ID: 1151802754

View in Genome Browser
Species Human (GRCh38)
Location 17:76387435-76387457
Sequence AAGGTGTGTTTGCAGTGGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151802750_1151802754 -10 Left 1151802750 17:76387422-76387444 CCCAAGGATGGGAAAGGTGTGTT 0: 1
1: 1
2: 3
3: 21
4: 244
Right 1151802754 17:76387435-76387457 AAGGTGTGTTTGCAGTGGATGGG 0: 1
1: 0
2: 1
3: 17
4: 174
1151802742_1151802754 14 Left 1151802742 17:76387398-76387420 CCCGTGGTCGCCTTCCGCTTGGA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1151802754 17:76387435-76387457 AAGGTGTGTTTGCAGTGGATGGG 0: 1
1: 0
2: 1
3: 17
4: 174
1151802745_1151802754 4 Left 1151802745 17:76387408-76387430 CCTTCCGCTTGGAGCCCAAGGAT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1151802754 17:76387435-76387457 AAGGTGTGTTTGCAGTGGATGGG 0: 1
1: 0
2: 1
3: 17
4: 174
1151802743_1151802754 13 Left 1151802743 17:76387399-76387421 CCGTGGTCGCCTTCCGCTTGGAG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1151802754 17:76387435-76387457 AAGGTGTGTTTGCAGTGGATGGG 0: 1
1: 0
2: 1
3: 17
4: 174
1151802748_1151802754 0 Left 1151802748 17:76387412-76387434 CCGCTTGGAGCCCAAGGATGGGA 0: 1
1: 0
2: 1
3: 12
4: 195
Right 1151802754 17:76387435-76387457 AAGGTGTGTTTGCAGTGGATGGG 0: 1
1: 0
2: 1
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151802754 Original CRISPR AAGGTGTGTTTGCAGTGGAT GGG Exonic
902923234 1:19679598-19679620 AACTTGTGTGTGCAGAGGATGGG + Intergenic
904120198 1:28193222-28193244 TAGGTTTGTTTGCAGTGAGTGGG + Intronic
908561008 1:65306497-65306519 GAGGTGTGTATGAAGGGGATGGG + Intronic
909272763 1:73644914-73644936 TAAGTGTGTTTGCAGTGAACAGG - Intergenic
913209109 1:116569091-116569113 AAACTGGGTTTGCAGTGGAAGGG + Intronic
916844079 1:168630547-168630569 AATGTGTGTGTGCAGGGAATGGG + Intergenic
918311204 1:183286749-183286771 AAGGTGTGTTGACATTGGAGAGG + Exonic
920271940 1:204771962-204771984 TCGGTGTGTTTGCAATGAATGGG + Intergenic
920356336 1:205375998-205376020 CAGGTCAGTTTGCAGTGTATTGG - Intergenic
923759861 1:236832205-236832227 AATGTGTGTTTGCAGCAGACTGG + Intronic
924073601 1:240309255-240309277 AAGGTGTGTTTGCAGCCCACTGG + Intronic
1063543232 10:6955500-6955522 AAGGGATGTGGGCAGTGGATGGG + Intergenic
1064352169 10:14586230-14586252 AAGGTGGGTTTTCAGTGGCCTGG - Intronic
1066128918 10:32371258-32371280 ATGGAGAGTTTCCAGTGGATTGG + Intronic
1066156956 10:32688379-32688401 AAGCAGTGTTTGCAGTGACTTGG + Intronic
1066280549 10:33913556-33913578 AAGGTGGTTTTGCCATGGATTGG + Intergenic
1068492411 10:57740368-57740390 AAGATGTGTTTTCTGTGGTTGGG - Intergenic
1068916135 10:62433714-62433736 AATGTGTGTTTGGCCTGGATTGG - Intronic
1069567008 10:69470314-69470336 AAGGTGCCTTTGCAATGGAGAGG - Intronic
1074925366 10:118063536-118063558 ATGGGGTCTTTGCATTGGATTGG - Intergenic
1075602685 10:123781973-123781995 AAGCTGTGTTTTCAGTGCTTGGG - Intronic
1075714448 10:124548002-124548024 GGGGTGTGTTTGCTGTGGATGGG + Intronic
1075845949 10:125545128-125545150 AAGGTGTGTTGGCTGTGGCTGGG - Intergenic
