ID: 1151802070

View in Genome Browser
Species Human (GRCh38)
Location 17:76384583-76384605
Sequence GCGGAGCCAGGCCGGCGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 323}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151802064_1151802070 -7 Left 1151802064 17:76384567-76384589 CCCCCGGGAGCGCGGGGCGGAGC 0: 1
1: 0
2: 1
3: 30
4: 213
Right 1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG 0: 1
1: 0
2: 1
3: 23
4: 323
1151802062_1151802070 -4 Left 1151802062 17:76384564-76384586 CCACCCCCGGGAGCGCGGGGCGG 0: 1
1: 0
2: 5
3: 29
4: 277
Right 1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG 0: 1
1: 0
2: 1
3: 23
4: 323
1151802055_1151802070 14 Left 1151802055 17:76384546-76384568 CCGCGCCGGGCTCAGGTTCCACC 0: 1
1: 0
2: 2
3: 11
4: 170
Right 1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG 0: 1
1: 0
2: 1
3: 23
4: 323
1151802054_1151802070 20 Left 1151802054 17:76384540-76384562 CCGAGGCCGCGCCGGGCTCAGGT 0: 1
1: 0
2: 2
3: 17
4: 205
Right 1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG 0: 1
1: 0
2: 1
3: 23
4: 323
1151802065_1151802070 -8 Left 1151802065 17:76384568-76384590 CCCCGGGAGCGCGGGGCGGAGCC 0: 1
1: 0
2: 2
3: 29
4: 235
Right 1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG 0: 1
1: 0
2: 1
3: 23
4: 323
1151802067_1151802070 -10 Left 1151802067 17:76384570-76384592 CCGGGAGCGCGGGGCGGAGCCAG 0: 1
1: 0
2: 1
3: 33
4: 250
Right 1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG 0: 1
1: 0
2: 1
3: 23
4: 323
1151802056_1151802070 9 Left 1151802056 17:76384551-76384573 CCGGGCTCAGGTTCCACCCCCGG 0: 1
1: 0
2: 8
3: 34
4: 338
Right 1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG 0: 1
1: 0
2: 1
3: 23
4: 323
1151802066_1151802070 -9 Left 1151802066 17:76384569-76384591 CCCGGGAGCGCGGGGCGGAGCCA 0: 1
1: 0
2: 3
3: 22
4: 213
Right 1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG 0: 1
1: 0
2: 1
3: 23
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151802070 Original CRISPR GCGGAGCCAGGCCGGCGCCG AGG Intronic
900176673 1:1294228-1294250 GCGGAGAGGGGCCGGTGCCGTGG - Intronic
900183953 1:1324472-1324494 GTGGAGCCAGGTGCGCGCCGCGG - Intronic
900310379 1:2030539-2030561 GCTGAGCCAGGCCGGGGTCTGGG + Exonic
900645253 1:3706112-3706134 GCGGAGGCGGGCCGGGGGCGGGG - Intronic
901798066 1:11691865-11691887 GCGGAGCCAGGGGCGGGCCGAGG - Intronic
903828681 1:26162111-26162133 CCGGGGCCAGTCCGGAGCCGCGG - Exonic
904125219 1:28233512-28233534 GCTGAGCCGGTCCGGCGCGGTGG - Intergenic
904528730 1:31154825-31154847 GGAGACCAAGGCCGGCGCCGGGG - Intergenic
904541987 1:31239575-31239597 GCGGAGCAAGAAGGGCGCCGCGG - Intergenic
904563336 1:31413157-31413179 GCGGGGCCGGGGCGGGGCCGGGG + Intronic
904822786 1:33256324-33256346 GCGCAGCCCGTCCGGCCCCGGGG - Intergenic
905626050 1:39491342-39491364 GCGGGACCGGGACGGCGCCGCGG + Intergenic
905648273 1:39639691-39639713 GCGGGGCCGGGGCGGGGCCGGGG - Exonic
907461470 1:54608088-54608110 GTGGAGCCAGGCTGGGGGCGTGG - Intronic
908252283 1:62274556-62274578 GAGGAGCCAGGCCTGAGCCTGGG - Exonic
910777856 1:90893747-90893769 GCGGCGCCAGGCCTGAGCGGTGG - Intergenic
911052360 1:93681665-93681687 GCGGTGCGAGGCCGGCCGCGCGG - Intronic
913300671 1:117366738-117366760 GCGGCGCGAGGCCGGAGCCCGGG + Intergenic
