ID: 1151807105

View in Genome Browser
Species Human (GRCh38)
Location 17:76412583-76412605
Sequence TTGGTTGTCCCTGAGCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 153}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151807096_1151807105 14 Left 1151807096 17:76412546-76412568 CCTCCCCTCCTGTCTCAGCTGAG 0: 1
1: 0
2: 6
3: 65
4: 449
Right 1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 153
1151807095_1151807105 15 Left 1151807095 17:76412545-76412567 CCCTCCCCTCCTGTCTCAGCTGA 0: 1
1: 0
2: 6
3: 49
4: 525
Right 1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 153
1151807100_1151807105 9 Left 1151807100 17:76412551-76412573 CCTCCTGTCTCAGCTGAGGCCTC 0: 1
1: 0
2: 5
3: 40
4: 375
Right 1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 153
1151807094_1151807105 22 Left 1151807094 17:76412538-76412560 CCTCTCTCCCTCCCCTCCTGTCT 0: 1
1: 5
2: 76
3: 1158
4: 8860
Right 1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 153
1151807093_1151807105 26 Left 1151807093 17:76412534-76412556 CCAGCCTCTCTCCCTCCCCTCCT 0: 1
1: 14
2: 279
3: 4150
4: 19483
Right 1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 153
1151807098_1151807105 11 Left 1151807098 17:76412549-76412571 CCCCTCCTGTCTCAGCTGAGGCC 0: 1
1: 0
2: 2
3: 46
4: 347
Right 1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 153
1151807104_1151807105 -10 Left 1151807104 17:76412570-76412592 CCTCTCTGGCTCTTTGGTTGTCC 0: 1
1: 0
2: 3
3: 17
4: 288
Right 1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 153
1151807101_1151807105 6 Left 1151807101 17:76412554-76412576 CCTGTCTCAGCTGAGGCCTCTCT 0: 1
1: 0
2: 9
3: 46
4: 329
Right 1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 153
1151807099_1151807105 10 Left 1151807099 17:76412550-76412572 CCCTCCTGTCTCAGCTGAGGCCT 0: 1
1: 0
2: 3
3: 45
4: 352
Right 1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151807105 Original CRISPR TTGGTTGTCCCTGAGCTTGA AGG Intronic
900003649 1:29666-29688 CAGCTTGGCCCTGAGCTTGAGGG - Intergenic
900023368 1:200182-200204 CAGCTTGGCCCTGAGCTTGAGGG - Intergenic
900290612 1:1922099-1922121 TTGGATGTCCCTGGGCTTGCGGG + Exonic
900362859 1:2298340-2298362 GTGGTTGTCCCTGGGGTTGGAGG + Intronic
907118119 1:51987489-51987511 TTGTTTGTCTCTGTGCTTCATGG + Intronic
907363647 1:53942801-53942823 TTCCTTGACTCTGAGCTTGAAGG - Intronic
909096722 1:71296838-71296860 TTTGCTGTCCCTGAGCTTTAGGG + Intergenic
909576519 1:77182924-77182946 TTGGTTGCTCCTAAGCTTGGTGG + Intronic
912680324 1:111725257-111725279 CTGATTGTCCCTCAGCCTGATGG - Exonic
912694453 1:111830517-111830539 AGGGTTGTCCCTGAGAGTGAGGG - Intronic
914923084 1:151860601-151860623 TGGGATGTCCCTGACCTTGAGGG - Intergenic
917143103 1:171857521-171857543 ATGGATAACCCTGAGCTTGATGG - Intronic
917236225 1:172894606-172894628 TTGGATGTCCCTGTGTTTTAGGG + Intergenic
918274309 1:182937517-182937539 TTGGTGTTCTCTGAGCTTTATGG + Intronic
919085928 1:192919990-192920012 TTCATTATCCCTGTGCTTGAGGG - Intergenic
923282436 1:232457020-232457042 TAGCTTGTCCCTCAGCGTGAAGG - Intronic
1063465749 10:6243140-6243162 TTGGTTGTCTTGGAACTTGAAGG - Intergenic
1064028428 10:11867790-11867812 TTGGGGATCCCTGAGCTGGAGGG + Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1071664895 10:87544470-87544492 TTGCTCTTCCCTGAGGTTGAGGG + Intronic
1071928057 10:90434311-90434333 ATGGTTGTCCCTGACATTGGTGG + Intergenic
1075467017 10:122659125-122659147 ATGTTTGTCCTGGAGCTTGAAGG + Intergenic
1076628990 10:131841575-131841597 TTCATTGTTCCTGAGCTCGATGG - Intergenic
1076754796 10:132563762-132563784 TTGGTTTTCCTTGCGCTTGCTGG + Intronic
1078028919 11:7728535-7728557 AAGGTTGTGGCTGAGCTTGATGG - Intergenic
