ID: 1151799597

View in Genome Browser
Species Human (GRCh38)
Location 17:76370228-76370250
Sequence GCTGGTGGAAAGACACGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151799590_1151799597 9 Left 1151799590 17:76370196-76370218 CCAGGAAGGGTTCACACAAATGG 0: 1
1: 0
2: 1
3: 13
4: 101
Right 1151799597 17:76370228-76370250 GCTGGTGGAAAGACACGAGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151799597 Original CRISPR GCTGGTGGAAAGACACGAGT CGG Intronic
905723885 1:40231691-40231713 GCTGGAGGAAAGAAATGAGTGGG + Intronic
908000315 1:59672669-59672691 GCTGGAGGAAAGAATTGAGTGGG + Intronic
910058876 1:83064863-83064885 ACTGGTGAGAAGACAAGAGTAGG + Intergenic
918682402 1:187371855-187371877 GCTGAAGGAAAGAAACCAGTAGG + Intergenic
919886120 1:201936162-201936184 ACTGGGGGAAAGAGAAGAGTCGG - Intronic
921310872 1:213841990-213842012 GCTGGTGTAAATAAAAGAGTGGG - Intergenic
1063587459 10:7365471-7365493 GCTGGTGTACACAGACGAGTGGG + Intronic
1072215444 10:93283736-93283758 GCTGGTGGGAAGACCCGAGCAGG + Intergenic
1073293531 10:102425020-102425042 GCTGATGGAAAGACAGCAGGAGG - Intronic
1077228842 11:1449796-1449818 GCTGGTGGAAAGGCCTGAGGAGG - Exonic
1079056353 11:17209264-17209286 GTTGGGGGAAAGATAGGAGTTGG - Intronic
1083232710 11:61333211-61333233 GCTGGCGGAAAGAGGCGAGGCGG - Exonic
1083294491 11:61707777-61707799 GCAGGTGGAAAGACAGGAGCTGG + Intronic
1084685845 11:70694776-70694798 GCTTGTGGACAGAGATGAGTAGG - Intronic
1087891146 11:103539832-103539854 GCATGTGGAAAAACACTAGTGGG - Intergenic
1089230924 11:116975362-116975384 GCTGGTGGAGGGATAGGAGTGGG - Intronic
1091123294 11:133074926-133074948 GATGGTGGACAGACAGGGGTGGG - Intronic
1092072432 12:5642587-5642609 GCTGGTAGAAAGGCAAGGGTGGG - Intronic
1094232171 12:28119042-28119064 GCTGGTGTAAACACACCTGTTGG + Intergenic
1094423868 12:30299130-30299152 TCTGGCTGAAAGACAAGAGTTGG + Intergenic
1098447706 12:70584374-70584396 GATTGTAGAAAGACACTAGTTGG + Intronic
1100626503 12:96338958-96338980 GCTGGGGGAAGGACAGGAATGGG - Intronic
1100626548 12:96339362-96339384 GCTGGGGGAAGGACAGGAATGGG + Intronic
1101322681 12:103686880-103686902 GCTGGTGGGAAGGCCAGAGTTGG - Intronic
1104723694 12:131061451-131061473 GCTGGGGGAAACACAAGCGTGGG - Intronic
1104798298 12:131535234-131535256 GTTGGTCTAAAGACACGAGGAGG + Intergenic
1106032195 13:26013371-26013393 ACTGGTAGAAAGAGATGAGTTGG + Intronic
1106429011 13:29661655-29661677 GCTGGAGGAAAGAGGAGAGTGGG + Intergenic
1106466865 13:30021291-30021313 GGTGGTGGGAAGACACCAGGTGG - Intergenic
1108350558 13:49586950-49586972 GATGCTGGGAAGACAAGAGTAGG - Intergenic
1114397420 14:22378454-22378476 GCTGGTGGAAAGACTTGGTTTGG - Intergenic