913662960 1:121021065-121021087 GCAGAACGAGGCCGGCGCTGCGG - Intergenic
914014342 1:143804330-143804352 GCAGAACGAGGCCGGCGCTGCGG - Intergenic
914163479 1:145156871-145156893 GCAGAACGAGGCCGGCGCTGCGG + Intergenic
915167866 1:153958550-153958572 GAGGAGCCGGGCCGAGGCCGCGG - Exonic
915959167 1:160250174-160250196 GCGAATGCAGGCCGGCGCAGTGG + Intronic
919832192 1:201549719-201549741 ACTGAGCCAGGCCGGCACCCAGG - Intergenic
920218515 1:204378216-204378238 GCGGAGCCGCGCCGCCGCCTCGG + Intergenic
922696848 1:227735192-227735214 CCGGAGCCTGGCCGACGCCGGGG + Exonic
923730169 1:236542658-236542680 GCTGAGCCTGGCCGGAGCCTGGG - Intronic
924576189 1:245283086-245283108 GGGGAGCCAGGCTGGAGCCATGG - Intronic
1063200973 10:3785262-3785284 GGGGAGCCAGGCGGGGGCGGAGG - Exonic
1064318938 10:14283855-14283877 ACGGAGCCAGGCCTGGGCCAAGG + Intronic
1064354409 10:14604335-14604357 GCGGCGCGAGGGCGGCTCCGGGG + Intronic
1065214690 10:23438858-23438880 GCGGGGCGAGGCCGGGGGCGCGG - Intergenic
1067140083 10:43649082-43649104 GCGGAGCCGGGACGGAGCCACGG + Intergenic
1067478951 10:46583314-46583336 GCAGAGACAGGCCGGTGCCCTGG + Intronic
1067615787 10:47758487-47758509 GCAGAGACAGGCCGGTGCCCTGG - Intergenic
1067830573 10:49609386-49609408 GCGGAGGCTGGCAGGAGCCGAGG + Intronic
1070151963 10:73811023-73811045 GCGAAGCCAGACGGGGGCCGGGG + Intronic
1070570737 10:77637996-77638018 GCGGAGCCGGGGCGGGCCCGGGG - Intronic
1072139076 10:92573938-92573960 GAGGCGGCAGGCGGGCGCCGAGG + Exonic
1073022958 10:100462090-100462112 GCGGAGCCAGGAGGGCACCCAGG - Intergenic
1073176394 10:101560036-101560058 GCAGAGCCAGGCCAGAGCCAGGG - Intergenic
1074377501 10:112951650-112951672 GCGGGGCCCGGCGGGCGGCGCGG - Intronic
1075651093 10:124128726-124128748 GCAGAGCCAGCCCAGCACCGCGG + Intergenic
1076372296 10:129963582-129963604 GCCGGGCCGGGCCGGGGCCGGGG + Intronic
1077068105 11:653808-653830 ACGGAGCCAGGCAGGAGCCCCGG + Intronic
1077128130 11:953602-953624 ACGGAGCCAGGACGGAGCCAGGG - Intronic
1080836366 11:35944278-35944300 TCCGGGCCAGCCCGGCGCCGGGG - Intronic
1081807870 11:45900086-45900108 GCGGGGCCGGGGCGGGGCCGAGG - Intronic
1083246050 11:61429423-61429445 GCGGCGCGAGGCCGGGGGCGGGG - Intronic
1083771433 11:64869884-64869906 CCAGAGGCAGGCCTGCGCCGTGG - Intronic
1083922330 11:65787552-65787574 GCGGAGCCAGGCGGCAGGCGCGG + Intronic
1083940193 11:65891466-65891488 GCGCAGCCAGGACGGCGTCCAGG - Exonic
1084146256 11:67266828-67266850 GCGGGGTCGGGCCGGGGCCGCGG - Intronic
1085197890 11:74683369-74683391 GCGCGGCCGGGCGGGCGCCGTGG + Intergenic
1085739033 11:79063577-79063599 GCTGAGCCAGGTCAGCACCGAGG - Intronic
1093465067 12:19440194-19440216 GGGCAGCCAGGGCGGCGGCGGGG + Exonic
1095476252 12:42589825-42589847 GCGGAGCGCGGACGCCGCCGCGG + Intronic
1095695808 12:45142915-45142937 GCGGAGGCTGACCGGCGCGGTGG - Intergenic
1095703658 12:45216174-45216196 GCTGAGCCCAGCCAGCGCCGGGG - Exonic
1096204148 12:49707241-49707263 GAGGAGCCTGGTCGGAGCCGCGG - Exonic
1096599222 12:52717684-52717706 GAGGAGCTAGGCCGAGGCCGAGG - Intergenic
1097243295 12:57591103-57591125 GGGCAGGCAGGCAGGCGCCGGGG + Intergenic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1101892987 12:108732167-108732189 ACGGAGCCAGGGCGGAGCCTCGG - Intergenic
1103360483 12:120350661-120350683 GCGGAGCCAGCCTTGAGCCGAGG - Intronic