1077482726 11:2824068-2824090 AAGGTGTTTGTGCTGTGGAAAGG - Intronic
1083183844 11:61006342-61006364 AAGCTGTGTGTGCAATGAATAGG + Intronic
1084468224 11:69339724-69339746 CATGTGTGTTTGCAGTGGGATGG + Intronic
1086979624 11:93179055-93179077 AATGGGTGTTTGCACAGGATGGG + Intronic
1090484291 11:127098776-127098798 AAGGTGTATTTCCAGAGGTTAGG + Intergenic
1095316350 12:40766495-40766517 AATGTGTGTATGTATTGGATGGG + Intronic
1095436763 12:42197369-42197391 AATGTGTGATCACAGTGGATGGG + Intronic
1101589863 12:106116007-106116029 AAGGGGTCATTGCAGGGGATGGG - Intronic
1103176635 12:118869628-118869650 AAGGTGTGTATGCAGGGGCATGG - Intergenic
1104440479 12:128789649-128789671 AGGGAGTGTTTCCAGAGGATGGG - Intergenic
1106876930 13:34084328-34084350 AAGGTGTGTCTGCACTGGATAGG - Intergenic
1107574653 13:41705279-41705301 AATGTGTGTGTGCAGGGGGTCGG + Intronic
1107957986 13:45535227-45535249 AAGTTGAGTTTGGAGTAGATTGG + Exonic
1108940771 13:55949671-55949693 TTGGTGTTTTTGCAGTGGCTGGG - Intergenic
1110036774 13:70697354-70697376 AAAGTTTGTTTGCATTGGTTTGG + Intergenic
1112717562 13:102204387-102204409 GAGGTGTGGTTACAGTGGGTGGG - Intronic
1116561869 14:46390051-46390073 AAGGTGTGTTTTCAGGGTAGTGG + Intergenic
1118050344 14:62019777-62019799 GAGGTGTGATTGCAGTGCAGCGG + Intronic
1118438392 14:65791504-65791526 AAAGTGTGTGTGTAGGGGATGGG + Intergenic
1128160027 15:65417447-65417469 AAGATGTGTTTTCAGAGAATTGG - Intronic
1128417076 15:67456860-67456882 ATGGGGTGTTTGGAGTGGGTGGG - Intronic
1128506372 15:68275914-68275936 AAAGTGTGTTGGCAGAGGAGAGG + Intergenic
1129689135 15:77703446-77703468 AAAGTGTGTTAGTAGTGGAGGGG - Intronic
1133446701 16:5867455-5867477 ATGGTGTGTTTTCAGTTGAGTGG + Intergenic
1133571401 16:7043989-7044011 AAGAGGTGCTTGCAGTGCATAGG - Intronic
1133706002 16:8355201-8355223 AATTTGTGTTTGCGGTGGGTTGG + Intergenic
1133861374 16:9598587-9598609 AAGGGGTGTTAGAAGTTGATAGG - Intergenic
1135435005 16:22420840-22420862 AAGGTGCAGTTGCAGTGGGTGGG + Intronic
1136506583 16:30708101-30708123 AAGGTGGGTGTGGAGTGGAAGGG - Intronic
1138549810 16:57741231-57741253 GAGGTGTGTAGGCAGTGCATGGG + Intronic
1139439557 16:66959222-66959244 AAGCTGTGTTTGCAGCTGATGGG + Intergenic
1142397281 16:89839434-89839456 CAGGAGTGTTGGCAGTGGGTGGG + Intronic
1144253786 17:13445417-13445439 AAGTTGTGTGTGTAGTGGAGTGG - Intergenic
1148443723 17:47725496-47725518 GAGGAGTGTTTGCAGTGGGCGGG - Intergenic
1149204961 17:54233476-54233498 AAGATGTGTTTGCGGTGCATTGG + Intergenic
1150341750 17:64374082-64374104 AAGTTGGGTTTGGAGGGGATCGG - Intronic
1150992420 17:70275156-70275178 CAGGTGTGTTTGCTGGGGCTAGG - Intergenic
1151361671 17:73592923-73592945 ATGCTGTGTTTGCAGCGCATGGG + Intronic
1151802754 17:76387435-76387457 AAGGTGTGTTTGCAGTGGATGGG + Exonic
1153344656 18:4012398-4012420 CAGATGTTTTTGCAGTGGCTGGG - Intronic
1154340152 18:13496079-13496101 AAGGTGAGTATGCAGGGGACAGG + Intronic
1155761514 18:29574600-29574622 CAGGAGTGTTGGCTGTGGATGGG + Intergenic
