ID: 1151798924

View in Genome Browser
Species Human (GRCh38)
Location 17:76365970-76365992
Sequence CCCCTCCGTCCCCGGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151798924_1151798928 1 Left 1151798924 17:76365970-76365992 CCTGACTTCCGGGGACGGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1151798928 17:76365994-76366016 TGGAGCTTGAGTTTAGTGTGTGG 0: 1
1: 0
2: 2
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151798924 Original CRISPR CCCCTCCGTCCCCGGAAGTC AGG (reversed) Intronic
903132869 1:21290588-21290610 CCCTCCCTTCCCCGGAGGTCGGG + Intronic
905546594 1:38804685-38804707 CCCTTCCGTCCCTGCAACTCTGG + Intergenic
906533809 1:46540104-46540126 CCTCTCAGTCCCTGGAAATCTGG + Intergenic
915131282 1:153697371-153697393 CCCCTCCTTCCCAGGCAGGCAGG + Intergenic
916290404 1:163159485-163159507 CCCCTCTGTTGCGGGAAGTCAGG - Intronic
923984532 1:239366105-239366127 CCTCCCCCTCCCCAGAAGTCAGG - Intergenic
1067139882 10:43648397-43648419 CTCCTCCCACCCCGGAAGGCCGG + Intronic
1067290289 10:44935002-44935024 CCCCTCCCTCGCCGAAGGTCTGG + Exonic
1070669381 10:78367368-78367390 CCCCGCCTTCCCCTGAGGTCGGG + Intergenic
1075070470 10:119316858-119316880 CCCGTCCCTCCCTGGAAGTCAGG + Intronic
1075404364 10:122184532-122184554 CCCCTGCGTCCCCAGCAGTGTGG + Intronic
1075603141 10:123785514-123785536 CCCCTCAGTCCCTGGCAGCCTGG + Intronic
1076496326 10:130899982-130900004 CCATTCCGACTCCGGAAGTCAGG + Intergenic
1076900824 10:133336538-133336560 CCCCGCCGTCACGGGAAGCCTGG + Intronic
1077158474 11:1101996-1102018 CCCTTCCGCCCCCGGGAGACGGG - Intergenic
1081758847 11:45563018-45563040 CCCCTCTGTCCCAGGTAGGCAGG - Intergenic
1083628775 11:64085393-64085415 GCCCTCCGTCCCCGGAAGGCAGG - Intronic
1083672173 11:64305731-64305753 CCCCTCCGCCCCCGGACCTGGGG - Intronic
1084948794 11:72653473-72653495 CCTCTCCCTCCCTGGGAGTCGGG - Intronic
1091454893 12:599701-599723 CCACTCAGTCCCAGCAAGTCTGG + Intronic
1093235618 12:16605688-16605710 CCCCTCTCTCCCCGGGAGTCAGG + Intronic
1102458883 12:113087838-113087860 CCCCTCCCTCCTCCAAAGTCTGG - Intronic
1103921111 12:124399645-124399667 CCCCACCGTCCCCTGGGGTCCGG - Intronic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1113462764 13:110493357-110493379 ACCCTCCATTCCCTGAAGTCTGG - Intronic
1117333660 14:54738270-54738292 CCCCTCCCTTCACGGAAGCCTGG + Intronic
1124369935 15:29098849-29098871 CTCCTCTGTCCCCAGAGGTCAGG - Intronic
1125361752 15:38871873-38871895 CCCTTCCCTCCCTTGAAGTCAGG - Intergenic
1128112511 15:65085631-65085653 CGCCTCCGTGACCGGAAGCCAGG + Intergenic
1129694743 15:77734295-77734317 TCCCTCCCTCTCCGGAATTCTGG - Intronic
1132349684 15:101132165-101132187 CCCCTGCGAGCCCTGAAGTCCGG - Intergenic
1132622489 16:874427-874449 CCCCTCCCGCCCTGGCAGTCCGG + Intronic
1136261728 16:29082077-29082099 CCTCCCCGGCCCCGGAAGGCGGG - Intergenic
1138552130 16:57753855-57753877 ACCCTCCGTCCCCCGCACTCTGG + Intronic
1141140768 16:81495459-81495481 CCCATCCTTCCCCGGACGCCAGG - Intronic
1141890814 16:86925434-86925456 CCCCTGCCTCCCTGGAAGCCAGG - Intergenic
1142117820 16:88369244-88369266 CCCCTCCCTCCCAGGTAGGCAGG + Intergenic