1103433012 12:120904065-120904087 GCGGAGCCCGCCCCGCCCCGGGG - Exonic
1103781567 12:123402274-123402296 CCGGAGCGGGGCCGGGGCCGTGG + Intronic
1103928400 12:124436254-124436276 ACTGAGCCAGGCCTGCGCCTGGG + Intronic
1103944582 12:124518874-124518896 TCGGAACCAGGCCGGAGCCAAGG - Intronic
1106517171 13:30465414-30465436 GCGGAGCGCGGCCGGGGCGGCGG - Intronic
1106956333 13:34942682-34942704 GGGGAGCGGGCCCGGCGCCGCGG + Exonic
1109024644 13:57142539-57142561 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109025631 13:57149109-57149131 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109026621 13:57155682-57155704 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109027613 13:57162253-57162275 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109028599 13:57168818-57168840 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1110630250 13:77698392-77698414 GCGGTGGCGGGCCGGAGCCGGGG + Intronic
1111693374 13:91592818-91592840 GGGCAGCCAGGCAGGTGCCGTGG + Intronic
1112402101 13:99086424-99086446 GCGGAGCGGGCCGGGCGCCGAGG - Intronic
1117898661 14:60511406-60511428 GTGAAGCCAGGCCGGCCGCGGGG - Exonic
1119520103 14:75278923-75278945 GCGGAGACAGGTGGGCGCTGTGG - Exonic
1119662649 14:76462811-76462833 GGAGAGCCATGCGGGCGCCGTGG - Intronic
1122217682 14:100214646-100214668 GCGGGGCTAGGCGGGCGCGGGGG - Intergenic
1122243510 14:100384429-100384451 GGGGAGCCAGGCAGGAGCTGTGG + Intronic
1122558225 14:102592775-102592797 GCGGGGCCGGGCGGGCGCGGCGG - Exonic
1122707451 14:103629802-103629824 GCGGGGCCAGGGCGGGGCCCTGG - Intronic
1122719866 14:103716019-103716041 GCGGGGCCGGGCCGGGGCGGCGG - Intronic
1123443325 15:20305103-20305125 GCAGAGCCAGGGAAGCGCCGGGG - Intergenic
1124014426 15:25863399-25863421 GCGGAACGAGGGCGGGGCCGTGG - Intronic
1125918644 15:43511099-43511121 GCTGTGCGAGGCCGGAGCCGCGG + Intronic
1127994871 15:64147536-64147558 GTGGAGCCAGGCCCCCGGCGGGG + Intergenic
1129710596 15:77818778-77818800 GCGGCTCCAGCGCGGCGCCGCGG + Intronic
1130932250 15:88437880-88437902 GAGGAGCTAGGCTGGCTCCGGGG + Intergenic
1131315692 15:91334922-91334944 GAGGAGCCAGGCCTGCACCTAGG - Intergenic
1132028910 15:98424816-98424838 GGGGAGGCAGGGCGGCGCCTTGG - Intergenic
1132704366 16:1236830-1236852 GCGGAGCCCGGGCGCGGCCGAGG + Intergenic
1132707150 16:1249595-1249617 GCGGAGCCCGGGCGCGGCCGAGG - Intergenic
1132815812 16:1826191-1826213 GCCGGGCCAGGCCAGCGCCCCGG - Intronic
1132947133 16:2537953-2537975 GCGGGGGCGGGGCGGCGCCGGGG + Exonic
1133076324 16:3283611-3283633 GCGCCGCCACGCCGGCCCCGTGG - Exonic
1133271806 16:4614172-4614194 CCGGTGCCCGGCCGACGCCGTGG + Intronic
1135036978 16:19086627-19086649 CCGGACACAGGCGGGCGCCGAGG - Intergenic
1136891522 16:33975575-33975597 GCGGGCCCCGGCCGGGGCCGGGG + Intergenic
1137696970 16:50468161-50468183 TCGGACCCAGGCTGGCGGCGGGG + Intergenic
1138619132 16:58197874-58197896 GCCGCGCCAGGCCGGGCCCGCGG + Exonic
1139575967 16:67842343-67842365 GGGCAGCCAGGCGGGCGGCGCGG + Exonic
1140078428 16:71723278-71723300 GCGGCGATTGGCCGGCGCCGCGG - Intronic
1140221479 16:73047706-73047728 GCGGCTCCAGGCCGGCTGCGCGG + Intronic
1141430518 16:83968491-83968513 GCGGGGACTGGCCGGCGCCGGGG - Intergenic
1141481997 16:84313038-84313060 GCGCGGCCTGGCAGGCGCCGGGG - Exonic
1141531258 16:84648530-84648552 GCGGAGCCATGGCTGCGCAGCGG + Exonic