1159205336 18:65243606-65243628 AAGCTGTAGTTGTAGTGGATGGG + Intergenic
1162178589 19:8850218-8850240 AAAATGTGTTTGCAGTGGCAGGG - Intronic
1165159674 19:33808634-33808656 AAGGGGTGTGTGCAGGGGAAGGG + Intronic
925152603 2:1625495-1625517 AAGGTGTGTTTGGAATGCCTGGG + Intergenic
925308117 2:2864545-2864567 AAGTTGTGTATTCAGTGGAAAGG + Intergenic
925363677 2:3296481-3296503 AGGGTGTGTGTGGAGAGGATGGG - Intronic
927024233 2:19049197-19049219 AATGTGTCTTGGCGGTGGATGGG + Intergenic
927040074 2:19220431-19220453 AAGGTGTGTATGAAGTGGGGAGG + Intergenic
927663410 2:25012106-25012128 AGGGTGTGTATGCAGTGAGTGGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929680971 2:43993438-43993460 GCGGTGTGACTGCAGTGGATAGG + Intronic
932941221 2:76168908-76168930 AAGGTGTTTGAGCAGTTGATCGG + Intergenic
933746160 2:85572854-85572876 AAGGTGAGTTTAGAGGGGATTGG + Intronic
936740204 2:115496734-115496756 AACTGGTTTTTGCAGTGGATAGG - Intronic
941143264 2:161811940-161811962 AAGGTGGGTTTGCAGGAGGTTGG - Intronic
942154979 2:173119199-173119221 AAGGTGTGTTTGCAGCCGACTGG + Intronic
942381013 2:175390678-175390700 AGTGTGTGTTTGCTGTGGAATGG + Intergenic
942499924 2:176578735-176578757 AAGGAGTGTTGGCTGTGTATTGG - Intergenic
943643026 2:190379768-190379790 AAGGTGTGGTTGGAGAGGAGGGG - Intergenic
944940335 2:204618268-204618290 ATGGAGTGTGTGCAGTGGAAAGG + Intronic
946630057 2:221657233-221657255 AGGGTGATTTGGCAGTGGATAGG + Intergenic
948399716 2:237674893-237674915 AGGGAGGGTTTGCAGTGGAGAGG - Intronic
1170428483 20:16258049-16258071 AAGGTGTGTGTGCATGGGATAGG - Intergenic
1172947001 20:38697412-38697434 AAAGTGGGTTGGAAGTGGATGGG + Intergenic
1173152203 20:40577179-40577201 CAAGGGTGTTTCCAGTGGATGGG + Intergenic
1177016679 21:15798123-15798145 AAGTCATGTTTGCAGTGGAGTGG - Intronic
1181068164 22:20316317-20316339 AAGGGGTGTCTGCAGTGGGGAGG + Intronic
950053489 3:10008894-10008916 GAGGTGTGTCTGCAGAGCATTGG + Intronic
950305133 3:11911171-11911193 GAGGTGTGTCTGCAGAGCATTGG + Intergenic
950305916 3:11915323-11915345 TAGGTGTGTCTGCAGAGCATTGG + Intergenic
950415243 3:12865592-12865614 GAGGTGTGTCTGCAGAGCATTGG + Intronic
952172581 3:30825084-30825106 AAGGTATGTTTGCTGTGCAAGGG + Intronic
952865564 3:37853062-37853084 AATGTGGGTTGGCAGTGTATGGG + Intergenic
956614125 3:71153859-71153881 AAGGTGTGTTTTCAGAGGTACGG + Intronic
956914029 3:73851864-73851886 AAGGTGTGTTTTCTTTGGTTTGG + Intergenic
959369046 3:105500033-105500055 AAGGTCAGTGTGCAGTAGATTGG + Intronic
961203924 3:125066085-125066107 AAGGTTTGTTTTGGGTGGATGGG - Intergenic
962419969 3:135219208-135219230 AAGGTGTGTTAGCTCTGGAAGGG + Intronic
962445749 3:135462591-135462613 CAGCTGTGTTTCCTGTGGATGGG + Intergenic
963278030 3:143352239-143352261 AAGAAGTGTTTGCAGTTGCTGGG + Intronic
964428619 3:156580007-156580029 AAGGTGTGATTCCAGTGATTAGG - Intergenic
969544826 4:7819025-7819047 ACGGTGACCTTGCAGTGGATTGG - Intronic
970885666 4:20984989-20985011 AGGGTCTGTTTGGAGTGGTTTGG - Intronic