1142509891 17:386439-386461 CCCCAGCCTCCCCGGCAGTCGGG + Intergenic
1142510370 17:389165-389187 CCTCTCCCTCCCCAGAAGCCTGG + Intergenic
1145089862 17:19977692-19977714 CCCCTCTGGACCCGGAAGTCCGG - Exonic
1146915040 17:36673037-36673059 CCCCCCACTCCCAGGAAGTCAGG - Intergenic
1147337763 17:39737706-39737728 CCCCTCCCTCCCAGGTGGTCGGG + Intergenic
1147613223 17:41813309-41813331 CCACTCCGTCCCCTGAACCCGGG + Intronic
1147754937 17:42761672-42761694 CCCCTCCCTCCCCGGCACTGAGG + Intronic
1148674034 17:49434773-49434795 CCCCTCTGTCCTCTGAGGTCAGG + Intronic
1151135122 17:71939106-71939128 CCCCTTAGTCCCTGGGAGTCAGG + Intergenic
1151146305 17:72044785-72044807 CCTCTCCCTCCCTGGAAGACAGG - Intergenic
1151798924 17:76365970-76365992 CCCCTCCGTCCCCGGAAGTCAGG - Intronic
1152141482 17:78539540-78539562 CCCCTCAGTCCCAGGCACTCAGG - Intronic
1152175094 17:78782132-78782154 CCCCTCCGGGCCCGGCCGTCCGG - Intronic
1152225447 17:79090596-79090618 CCCCTCCGTCTCAGGCAGTGGGG - Intronic
1152350691 17:79782428-79782450 CCCCTCCCTCCCCTGAGGACAGG + Intronic
1152562781 17:81086869-81086891 CCCATCCCTGCCCGGGAGTCCGG + Intronic
1152587877 17:81197135-81197157 CCCCTCTGTCCCCAGAGGGCAGG - Intronic
1160628513 18:80229427-80229449 CCCCTCAGGCCAAGGAAGTCAGG + Intronic
1162339841 19:10085967-10085989 TCCCTCCTTCCCCGGGAATCTGG - Intergenic
1163346422 19:16745386-16745408 CCCCTCCGTCCCAGGCAAACTGG - Intronic
1163729318 19:18940436-18940458 CCCCCCCGTCCCCCGCACTCGGG - Intronic
1165311135 19:35030209-35030231 CCCCACCTTCCCAGGGAGTCTGG - Intergenic
1165471706 19:36008153-36008175 CCTCTCTGTCCCCTGGAGTCTGG - Intronic
1165856181 19:38880435-38880457 CTCCTCAGTCCCTGGAAGCCCGG + Intronic
1166528279 19:43526773-43526795 CCACTCTTTCCCCGGGAGTCGGG + Intronic
1167854942 19:52229672-52229694 CCCTTCCCTCCTCCGAAGTCTGG - Intergenic
927193889 2:20534714-20534736 CCCCTCAGTCCCAGGAAACCAGG - Intergenic
928091205 2:28376136-28376158 CCCCTCTGTCCCAGGAAGCATGG - Intergenic
928924420 2:36563591-36563613 CTCCTACCTCCCCAGAAGTCAGG + Intronic
931797535 2:65725496-65725518 CCTCTCCCTCTCCAGAAGTCAGG - Intergenic
936029768 2:109062012-109062034 ACCCTCCAGCCCCGAAAGTCTGG + Intergenic
936661431 2:114548028-114548050 CCACTCCATCCCTGGAAGGCTGG - Intronic
936978137 2:118239495-118239517 GCCCTCCTTCCCCAGATGTCCGG + Intergenic
937594093 2:123652064-123652086 CCCCACCTTCCCTGGAATTCAGG - Intergenic
938812099 2:134863039-134863061 CCCCTACCTCCCAGGAGGTCGGG - Intronic
945948054 2:216013341-216013363 CCCCACCGGCGCCGGAAGCCTGG + Exonic
948002738 2:234581621-234581643 CCCCTCAGTCCCGGAAATTCTGG + Intergenic
948431526 2:237922165-237922187 CCCCACCTTCCCCGGCAGGCTGG - Intergenic
1169406023 20:5321955-5321977 CCCCTCCTTCGCCTGAGGTCAGG + Intergenic
1171533735 20:25868443-25868465 CCCCTCCCTCAGTGGAAGTCGGG - Intergenic
1171966759 20:31536424-31536446 CCCCTCCATCCCCCCAAGCCAGG + Intronic
1173907323 20:46638490-46638512 CCCCTCTGTCCGCAGCAGTCAGG - Intronic
1179283240 21:39952958-39952980 CCCCTCAGTCCCTGGAAAACCGG + Intergenic
1181393789 22:22603722-22603744 CACCTCTGTCCCCAGAACTCAGG + Intergenic
1182471686 22:30552685-30552707 CCCCTCTGTCCCAGGCAATCAGG - Intergenic