1141692974 16:85606908-85606930 GCGGGGCCAGGCCGAGGCAGGGG - Intergenic
1141818903 16:86431738-86431760 GCTGAGTCAGACCGGCCCCGGGG - Intergenic
1142285917 16:89171504-89171526 GCGGGGCGGGGCCGGGGCCGAGG - Intergenic
1203081510 16_KI270728v1_random:1148031-1148053 GCGGGCCCCGGCCGGGGCCGGGG - Intergenic
1142717600 17:1755479-1755501 GCAGAGCCAGGCTGGCGTGGAGG - Intergenic
1142762723 17:2051161-2051183 CCGCAGCCTGGCCGGCGCGGCGG + Intergenic
1143090649 17:4447545-4447567 GTGGAGCCAGCCCAGTGCCGGGG + Intronic
1143106774 17:4534126-4534148 GCGGTGCCAGGCTGGCACTGAGG + Intronic
1143141966 17:4745869-4745891 GCGGGGCCCGCCCGGCGCCCGGG + Exonic
1143487536 17:7262853-7262875 GCGGGGAAAGGGCGGCGCCGAGG - Intronic
1145265099 17:21376265-21376287 TCGGGGCCAGGCCGGAGCCGTGG + Exonic
1146182935 17:30709065-30709087 GGGGCGCCAGGCCGGGCCCGTGG - Intergenic
1147740798 17:42670108-42670130 GCGGAGCGGGCCCGGCGCGGCGG - Exonic
1148048720 17:44759088-44759110 GCGGAGCCGGGGCGGGGGCGCGG - Exonic
1148603081 17:48908674-48908696 GCGGAGCCAGGCCGCTCCCCGGG - Exonic
1148617761 17:49013688-49013710 GCGAAGCCAGGCAGCCGGCGAGG - Intronic
1150131916 17:62674128-62674150 GCTGAGCCAGGGGGCCGCCGAGG + Exonic
1150692270 17:67377116-67377138 GCGGAGCCCGGCCGGCGCTGGGG - Intergenic
1151494037 17:74449005-74449027 GGGCTGCCAGGCCGGCCCCGGGG + Intronic
1151629937 17:75303594-75303616 GGGCAGCCAGGCCAGCACCGTGG - Intergenic
1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG + Intronic
1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG + Intergenic
1152406495 17:80101217-80101239 GGGGACCCAGGCCGGGGCAGCGG + Intergenic
1152608127 17:81303176-81303198 TCTGAGCCAGGCTGGTGCCGGGG - Intergenic
1152608318 17:81303815-81303837 TCTGAGCCAGGCTGGTGCCGGGG - Intergenic
1152627817 17:81396321-81396343 ACCGAGCAAGGCCGGCGCAGCGG + Intronic
1152675293 17:81637017-81637039 GCGTAGGGAGGCCGGGGCCGGGG - Exonic
1154144126 18:11852018-11852040 GCAGGGCCAGACCGGCTCCGTGG + Exonic
1154333460 18:13448462-13448484 GCGCAGCCAGGCAGGCGCTGGGG - Intronic
1157529565 18:48409613-48409635 GCGGAGCCGGGCGGGGGCTGCGG - Intronic
1160730848 19:641008-641030 GCGGAGCCAGGCCTCTGCCCCGG - Intronic
1160788699 19:913050-913072 GCGGGGCGCGGCGGGCGCCGGGG - Intronic
1160826325 19:1082164-1082186 GCGGGGCCAGTTCTGCGCCGAGG + Intronic
1160928061 19:1556346-1556368 GCGGAGGCCGGCCGTGGCCGTGG + Exonic
1160930715 19:1568358-1568380 GCGGGGCCGGGGCGGGGCCGCGG - Intergenic
1160991856 19:1863368-1863390 GCACATCCAGGCCGGCGGCGGGG + Exonic
1161569880 19:5024594-5024616 GAGGAGCCAGGCCTGGCCCGTGG + Intronic
1161664613 19:5567921-5567943 CCGGAGCCGGGCGGGCGCCATGG - Intergenic
1161960361 19:7519809-7519831 GCTGAGCCAGGGTGGCACCGTGG - Exonic
1162031749 19:7920570-7920592 CCGGAGCCAGGCTGGAGGCGGGG + Intronic
1162366415 19:10252273-10252295 CCGAAGCCAGGCCCGCGCCCCGG - Exonic
1162479650 19:10920991-10921013 GAGGGGCCAGGCCTGCGGCGAGG - Intronic
1162535867 19:11262518-11262540 GCGGGGCGGGGCCGGCGCGGGGG + Intergenic
1162901044 19:13795669-13795691 GCGGAGCCGGGGCTGCCCCGCGG + Exonic
1162985341 19:14265899-14265921 GCCGAGCCAGGCCGGGGGCCAGG - Intergenic
1163027053 19:14518489-14518511 GCGGCGATTGGCCGGCGCCGCGG - Intronic
1163158022 19:15449649-15449671 GCGGGGCCTGGCCGGGGGCGGGG - Intronic