1120865342 14:89291555-89291577 ACTGCTGGAAAGACTGGAGTGGG - Intronic
1127615853 15:60684759-60684781 CCTGGTGTAGAGACATGAGTTGG - Intronic
1128549440 15:68588782-68588804 GCTGATGGAAAGAAAGGTGTTGG + Intronic
1128733172 15:70034436-70034458 GCTGGGGGAATGTCACGGGTGGG + Intergenic
1131126529 15:89862804-89862826 GCTGTTGGAAATACAGGAATAGG + Intronic
1134512086 16:14856744-14856766 CGTGGTGGAAAGACAGGAGGGGG + Intronic
1137661475 16:50210464-50210486 GCTGGTGGAAGGAAAGGAATGGG - Intronic
1138197056 16:55059561-55059583 GCTTGGGGAAAGACAGGAGGTGG + Intergenic
1143052241 17:4135749-4135771 GCTGGTGGAAAGAATGGAGAAGG - Intronic
1147219844 17:38922057-38922079 GCGGGTGGAAAGCCAGAAGTAGG - Intergenic
1151799597 17:76370228-76370250 GCTGGTGGAAAGACACGAGTCGG + Intronic
1156686703 18:39657710-39657732 ACTGATGGAAAGTCACCAGTAGG - Intergenic
1163035337 19:14566265-14566287 GCTGGGGGAAAAGCACGAGAGGG + Exonic
1165449447 19:35873734-35873756 GGTGGTGGACAGGCATGAGTAGG - Intronic
929790117 2:45016114-45016136 GCAGTTGGAAAGACAGGAATGGG + Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930094508 2:47556738-47556760 GATGGTGGAAAAATAAGAGTGGG + Intronic
930107556 2:47651923-47651945 GGTGGTTGAGAGACAGGAGTGGG - Intergenic
936044811 2:109179122-109179144 GCAGCTGGAAGGAAACGAGTAGG + Intronic
936737028 2:115457715-115457737 GCTGGTGGAAATACAACACTTGG + Intronic
943965030 2:194321504-194321526 GCTGGTGGGAAAATACAAGTAGG - Intergenic
1175172687 20:57091363-57091385 GCGGGTGGAGAGGCATGAGTGGG - Intergenic
1178512340 21:33216052-33216074 GCAGGTGGAAGGAAATGAGTGGG - Intergenic
1179189133 21:39108397-39108419 GTTGGGGGAAGGCCACGAGTGGG - Intergenic
1180286193 22:10746804-10746826 GCTGGTGGATGGAGAAGAGTGGG - Intergenic
1180658316 22:17443468-17443490 GATGGTGGAAAGGCACCAGCAGG + Intronic
1182241372 22:28918909-28918931 GCTGGTGGAAATACCGGATTGGG + Intronic
1184893545 22:47393814-47393836 CCTGGTGGAGAGGCATGAGTTGG - Intergenic
949412352 3:3779731-3779753 CCTTGTGGAAATACACCAGTTGG - Intronic
951806220 3:26647003-26647025 GCGGATGGAAAGAGATGAGTTGG - Intronic
952481642 3:33768157-33768179 GCTGAAGGAAAGACACAAGAAGG + Intergenic
952810220 3:37396079-37396101 GCTGGTGGAAGGACAGGAGTAGG - Intronic
954618239 3:51981221-51981243 GCTGTGGGAAAGACGGGAGTGGG + Intronic
960992790 3:123322704-123322726 GCCAGTGGGAAGACACGTGTGGG - Intronic
962317962 3:134370653-134370675 GCTGGAAGAAAGCCAGGAGTTGG + Intronic
965518945 3:169653590-169653612 GATGGTAGAAACACAAGAGTAGG + Intronic
966151882 3:176874862-176874884 ACTGGTGCAAAAACACCAGTGGG + Intergenic
967596467 3:191330450-191330472 GCTAGTGGAAAAACAAGAGAAGG - Exonic
975437264 4:74367055-74367077 GCTGGGGGAAGGACAAGATTTGG - Intronic