1184614611 22:45629662-45629684 CCTCTCTCTCCCCAGAAGTCAGG + Intergenic
1184674849 22:46036071-46036093 TCCGTCCCGCCCCGGAAGTCAGG - Intergenic
950035143 3:9879841-9879863 CCCCTCAGTCCCTGGATGCCTGG + Intronic
950140017 3:10608996-10609018 ACCTTCCTTCCCCGGAATTCCGG + Intronic
950486311 3:13275914-13275936 CCCCTCCGTCCTTGGAGTTCTGG - Intergenic
950667669 3:14506956-14506978 CCCCTCCTACCCCGCAAGTCGGG - Exonic
953883020 3:46701278-46701300 CCCCTCCTTCCCGGGAGATCGGG - Intergenic
954886606 3:53880871-53880893 CTCCTCCATCCCCGACAGTCAGG - Intronic
960767355 3:121149351-121149373 TCCCTCCCTCCCCAGAATTCAGG + Intronic
967112556 3:186307076-186307098 CCCCTCAGTCCCAGAAAATCTGG + Intronic
977258050 4:94761878-94761900 CCCCTCCTTTCCCTGAATTCTGG - Intronic
978795793 4:112706159-112706181 CCTCCCCGGCCCCGGAAGGCGGG + Intergenic
982716534 4:158814685-158814707 CCCCTCCCTCCCCCAAAGACAGG - Intronic
985880691 5:2636788-2636810 GCCCTCCCTCCCCTGAAGCCAGG - Intergenic
995411117 5:111858283-111858305 CCCCTCCCTCCCCTGCAGTAAGG + Intronic
997648591 5:135498284-135498306 CCCCTCTGTCCCTGCATGTCAGG - Intergenic
1003087131 6:3068947-3068969 CCCCGCCGGTACCGGAAGTCGGG + Intronic
1004114137 6:12749878-12749900 CCCCGCCGCCCCCCGCAGTCGGG + Intronic
1006151307 6:31991661-31991683 CCCCACCTTCCCCCCAAGTCAGG - Intronic
1006157608 6:32024399-32024421 CCCCACCTTCCCCCCAAGTCAGG - Intronic
1007478939 6:42137453-42137475 CACCTCCTACCCCGGGAGTCAGG - Intronic
1011055819 6:83202343-83202365 CCCCTCAGTCCCAGGAAAACTGG - Intergenic
1015085073 6:129280868-129280890 CCCCTCCCTCCCAGGAAGGGTGG - Intronic
1017170768 6:151452343-151452365 CGCCTTCGTCCCCGGAAGATTGG + Exonic
1020411986 7:7902864-7902886 CCCCTCAGTCCCAGGCAGACTGG - Intronic
1020784450 7:12556411-12556433 CCCCGCCGCCCCCGGCAGTGAGG - Intergenic
1021313033 7:19116502-19116524 CCCCAGCGTCCCCGGAAGGCCGG - Intronic
1022088959 7:27095651-27095673 CCCCCAGGTTCCCGGAAGTCTGG + Exonic
1024216504 7:47253667-47253689 CCCCTCCTTCCCCAGAAGGCAGG - Intergenic
1025733160 7:64124316-64124338 CCTCTCCATCCCTGGAAATCTGG - Intronic
1026736943 7:72954772-72954794 GCCCTTGGACCCCGGAAGTCCGG - Intergenic
1027106789 7:75410291-75410313 GCCCTTGGACCCCGGAAGTCCGG + Intronic
1029470016 7:100748379-100748401 GTCCACCATCCCCGGAAGTCTGG - Exonic
1034260683 7:149753432-149753454 CCCCTCCGGCCCAGCAAGACAGG - Intergenic
1035823712 8:2621834-2621856 CCCCTCCATCCACTGAAATCAGG - Intergenic
1036661388 8:10711263-10711285 CCCCTCCTCCCCAGGAAGACAGG + Intronic
1038418076 8:27412222-27412244 CCCTTCCCTCCCTGGAGGTCAGG + Intronic
1039464597 8:37775470-37775492 CCCCCCAGTACCTGGAAGTCTGG - Exonic
1039875182 8:41578590-41578612 GCCCTCCCGCCCCGGGAGTCCGG + Intronic
1049354050 8:142179051-142179073 CCCCTCCCTCCCCTGGTGTCTGG - Intergenic
1049851039 8:144830294-144830316 CCCCTCTGTCCCGGCTAGTCTGG + Intronic
1194233675 X:91356189-91356211 TCCCTCCCTCCCCGTAACTCTGG - Intergenic
1194819755 X:98491058-98491080 CTCTTCCCTCCCTGGAAGTCAGG - Intergenic
1198518436 X:137429939-137429961 CCCCTGCGTCCCCGGAACCCTGG - Intergenic
1200206442 X:154319922-154319944 ACCCCCCTTCCCCAGAAGTCCGG - Intronic