1163243050 19:16076202-16076224 GCGGGGCCAGGCCGGAGCCCCGG + Intronic
1164159666 19:22618077-22618099 GCGGGGCCGGGCCGGAGGCGGGG + Intergenic
1165871387 19:38975735-38975757 GCGGCTGCAGCCCGGCGCCGGGG + Exonic
1166260706 19:41638896-41638918 GGGGAGCCAGGCTGGAGCCATGG - Intronic
1166317889 19:41998902-41998924 GCGGGGCCAGGCCGCGGCCGGGG + Exonic
1166808126 19:45499030-45499052 GCTGAGCCGCGCTGGCGCCGTGG + Exonic
1166957066 19:46471643-46471665 GCTGAGCCCGGCCGGCGCGCCGG + Intergenic
1166979389 19:46623805-46623827 GCAGCGCCAGGCGGGCGCAGCGG + Exonic
1167075199 19:47244238-47244260 GCGGAGGCCGGGCGGCCCCGTGG + Intergenic
1167134297 19:47608246-47608268 GTCGAGCCACGGCGGCGCCGGGG - Exonic
1167498090 19:49830839-49830861 TGGGAGCCAGGCCGGAGCCAGGG - Exonic
1167596811 19:50432360-50432382 GCGTAGGCAGGACGGCGGCGGGG - Intergenic
1167633501 19:50639848-50639870 GAGGAGCCGAGCCGGCACCGCGG - Intronic
1167889346 19:52527518-52527540 GCGGGGCCGGGGCGGGGCCGGGG - Intergenic
1168346629 19:55653032-55653054 GCGGGGCCAGGGCGGAGACGGGG - Exonic
1168512101 19:56981045-56981067 GCCGAGCCAGGCTGACGTCGCGG + Intergenic
925640480 2:5981821-5981843 GCTGAGACAGGACAGCGCCGCGG - Intergenic
927935317 2:27072608-27072630 ACTGAGCCAGGCCGGGGCCGGGG + Intergenic
929033666 2:37671694-37671716 GCGGGGCGGGGCCGGCGGCGCGG + Exonic
932329494 2:70889615-70889637 CCAGAGCCAGGCCGGCGAGGCGG + Intergenic
933907975 2:86914063-86914085 GCCCGGCCAGGCCGGGGCCGAGG - Intronic
933907995 2:86914112-86914134 GCCCGGCCAGGCCGGGGCCGAGG - Intronic
936278823 2:111121206-111121228 TCGGTGCCAGGCCCGCGCCCCGG - Intronic
937208668 2:120253135-120253157 GCGGAGCGGGGCCGCTGCCGGGG - Intronic
937215958 2:120313824-120313846 GCGGAGCCACGCCCGCCCCGAGG + Intergenic
937869356 2:126776696-126776718 GCGGGGCCAGGGCGGGGCCGGGG - Intergenic
937930961 2:127204974-127204996 GCTAAGCCAGCCCGGCGCCTGGG + Intronic
940130019 2:150370258-150370280 GCTGAGCAAGGCCGGGGCAGGGG + Intergenic
940316702 2:152335098-152335120 GCGGAGCCGGGCCGGGGGCGGGG + Intergenic
941112116 2:161427169-161427191 GGGGAGCCAGGGGGGTGCCGGGG + Intronic
942448376 2:176092993-176093015 GCGGCGTCAGGCCAGTGCCGCGG + Exonic
942450764 2:176106910-176106932 GCGGACCGAGGCCGGCGGGGAGG - Intronic
943737515 2:191373135-191373157 AGGCAGCCAGGCCGGCGCGGTGG - Intronic
946321992 2:218959795-218959817 GCAGAGCGGGGCCGGCGCCCAGG - Exonic
946358761 2:219206611-219206633 GCGGAGCTACGCCCGCGCCCAGG + Intronic
946422019 2:219570650-219570672 GCAGTGCCAGGCTCGCGCCGGGG + Exonic
946921520 2:224585490-224585512 GGGGAGCCCGGCGGCCGCCGCGG + Intergenic
948370699 2:237487463-237487485 GCGGGGCCAGGGTGGCGCCCAGG + Intronic
948645179 2:239400327-239400349 GCGGGGGCGGGCGGGCGCCGGGG - Intronic
948793826 2:240392224-240392246 ACGGAGCCCGGCCGGGGCTGGGG - Intergenic
1168769801 20:408024-408046 GCGGGGCCGGGGCGGGGCCGGGG - Intronic
1169278558 20:4249133-4249155 GGGGAGCCCGGCCGCCGCCCGGG - Intergenic
1169349286 20:4855266-4855288 GCTGAGCCAGCCTGGGGCCGAGG + Exonic
1169367201 20:5001305-5001327 GCCGTGCCAGGCCGGCCTCGTGG + Intronic
1170969738 20:21105459-21105481 GCAGAGCCAGGTCTGCTCCGGGG - Intergenic
1172284689 20:33732257-33732279 GGAGAGCCAGGCCGGCGGGGAGG + Intronic
1172702494 20:36862170-36862192 GCAGAGACAGGCCTGCGCCCGGG + Intronic
1175517252 20:59577472-59577494 GCGGAGCGGAGCCGGGGCCGCGG - Intergenic
