ID: 1151805561

View in Genome Browser
Species Human (GRCh38)
Location 17:76402864-76402886
Sequence GATGCAGCCTAGAACTTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 74}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151805561_1151805567 8 Left 1151805561 17:76402864-76402886 CCCTACAAGTTCTAGGCTGCATC 0: 1
1: 0
2: 0
3: 14
4: 74
Right 1151805567 17:76402895-76402917 TCTTCCCAGTGAGGAGGAAGTGG 0: 1
1: 2
2: 11
3: 103
4: 641
1151805561_1151805575 22 Left 1151805561 17:76402864-76402886 CCCTACAAGTTCTAGGCTGCATC 0: 1
1: 0
2: 0
3: 14
4: 74
Right 1151805575 17:76402909-76402931 AGGAAGTGGTGGTGGTGGTGGGG 0: 1
1: 6
2: 34
3: 376
4: 1970
1151805561_1151805568 11 Left 1151805561 17:76402864-76402886 CCCTACAAGTTCTAGGCTGCATC 0: 1
1: 0
2: 0
3: 14
4: 74
Right 1151805568 17:76402898-76402920 TCCCAGTGAGGAGGAAGTGGTGG 0: 1
1: 0
2: 1
3: 55
4: 494
1151805561_1151805564 -1 Left 1151805561 17:76402864-76402886 CCCTACAAGTTCTAGGCTGCATC 0: 1
1: 0
2: 0
3: 14
4: 74
Right 1151805564 17:76402886-76402908 CCCAGCTGCTCTTCCCAGTGAGG 0: 1
1: 0
2: 6
3: 35
4: 330
1151805561_1151805574 21 Left 1151805561 17:76402864-76402886 CCCTACAAGTTCTAGGCTGCATC 0: 1
1: 0
2: 0
3: 14
4: 74
Right 1151805574 17:76402908-76402930 GAGGAAGTGGTGGTGGTGGTGGG 0: 1
1: 2
2: 38
3: 325
4: 1651
1151805561_1151805571 14 Left 1151805561 17:76402864-76402886 CCCTACAAGTTCTAGGCTGCATC 0: 1
1: 0
2: 0
3: 14
4: 74
Right 1151805571 17:76402901-76402923 CAGTGAGGAGGAAGTGGTGGTGG 0: 1
1: 0
2: 8
3: 144
4: 1027
1151805561_1151805573 20 Left 1151805561 17:76402864-76402886 CCCTACAAGTTCTAGGCTGCATC 0: 1
1: 0
2: 0
3: 14
4: 74
Right 1151805573 17:76402907-76402929 GGAGGAAGTGGTGGTGGTGGTGG 0: 2
1: 22
2: 324
3: 3635
4: 9217
1151805561_1151805576 30 Left 1151805561 17:76402864-76402886 CCCTACAAGTTCTAGGCTGCATC 0: 1
1: 0
2: 0
3: 14
4: 74
Right 1151805576 17:76402917-76402939 GTGGTGGTGGTGGGGCTGCCTGG 0: 1
1: 0
2: 11
3: 186
4: 1255
1151805561_1151805566 2 Left 1151805561 17:76402864-76402886 CCCTACAAGTTCTAGGCTGCATC 0: 1
1: 0
2: 0
3: 14
4: 74
Right 1151805566 17:76402889-76402911 AGCTGCTCTTCCCAGTGAGGAGG 0: 1
1: 0
2: 6
3: 153
4: 875
1151805561_1151805572 17 Left 1151805561 17:76402864-76402886 CCCTACAAGTTCTAGGCTGCATC 0: 1
1: 0
2: 0
3: 14
4: 74
Right 1151805572 17:76402904-76402926 TGAGGAGGAAGTGGTGGTGGTGG 0: 2
1: 3
2: 41
3: 467
4: 3322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151805561 Original CRISPR GATGCAGCCTAGAACTTGTA GGG (reversed) Intronic
902579020 1:17396774-17396796 GACACAGCCTAGAGCTTGTTAGG - Intronic
904667401 1:32133607-32133629 CCTGCAGCCTAGACCTTGTGAGG - Intronic
907735144 1:57104906-57104928 GAAGCAGCCTAGGACTGGAAGGG - Intronic
912557353 1:110525648-110525670 GAGGCTGGGTAGAACTTGTACGG + Intergenic
914701496 1:150137989-150138011 GATGGAGCCTAGAAAGAGTAAGG - Intronic
915376706 1:155402621-155402643 AATGCAGCCTTGAACTCCTAAGG + Intronic