971498136 4:27289479-27289501 AAGGTCTGTGTGCTCTGGATGGG - Intergenic
972727025 4:41753688-41753710 AAGGTGTATTTGTATTAGATAGG + Intergenic
973813240 4:54594046-54594068 GAGGTTTGTTGGCAGTGGGTGGG + Intergenic
974954764 4:68623808-68623830 AAAGTATGTTTGCATTGGAAAGG - Intronic
976035094 4:80808997-80809019 AAGCTGTTTTTGCTTTGGATTGG - Intronic
977920115 4:102633882-102633904 AAGGTATGTTTTCAGTTGTTAGG + Intronic
978696671 4:111588390-111588412 AATGTGTGTTTGATGAGGATGGG + Intergenic
979838293 4:125402767-125402789 AAGGTAAGTTTGGAGTGTATAGG - Intronic
981016620 4:139980325-139980347 GAGGTGTGTATGCAGAGGGTGGG - Intronic
983876503 4:172882807-172882829 GAGGTCTCTTTGCTGTGGATCGG + Exonic
985581454 5:697515-697537 AACTTGTGTCTGCAGTGGAGAGG + Intergenic
985620266 5:951316-951338 AAGGTCTGTTTGCCTTGGAAAGG + Intergenic
987655301 5:20798507-20798529 AAGGTGTGTTTCAAGTGTACTGG + Intergenic
988768258 5:34405395-34405417 AAGGTGTGTTTCAAGTGTACTGG - Intergenic
988998733 5:36739645-36739667 CAGGTGAGTCCGCAGTGGATGGG - Intergenic
989406186 5:41063818-41063840 AAGCAGTGTTTGCAGTGTACAGG - Intronic
990154218 5:52856476-52856498 AAGGTGTTTTTATAGTGGATGGG - Intronic
991464752 5:66898964-66898986 AAGGTGAGTTTGAAGCTGATGGG + Intronic
991636097 5:68707461-68707483 AAGGTGTGGTTAGAGAGGATAGG - Intergenic
992344562 5:75863629-75863651 AGGGTTTGTATGCAGTGGCTTGG + Intergenic
992502397 5:77355654-77355676 AAAGTGTGTGTGCAGAGGAGAGG - Intronic
992878121 5:81077701-81077723 CAGGTCTGATGGCAGTGGATGGG + Intronic
996457633 5:123702879-123702901 GATGTGTGGTTGCAGTGGAATGG + Intergenic
1001213865 5:169837064-169837086 AAGGTGAGCTGGGAGTGGATGGG - Intronic
1001937244 5:175714263-175714285 ATGGTGTGTTTGCAGAAGAGAGG - Intergenic
1003036705 6:2646352-2646374 TATGTGTGTGTGTAGTGGATGGG + Intergenic
1003036723 6:2646463-2646485 TGGGTGTGTGTGTAGTGGATGGG + Intergenic
1003036757 6:2646656-2646678 AGTGTGTGTGTGTAGTGGATGGG + Intergenic
1007788049 6:44292787-44292809 AAGGTCTGTTTGCGGTGGGAGGG + Intronic
1008044491 6:46837747-46837769 AAGTTGTGTTTGGAGAGGACTGG + Intronic
1008308830 6:49939822-49939844 CAGGTGTGTTTGCAGTATGTAGG + Intergenic
1008512822 6:52292687-52292709 ATGGTGTGAATGCTGTGGATAGG - Intergenic
1008525790 6:52405413-52405435 CATGTGTGTTTACTGTGGATTGG + Exonic
1011104878 6:83768535-83768557 TAGCAGTGTTGGCAGTGGATTGG - Intergenic
1015108520 6:129565909-129565931 AAGTTGTGTATGCAGTCGGTTGG - Intergenic
1018675623 6:166219786-166219808 CAGGTGGGTTTGGAGTGGGTTGG + Intergenic
1023059701 7:36315641-36315663 AAGGAGTGAGTGCAGTGGGTGGG + Intergenic
1023265690 7:38403544-38403566 AAGGTATGTTTGCAGGGGTCTGG - Intronic
1026275722 7:68874137-68874159 AAAGTGTCTGTGAAGTGGATTGG + Intergenic
1026288316 7:68983573-68983595 AATGTGTGCTTGCTGTTGATTGG - Intergenic
1028365368 7:90022925-90022947 AAGGTGTATTTGCTTTGGAGGGG - Intergenic
1030747720 7:113188098-113188120 AAGGAATTTTTGCAGGGGATTGG - Intergenic
1030945190 7:115710369-115710391 AAGATGTGTTTGCTTTGGTTTGG + Intergenic