1175844228 20:62050271-62050293 GCAGAGCCAGGCCGGGACCCTGG - Intronic
1175887954 20:62302975-62302997 GCGGGGCCCGGCAGGCGCCGAGG + Exonic
1176113637 20:63421854-63421876 GGGGAGCCAGGCAGGCTGCGGGG - Intronic
1176156930 20:63626767-63626789 GCGGCGTCAGGCGGGCGGCGCGG - Intronic
1176286690 21:5022455-5022477 GAGGAGCCAGGCCGGGGGCGGGG + Intergenic
1176380474 21:6110286-6110308 ACGGAGCCAGGCCGGCCGCCTGG - Intergenic
1177835436 21:26182066-26182088 GAGGTGCCAGGCAGGCGCGGTGG - Intergenic
1178772896 21:35522037-35522059 ACTGAGACAGGCAGGCGCCGTGG + Intronic
1178916701 21:36709026-36709048 GCGGAGCCGGGGAGGCGGCGGGG + Intronic
1178992627 21:37367687-37367709 CCGCAGCCGGGCCGGAGCCGAGG + Intronic
1179742998 21:43427954-43427976 ACGGAGCCAGGCCGGCCGCCTGG + Intergenic
1179801477 21:43813369-43813391 GGGGAGCCAGGCAGGGGCAGGGG + Intergenic
1179870491 21:44241020-44241042 GAGGAGCCAGGCCGGGGGCGGGG - Intergenic
1179978778 21:44885689-44885711 GCGGAGCCTGGCCAGGGCAGAGG - Intergenic
1180093105 21:45542590-45542612 GTGGGGAGAGGCCGGCGCCGGGG - Intronic
1180975240 22:19844495-19844517 GGGGCGCCAGGCAGGCGCTGAGG + Intronic
1181030308 22:20146268-20146290 CCGCAGCCAGGCCGGGGCTGCGG - Intronic
1181057760 22:20268030-20268052 CCCGAGCCCGGCCGGCGGCGGGG - Intronic
1181512987 22:23397105-23397127 CCGCAGCCAGGCCGGGGCTGGGG + Intergenic
1181710690 22:24685928-24685950 CGGGAGCCAGGCCAGTGCCGCGG + Intergenic
1183524809 22:38316903-38316925 GCGGAGGCAGGCCGGCCGGGGGG + Intronic
1183586469 22:38755800-38755822 CCGAGGCCAGGCCGCCGCCGGGG + Exonic
1183713651 22:39521049-39521071 GCGGCGGCAGGGCGGCGGCGCGG + Exonic
1184439187 22:44498224-44498246 ACCGGGCCAGGCCGGGGCCGGGG + Exonic
1184759753 22:46537648-46537670 GCGGGGCCGGGCCGGGGGCGGGG - Intergenic
1185337625 22:50277811-50277833 GCGGAGCCGGGGCTGGGCCGCGG + Intronic
950359194 3:12438377-12438399 GCAGAGCCAGGCCTGCGGGGTGG - Intergenic
950509925 3:13420025-13420047 GCCGGGCCGGGCGGGCGCCGTGG - Intronic
950650206 3:14402532-14402554 GCGGGGCCGGGGCGGGGCCGGGG - Intergenic
951640325 3:24829206-24829228 GCGGAGCCACGACGGCCCAGTGG - Intergenic
952347595 3:32502852-32502874 GCGGAGTCAGGCGGAAGCCGGGG - Exonic
953332336 3:42064175-42064197 TCGCAGCCAGGCGGGCGCTGTGG + Intronic
953620112 3:44525840-44525862 GAGGGGCCAGGCTGGAGCCGTGG - Intergenic
953890849 3:46750653-46750675 GCGGAGCAGGGCTGGGGCCGGGG + Intronic
954004018 3:47578317-47578339 GCGGGGCCGGGGCGGGGCCGGGG - Intronic
954305705 3:49724217-49724239 TCGGGGCGAGGCCGGGGCCGTGG - Intergenic
956792808 3:72693212-72693234 GGGCAGCCAGGCCTGCGCCGAGG - Intergenic
956979031 3:74614811-74614833 GCGGGGTCCGGCCGGCGCAGAGG - Intergenic
958719112 3:97822598-97822620 GCGGAGCCAGGCGGGGATCGGGG - Intronic
960639146 3:119810208-119810230 GCGCGGGCGGGCCGGCGCCGGGG + Intronic
961359413 3:126357544-126357566 GCGGGGCCAGGGCGGGGCCAGGG - Intergenic
961604429 3:128083161-128083183 GGGGAGGCAGGCTGGCGGCGGGG + Intronic
963939651 3:151086163-151086185 GCGGCTCCGGGCAGGCGCCGAGG - Intronic
966696389 3:182793850-182793872 GCGGGGAAAGGCCGGCGGCGCGG + Intronic
966883658 3:184362935-184362957 GCCGGCCCAGGCCGGCCCCGGGG + Intronic
968803149 4:2756127-2756149 GCGCGGCCAGGCGGGCGCGGAGG + Exonic
971432608 4:26584146-26584168 GCGGGGACAGGCCGCCGGCGCGG - Exonic