916455901 1:164970655-164970677 GATGCAACCTAGATTTTGTGGGG + Intergenic
917901498 1:179547473-179547495 GGTGCAGCAAAGAACGTGTAAGG + Intronic
919872126 1:201829623-201829645 GATGGAGCCTAGAATCTGCAGGG + Intronic
921088067 1:211815165-211815187 TGTGCAGTCTGGAACTTGTAAGG - Intronic
922279793 1:224113022-224113044 GCTGCAGCCTCGAACTCGTGTGG + Intergenic
1064722811 10:18247016-18247038 GATGCAGCCTCGCAGTTGTAAGG + Intronic
1074705080 10:116123091-116123113 AATGCAGCCAAGAAGCTGTAGGG - Intronic
1076144209 10:128104189-128104211 GAGGCAGCTGAGAACTCGTAAGG - Exonic
1076144347 10:128105284-128105306 GAGGCAGCCAAGAACTCCTAAGG - Exonic
1083411487 11:62496259-62496281 GAGGGAGCCTAGGACTTTTAAGG - Intronic
1086374513 11:86186593-86186615 GATCAAGCCAAGAACTTGGAAGG + Intergenic
1089724913 11:120468003-120468025 GATGCAGGCTAGAACAAGGATGG - Intronic
1089742185 11:120592265-120592287 GAAGCAGCCCAGAACTTGTGCGG + Intronic
1090291139 11:125545915-125545937 GGTGCTGCCCAGAACTTGCATGG - Intergenic
1092481254 12:8861100-8861122 GATGAAGACTATAACTTATAAGG - Intronic
1099609143 12:84844243-84844265 TATGCAACCTAGAACTTTCATGG + Intergenic
1099983235 12:89631287-89631309 CATACTGCCTAGAATTTGTAGGG + Intronic
1101516678 12:105442607-105442629 GAAGGTGACTAGAACTTGTATGG - Intergenic
1101833663 12:108279561-108279583 TATGAAGCCTTGAACTTGTCAGG - Intergenic
1104819830 12:131670035-131670057 GAACCAACCTATAACTTGTAAGG + Intergenic
1113301930 13:109031926-109031948 GATACTGCCTAGACATTGTACGG + Intronic
1113445992 13:110367309-110367331 AATGGAGCCAAGAACTTGTTAGG - Intronic
1117429522 14:55641508-55641530 GATGCACCCTAGCACTTGGTTGG - Intronic
1117457749 14:55914686-55914708 AAAGCAGCCCAGAGCTTGTATGG + Intergenic
1118159621 14:63275427-63275449 GATGCAGCCTATAATATTTAGGG + Intronic
1120692905 14:87613203-87613225 GATGCATCCTAGAATGTTTAGGG - Intergenic
1122737289 14:103850053-103850075 GATGCATCCTAGCATATGTAAGG + Intergenic
1124996169 15:34724758-34724780 AATGCAGTCTAGCACTTGTTTGG + Intergenic
1126304827 15:47243871-47243893 AATGCAGCCTAGAACATGGTAGG - Intronic
1131547218 15:93325913-93325935 GTTGCAAGCTAGAACTTCTAGGG + Intergenic
1133398804 16:5469684-5469706 GATGCAGACTAGCAGTTGTCAGG - Intergenic
1143298646 17:5891484-5891506 GAGGTAGCCTAGAACTAGTTAGG - Intronic
1148857556 17:50587042-50587064 GATGCAGGCTAGACCTGGGAAGG + Intronic
1151805561 17:76402864-76402886 GATGCAGCCTAGAACTTGTAGGG - Intronic
1159288324 18:66382253-66382275 GTTGCAGCCTGGAACCTGAAAGG + Intergenic
1160790082 19:919114-919136 GGTGCAGCCTAGAACTGGAGTGG + Intronic
925441934 2:3895463-3895485 CATGCAGCCTGCAACTTGAAAGG + Intergenic
936292288 2:111235548-111235570 GCCCCAGCCTAGAACTTGCAGGG - Intergenic
938987464 2:136592157-136592179 GATGCAGCAAAGAATTTTTATGG - Intergenic
942985900 2:182141745-182141767 GATGCAGCAGAAAACTTGTTAGG + Exonic
944142588 2:196473305-196473327 GATGAAACCTAGAAATTGAAAGG - Intronic
