergenic
1196131453 X:112161513-112161535 TCATTCATACTGAAGGGTGAGGG - Intergenic
1196317055 X:114239517-114239539 TCATTTTCACTCAGGGGTCTAGG + Intergenic
1197131770 X:123013988-123014010 CCACTTTTACTGAAGGGACAGGG + Intergenic
1198309684 X:135418375-135418397 TCCTTTTTATTTATGGATCATGG - Intergenic
1200465877 Y:3518528-3518550 TTATTTTTATTGATTTGTCAAGG + Intergenic
1200821401 Y:7587236-7587258 TCATTTTTCCTGAAATGTCATGG - Intergenic
1201561036 Y:15316990-15317012 TCATTCTAACTGATGTGACATGG + Intergenic
1201577204 Y:15473825-15473847 TCATTTTTAATGAAGTCTCAAGG + Intergenic
1201623605 Y:15987950-15987972 TCAGTTTAACTGATGTGACAAGG - Intergenic
1201863058 Y:18620814-18620836 TCATTTTTACAGCTGGAGCAAGG + Intergenic
1201870265 Y:18699564-18699586 TCATTTTTACAGCTGGAGCAAGG - Intergenic
1202238904 Y:22745515-22745537 TCATTTTTCCTGAAATGTCATGG + Intergenic