1031959277 7:127974322-127974344 AAGGTGAATTTGGAGTGGTTTGG + Intronic
1033636244 7:143213901-143213923 TATGTGTGTTTGCAGGGGGTAGG - Intergenic
1033653670 7:143360124-143360146 ATGAGGTGATTGCAGTGGATTGG - Exonic
1035912596 8:3584009-3584031 GAGGTGTTTTTATAGTGGATGGG - Intronic
1036937714 8:13019929-13019951 AAGGTTTGTGTGCTGTTGATAGG + Intronic
1038406270 8:27325220-27325242 AAGGTGTGTGTGAGGTGGGTGGG - Intronic
1040013816 8:42683896-42683918 AATGTGTCTTGGAAGTGGATTGG + Intergenic
1040692499 8:49956976-49956998 AAGGTGTTTTGCCAGGGGATAGG + Intronic
1041062556 8:54049822-54049844 AAGGATTGTATGAAGTGGATAGG - Intronic
1042470969 8:69187541-69187563 ATGTTGTCTTTGCAGTGTATAGG + Intergenic
1043965824 8:86473884-86473906 AAGGTGTGGTGACAGTGGTTAGG - Exonic
1045073640 8:98538875-98538897 AAGGTGTGGCTGCAGTGGTTTGG - Intronic
1045693789 8:104785719-104785741 AAGTTGCTTTTGCAGTGCATGGG + Intronic
1048376120 8:133823863-133823885 AAGGTGAGTTTGAAGTGGTTTGG - Intergenic
1050069058 9:1791507-1791529 AATGTGTGCTTGCAGGGGAAAGG + Intergenic
1051411806 9:16797410-16797432 GATGTGTGTTTGCCATGGATTGG - Intronic
1052189945 9:25648508-25648530 AACCTGTGTATGGAGTGGATTGG - Intergenic
1052270667 9:26625258-26625280 AAGCTGAGAATGCAGTGGATAGG + Intergenic
1053653103 9:40189188-40189210 AAGTTGTGTTTGGAGGGGACTGG - Intergenic
1053903506 9:42818491-42818513 AAGTTGTGTTTGGAGGGGACTGG - Intergenic
1054531481 9:66187035-66187057 AAGTTGTGTTTGGAGGGGACTGG + Intergenic
1055113773 9:72585823-72585845 GAGGTGAGTGTGGAGTGGATGGG + Intronic
1055178421 9:73350901-73350923 AAGGGTGGTTTTCAGTGGATGGG - Intergenic
1058772274 9:108247527-108247549 ATAGTGTGTGTGCAGTGGGTTGG - Intergenic
1058772278 9:108247551-108247573 ATGGTGTGTGTGCAGTGGGTTGG - Intergenic
1058772289 9:108247599-108247621 ATAGTGTGTGTGCAGTGGGTTGG - Intergenic
1058772297 9:108247645-108247667 ATGGTGTGTGTGCAGTGTGTTGG - Intergenic
1058772321 9:108247809-108247831 ATGGTGTGTGTGCAGTGGGTTGG - Intergenic
1058772334 9:108247904-108247926 ATGGTGTGTGTGCAGTGGGTTGG - Intergenic
1058772339 9:108247928-108247950 ATGGTGTGTGTGCAGTGTGTTGG - Intergenic
1058772352 9:108247999-108248021 ATGGTGTGTGTGCAGTGGGTTGG - Intergenic
1058772363 9:108248071-108248093 ATGGTGTGTGTGCAGTGGGTTGG - Intergenic
1058772374 9:108248142-108248164 ATGGTGTGTGTGCAGTGGGTTGG - Intergenic
1058772385 9:108248213-108248235 ATGGTGTGTGTGCAGTGGGTTGG - Intergenic
1058772400 9:108248309-108248331 ATGGTGTGTGTGCAGTGGGTAGG - Intergenic
1060536144 9:124389660-124389682 GTGGAGTGTCTGCAGTGGATGGG - Intronic
1062079505 9:134615891-134615913 AAGGTGGGTTTCCACTGGACAGG + Intergenic
1192861402 X:75076425-75076447 AAGTTGTGTTTGTAGTGAAAAGG + Intronic
1193136065 X:77972074-77972096 AATGTATGTTTTCAGGGGATGGG + Intronic
1196563543 X:117178307-117178329 TGGGTGTGTTTGCAATGGGTTGG + Intergenic
1197653079 X:129086698-129086720 AGGGTGGGTTTGCACTGGGTGGG - Intergenic
1201910751 Y:19131298-19131320 AAGGTGTGTTTTCGTTGGAAGGG - Intergenic