1171355407 20:24541632-24541654 GATGCAGCCCAGAAAGTGTTTGG + Intronic
1174847014 20:53952281-53952303 GATACAGCCTTGAACCTGAAAGG + Intronic
1176692073 21:9926239-9926261 CATGCATCCTAGAACTTGTTAGG - Intergenic
1179171101 21:38973428-38973450 GATGCAGCCTAGAACTTAAGAGG + Intergenic
952239468 3:31515598-31515620 TATGCAGCCTAGAAAATGTAGGG - Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955488133 3:59455411-59455433 GAGGAAGCCTAGCCCTTGTAAGG - Intergenic
956612418 3:71137566-71137588 GATGCAGCCTAAAGCTTTTGTGG + Intronic
961642189 3:128371661-128371683 GATGCACCCCAGAACCTGTTGGG + Intronic
963055695 3:141184770-141184792 GATGTAGCCTAGAAATTTCAAGG - Intergenic
974708110 4:65549604-65549626 GATGCATGCTATAATTTGTAGGG + Intronic
979026972 4:115589448-115589470 GATTGAGCATAGAATTTGTATGG - Intergenic
980364667 4:131786471-131786493 TATGCATCCTAGAACTTGTTAGG - Intergenic
984969010 4:185169726-185169748 GATGAAGCAAAGACCTTGTAAGG + Intronic
985957053 5:3273707-3273729 GATGCAGGCTAGACCTTGGGAGG - Intergenic
988431706 5:31126523-31126545 GATGCTGCCTAGGACTTTCATGG + Intergenic
989081856 5:37630924-37630946 GATGGAGCTGAGAGCTTGTAAGG + Intronic
992606944 5:78467191-78467213 AATGAAGCCTAGAAAGTGTATGG + Intronic
997644643 5:135473446-135473468 GCTGCAGCCTAGAAGTGGCAGGG + Intergenic
1004853669 6:19726861-19726883 GAAGAAGCCTTGAACTTTTAGGG + Intergenic
1005383083 6:25257421-25257443 TAAGGAGCCTACAACTTGTATGG - Intergenic
1010156740 6:72802972-72802994 GATGCAGCCTAGGAGTTGATAGG - Intronic
1016624312 6:146147740-146147762 CCTGCAGCCTAGCCCTTGTAGGG + Intronic
1022969902 7:35507423-35507445 GATTCAGCCAACAACTTGAATGG - Intergenic
1028202712 7:87980909-87980931 AATGCAGCCTAGGACTAGTGTGG - Intronic
1028661918 7:93287757-93287779 GTTGCAGCCCAGAACTTTTTGGG + Intronic
1030332921 7:108292211-108292233 GATGCTGTCTAGACCTTGCATGG + Intronic
1031501318 7:122521381-122521403 CAAGCAGCAGAGAACTTGTAGGG - Intronic
1034272216 7:149808862-149808884 GATTCAGCCTAGAACTGGGCTGG - Intergenic
1043259266 8:78176981-78177003 GATGCAGCCTGGCAATTGCATGG + Intergenic
1053629011 9:39912330-39912352 CATGCATCCTAGAACTTGTTAGG - Intergenic
1053776756 9:41551240-41551262 TATGCATCCTAGAACTTGTTAGG + Intergenic
1054214876 9:62338372-62338394 CATGCATCCTAGAACTTGTTAGG + Intergenic
1054364973 9:64327245-64327267 TATGCATCCTAGAACTTGTTAGG - Intergenic
1054672604 9:67816977-67816999 CATGCATCCTAGAACTTGTTAGG - Intergenic
1054754695 9:68945860-68945882 GATGAAGACGAGAACTTGTATGG - Intronic
1057260380 9:93579824-93579846 GCGGCAGCCGAGAACTTGTTTGG + Intronic
1059576464 9:115494120-115494142 GAGGAAGCCTAGAACTCATATGG + Intergenic
1061829870 9:133284939-133284961 TATGCTGCCTAGAACTTGGTAGG + Intergenic
1187261724 X:17690943-17690965 GCTGCAGCCTCCAACTTGAAAGG - Intronic
1187355052 X:18560646-18560668 GATCCAACCTAGAAGTTGTAAGG + Intronic
1200928852 Y:8678987-8679009 GAGGCTGCCTAGAAGTTGTAGGG - Intergenic