977908297 4:102501679-102501701 GCGGCGGCAGGCCGGAGCCCGGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
980913741 4:139015917-139015939 GCGGAGCCCGGCTGGGGCCGAGG - Exonic
984801803 4:183722990-183723012 GCCGAGCGAGGCGGGCGCCCTGG + Intergenic
985895980 5:2750455-2750477 GCTGGGCCAGGCCCGGGCCGCGG - Intronic
989523102 5:42423837-42423859 GCTGAGCCCGGGCGGCGGCGGGG + Intronic
990438750 5:55822106-55822128 GCGCAGCTAGGCTGGCCCCGCGG + Intergenic
991263490 5:64690874-64690896 GCGGAGCCACGCCAGGGCCAGGG + Intronic
991587530 5:68215694-68215716 GCGGGGCCGGGCCGGAGGCGGGG + Intergenic
1002170328 5:177371062-177371084 GCGGGGCCGGGCCGGGGCCGGGG + Intronic
1002360723 5:178668664-178668686 GAGAAGCCAGGCAGGCGGCGTGG - Intergenic
1002691351 5:181052921-181052943 GCGGGGCGAGGGCGGCGCTGCGG + Intronic
1002888177 6:1313432-1313454 GCGGGGCGAGGCCGGGGCGGCGG - Exonic
1005912881 6:30326558-30326580 GCGGCGCCTGGCCAGAGCCGGGG + Intronic
1006125397 6:31834644-31834666 GCGCTGGCCGGCCGGCGCCGGGG + Exonic
1007576693 6:42929663-42929685 CCCGAGCCAGGCCGGAGCTGAGG + Exonic
1007589817 6:43014319-43014341 GCCGAGCCGGGGCGGGGCCGCGG - Exonic
1008554841 6:52664562-52664584 GCGGGGCCAGAACGGCGCCAAGG + Intergenic
1008724769 6:54404008-54404030 GTGGAGCCAGGCCTGTGCCTGGG + Intergenic
1010209877 6:73354321-73354343 GCGGGGCCTGGCCGGGGGCGGGG - Intergenic
1010244817 6:73653548-73653570 GCGGAGCCGAGCCGGGGCCTCGG - Intronic
1012887178 6:104859532-104859554 GCGGGGCCAGGCTGGCCGCGGGG - Intronic
1014272568 6:119349927-119349949 GCGGGGCCCGGCCGGCGGCGGGG + Intergenic
1014818098 6:125956998-125957020 CGGGGGCCAGGCCGGCGCTGCGG - Exonic
1015965491 6:138692766-138692788 GCGGGGGCGGGCCGGCGGCGCGG + Intergenic
1016714055 6:147203932-147203954 GCGGGGCGAGGCAGGCGGCGCGG + Intergenic
1017764133 6:157593162-157593184 GCGGAGCCTGGCGGGAGCCCGGG + Intronic
1018062616 6:160102579-160102601 ACGGAGCCAGGCAGTCGGCGCGG + Exonic
1019711465 7:2519987-2520009 GCGCAGCCTGGCGGGCCCCGCGG + Exonic
1020274429 7:6615826-6615848 CGGGATCCAGGCCGGCGCCCGGG - Exonic
1021486085 7:21169857-21169879 GCCGAGCCAGGCCGGGGCTCCGG - Intergenic
1021554439 7:21904948-21904970 GCAGAGCTAGGCTGGGGCCGAGG - Intronic
1023287033 7:38631153-38631175 GCGGAGCGGGGCCGGGGCCAGGG - Intronic
1023638664 7:42237463-42237485 GCGGTGCCAGGTCGGGGCGGGGG - Intronic
1025940959 7:66075972-66075994 TCGGAGCCAGCCCGGCCCGGGGG + Intronic
1028727105 7:94100774-94100796 GCGCAGCCAGAGTGGCGCCGTGG - Intergenic
1029110551 7:98211370-98211392 GCGGGGCCGGGGCGGGGCCGGGG - Intergenic
1029123209 7:98281757-98281779 GCCGAGCCGGGCCGGAGCGGCGG + Exonic
1029207475 7:98878376-98878398 ACGGGGCCGGGCCGGCGCCCAGG - Intronic
1029456593 7:100675123-100675145 GCGGAGCCAGCCGGGCCCCTGGG + Intronic
1029993457 7:104983929-104983951 GTGGAGGCAGGCCCGCGCGGCGG + Intergenic
1031051868 7:116953412-116953434 CCGGAGCCCGCCCGCCGCCGGGG - Exonic
1034271130 7:149803869-149803891 GAGGAGCCAGGCCAGCCCTGAGG + Intergenic
1034418697 7:150978099-150978121 GCGGCTCCAGGCCGGGCCCGGGG - Exonic
1034483609 7:151341980-151342002 GTGGAGCTGGGCCGGGGCCGGGG + Intronic
1034967278 7:155399105-155399127 CCGGAGCCAGGCTGGAGCTGAGG + Intergenic
1037855367 8:22367489-22367511 GCGGGGACAGCCCTGCGCCGAGG + Intronic
1037957150 8:23068796-23068818 GGGGAGCCAGGCCTGGGCCCCGG - Exonic