976326197 4:83774446-83774468 GATGGTGGAAAGACACAAAGGGG + Intergenic
976692668 4:87885459-87885481 GCAGGTGGAGAGAAACGGGTTGG - Intergenic
980253639 4:130349449-130349471 GCTGCTGGAAAGAAAGGGGTGGG - Intergenic
983084847 4:163430116-163430138 TCTGGTGGAAAGACGAAAGTAGG + Intergenic
987464444 5:18254923-18254945 GCTGGTGGAAAGAGAACAGAAGG - Intergenic
991593609 5:68279679-68279701 GCTGCTGGAATGACAGGATTTGG - Exonic
997371455 5:133363825-133363847 GCTGATGGAAAGACAGGGGTGGG - Intronic
998139008 5:139689641-139689663 CCTGGTGGGAAGACACCAGGGGG - Intergenic
1002023060 5:176377599-176377621 GTTGGTGGAAATACACCACTTGG + Exonic
1003868335 6:10382847-10382869 GCTGCGGGGAAGACACGCGTGGG - Intergenic
1012114925 6:95285072-95285094 GCAGGTGGGAAGACACGCCTGGG - Intergenic
1012204979 6:96450252-96450274 GCTGGAGGAACGAGAAGAGTAGG + Intergenic
1014440254 6:121465576-121465598 TCTGGTGGAAAGAGAGGAGAGGG - Intergenic
1015494427 6:133865609-133865631 GCTGGTCCAAAGACACCTGTAGG + Intergenic
1018312069 6:162520443-162520465 ACTGGTGGACAGAGAGGAGTTGG - Intronic
1020594643 7:10190559-10190581 GCTGGTGGGAGGACAGTAGTGGG + Intergenic
1021264696 7:18505689-18505711 CCTGTTGGAAAGCCAAGAGTGGG - Intronic
1028314282 7:89380896-89380918 GCTGATGCAAAGGCACAAGTGGG - Intergenic
1028366372 7:90037323-90037345 GCTGTGGCAAAGACAAGAGTTGG - Intergenic
1028446946 7:90935094-90935116 GCAGGTAGAAGGACAAGAGTGGG + Intronic
1029793906 7:102873939-102873961 TCTAGTGGGAAGACAGGAGTAGG - Intronic
1030273012 7:107690220-107690242 ACTGGAGGAAAGACACAGGTAGG + Exonic
1035877926 8:3211902-3211924 GCTGGTGGCAAGACAAGAGGGGG + Intronic
1035947958 8:3986205-3986227 GATGGTGCAAAGACACCAGATGG + Intronic
1037793445 8:21968988-21969010 GCTGATGGAAAGATACAATTTGG + Intronic
1051222880 9:14868989-14869011 GCCGGTGGACAGAGAAGAGTTGG - Exonic
1052678105 9:31652616-31652638 GCTGGTGGAAAGCCACAAGGTGG - Intergenic
1052914711 9:33916032-33916054 GCTGGAGAAAATACAAGAGTGGG + Intronic
1055274521 9:74599293-74599315 TCTGGTGGAAAGACTGGAGTTGG - Intronic
1055635418 9:78272801-78272823 GCTGGTGGAACGTCACTATTTGG + Intronic
1058077106 9:100662315-100662337 GCTCCTGGAAAGACACTCGTTGG + Intergenic
1186831807 X:13398230-13398252 CCTGCTGGAAAGAAACTAGTAGG + Intergenic
1188967836 X:36577226-36577248 GAAGGTGGAAAGACAGGAGAGGG + Intergenic
1189470337 X:41308968-41308990 GCTTGTGGACAGGCAAGAGTGGG + Intergenic
1193196663 X:78639853-78639875 GCTGGTGGAACTACAGCAGTTGG + Intergenic
1195671950 X:107477328-107477350 GCTGGTGGAAATGCAGGAGGGGG + Intergenic
1197770461 X:130086154-130086176 GCTGGTAGAAAGAAAGGAATAGG - Intronic
1198739556 X:139826798-139826820 GCTGGAGAAGAGAAACGAGTTGG - Exonic