1038422741 8:27443808-27443830 GCTGAGCCAGGCCCGCGGGGAGG - Intronic
1039502779 8:38030510-38030532 GCGGAGCGAGGCTGGAGGCGCGG + Exonic
1040559868 8:48514633-48514655 GCGGAGCCAGGTGGGCGGGGCGG + Intergenic
1041839114 8:62248788-62248810 GGGGAGCCAGGCGGGCGGGGCGG - Intronic
1042235909 8:66613149-66613171 GCGGAGCCGGGCTGGGGCCAGGG - Exonic
1046754182 8:117956225-117956247 GCAGAGCCAGGCCCGTGCCAAGG - Intronic
1046754346 8:117957521-117957543 GCAGAGCCAGGCCCGTGCCAAGG - Intronic
1047081956 8:121472265-121472287 GCGCAGCCAGGCAGAGGCCGAGG + Intergenic
1047951474 8:129939400-129939422 CCGGGGGCAGGCCGGGGCCGCGG + Intronic
1048980715 8:139702344-139702366 GCGCAGCCCAGCCCGCGCCGGGG + Intronic
1049217604 8:141415273-141415295 GGGGAGACAGGCCGGAGCCCTGG + Intronic
1049396369 8:142402996-142403018 CCGGAGCCCGGCGGGGGCCGCGG - Intronic
1049409014 8:142464201-142464223 GAGGGGCCAGGCCGCCGCCCCGG + Exonic
1049507117 8:143008709-143008731 GCGTGGCCAGGCCGGGGCCCTGG + Intergenic
1049625400 8:143617538-143617560 GCGGAGCCAGGTGGGGGGCGGGG + Exonic
1049766693 8:144358394-144358416 GCAGAGCCCGGGCAGCGCCGCGG - Exonic
1050204332 9:3181412-3181434 GGGGACCCGGGCCGGAGCCGGGG + Intergenic
1051096977 9:13477435-13477457 GTGGAGCCAGGCTGGGGCCCTGG + Intergenic
1051855485 9:21559857-21559879 GCGGAGCCGGGGCGGAGCCACGG - Intergenic
1053010274 9:34628949-34628971 GCGGAGCAAAGGCAGCGCCGTGG - Intergenic
1053072898 9:35111514-35111536 GCGGAGCCGGGGCGGCCCCGGGG - Exonic
1053697395 9:40650731-40650753 GCGGAACCGGGCGGGGGCCGCGG + Intergenic
1054308700 9:63450177-63450199 GCGGAACCGGGCGGGGGCCGCGG + Intergenic
1054407364 9:64773870-64773892 GCGGCACCAGGCGGGGGCCGCGG + Intergenic
1054489443 9:65762650-65762672 GCGGAACCGGGCGGGGGCCGCGG - Intergenic
1056532174 9:87497741-87497763 GCCCTGCCAGGCCGGCGCTGCGG - Intronic
1057322977 9:94031081-94031103 GCTGACCCCAGCCGGCGCCGAGG + Intronic
1057432233 9:95004944-95004966 GCGGGGCCTGGGCGGCGGCGCGG - Intronic
1057921968 9:99105095-99105117 CCGGAGCGAGGCCGCCGCGGCGG + Exonic
1058078257 9:100672749-100672771 GCAGAGCCAGGCTGGAGCCCAGG + Intergenic
1060139833 9:121201059-121201081 GCCGGGCCGGGCCGGGGCCGGGG - Intronic
1060468632 9:123929847-123929869 GCGGAGCCGGGCCGGGCGCGGGG - Intronic
1060552690 9:124492984-124493006 GCGGGGCCAGGGCGGGGCCCAGG + Intronic
1060811238 9:126612615-126612637 GCGGAGCCGGGCGGGGGCGGAGG - Intergenic
1061579991 9:131530839-131530861 GAGGAGCCCGGCCGGCGGAGAGG + Intronic
1061843875 9:133376062-133376084 GCGGAGCGAGGCCGGCCGCCGGG - Exonic
1062574395 9:137199740-137199762 GCGGAGGCTGGCCAGCGCCCGGG + Exonic
1062579218 9:137222133-137222155 GCGGGGCCCGGGCGGCACCGAGG + Intergenic
1062696971 9:137880502-137880524 CAGGAGCCAGGCCGGGGCGGGGG + Intronic
1185836193 X:3347196-3347218 GGGGAGGGAGGCGGGCGCCGGGG - Intergenic
1187225893 X:17375285-17375307 GCGGGGAGAGGCCTGCGCCGGGG + Intergenic
1189325494 X:40108732-40108754 GAGGAGCCCGGCCGGATCCGAGG - Intronic
1192260855 X:69505172-69505194 GTAGAGCCTGGACGGCGCCGAGG + Intergenic
1192624521 X:72714015-72714037 GCGGCGCCAGGCCTGAGCGGTGG - Exonic
1193749720 X:85326902-85326924 GCAGAGCCAGTCTGGGGCCGCGG + Intronic
1198267447 X:135022456-135022478 GCGGAGCCAGCGCGGCGCGATGG - Exonic
1200249863 X:154547131-154547153 GCGGGGCCGGGCCGGCGATGGGG - Exonic