1079866550 11:25742647-25742669 TTAGTTGTCTTTGAGCTTGCAGG - Intergenic
1080638648 11:34145260-34145282 GTGGTTGTTCATGTGCTTGATGG + Intronic
1086904422 11:92402801-92402823 TTGGTGTTCCCTGAGCTTCTTGG - Intronic
1087046635 11:93848828-93848850 TGGCTGGTCCCTGAGCATGAGGG + Intronic
1089606705 11:119645518-119645540 CTGTTGGTCCCTGAGCATGAAGG - Intronic
1090141400 11:124267601-124267623 TTGGTTGTTTCTCTGCTTGACGG + Intergenic
1091377067 12:31720-31742 CAGCTTGGCCCTGAGCTTGAGGG - Intergenic
1093528729 12:20135806-20135828 TTGGGTTTTCCTGTGCTTGAAGG + Intergenic
1095389706 12:41690884-41690906 TTGGTGCTCCCTGAGCTTCCTGG - Intergenic
1098044265 12:66383642-66383664 TTGGGGCTCTCTGAGCTTGATGG + Intronic
1098707757 12:73712938-73712960 TTTGTGTTCTCTGAGCTTGATGG - Intergenic
1098877977 12:75886748-75886770 TTGGTTGACGAAGAGCTTGAAGG - Intergenic
1100821402 12:98434415-98434437 TTTCTTGTCCCTGATCTTGGAGG - Intergenic
1102516108 12:113447943-113447965 TTGGTTTTTCCTGAGCATGAGGG + Intergenic
1103857316 12:123981702-123981724 TTGGATGTACTTGAGTTTGAAGG + Intronic
1104320387 12:127745297-127745319 TTTGTAGACCCTGAACTTGATGG - Intergenic
1105721291 13:23117205-23117227 TTGTCTGTCGCTGAGCTTCATGG + Intergenic
1106895123 13:34291710-34291732 TTGGTTTTCTCTGAGATTCAAGG + Intergenic
1108150585 13:47529667-47529689 TTGGTAGTCTCTGAGCTTTCTGG - Intergenic
1110211618 13:72980391-72980413 ATGGTTCTCCCTGGGCTTTAGGG - Intronic
1110270216 13:73581014-73581036 CTTGTTGTCCCTGTGCTTTATGG + Intergenic
1111615741 13:90659419-90659441 TTGGTTTTCCCTGAACCTGGAGG - Intergenic
1114712991 14:24797140-24797162 TTGGTTCTCCCTGGTTTTGAGGG + Intergenic
1118088231 14:62442996-62443018 TTGGCCGACCCTGAACTTGATGG + Intergenic
1121177266 14:91899907-91899929 TTTGTTGTCCCCGAGATTGTTGG - Intronic
1121514838 14:94542704-94542726 TTGGTAGTCCCTGACCTTCAGGG - Intergenic
1122446768 14:101775541-101775563 GGCGTTGTCCCTGAGCGTGAGGG + Intronic
1122795021 14:104201685-104201707 TTGGGTGTCACTGAGCTTCAGGG + Intergenic
1123932826 15:25180064-25180086 TTGGTTTGCTCTGAGCTTGTTGG + Intergenic
1123942356 15:25222721-25222743 TTGGTTGTCCATGACCTGGCTGG + Intergenic
1123945609 15:25237456-25237478 TTGGTTGGCCGTGAGCTGGCTGG + Intergenic
1125371350 15:38981366-38981388 TTGGTTTTCCATTTGCTTGATGG + Intergenic
1126771154 15:52057311-52057333 TTGCTTTACCCTGAGTTTGATGG - Intronic
1126798230 15:52277704-52277726 TGGCTTGTCCCTGAGGATGACGG + Intronic
1128355381 15:66922917-66922939 GTGGGTGTCCCTGAGCTTAGAGG - Intergenic
1128696035 15:69763560-69763582 TTAGTTGTCCCTAAGTTTGATGG + Intergenic
1129944226 15:79524998-79525020 TTGGATGTTCCTGAGCCTGCAGG + Intergenic
1132449853 15:101961274-101961296 CAGCTTGGCCCTGAGCTTGAGGG + Intergenic
1132928986 16:2449010-2449032 TTCGTTGTCGCTGTGCTGGAGGG + Intronic
1134842297 16:17411620-17411642 TTGGTTGCCTCTGAGTTTGGGGG + Intronic
1137645454 16:50069525-50069547 TTGGTTGTTACAGAGCTTGTGGG + Intronic
1140859227 16:79004824-79004846 TGGGTTTTCCCTCAGCTTGCTGG + Intronic
1141737040 16:85860766-85860788 GTGGGTGCCCCTGAGCTGGAAGG + Intergenic
1145005756 17:19336867-19336889 TTGGTTGCCCCTGAACCTCAGGG + Intergenic
1146442664 17:32910680-32910702 TTGGGTGTCCCTTAGTTAGAGGG + Intergenic
1147256857 17:39186698-39186720 ATGGTTGTCCCTGGCCCTGAGGG - Intronic
1148973665 17:51507699-51507721 TTGGTTTTAGCTGAGCTTCAGGG - Intergenic
1149161579 17:53700271-53700293 TTGGGTGTCCTTGAGCTGAAAGG - Intergenic
1151786133 17:76275932-76275954 TTTGAGGTCCCTGAGCCTGATGG + Exonic
1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG + Intronic
1155155673 18:23155641-23155663 GTGTTTCTCCCTGAGGTTGAAGG - Intronic
1157122549 18:44925165-44925187 TTAGTTGTCTCTTAGCTTTATGG - Intronic
1158866897 18:61646597-61646619 GTGGTTGGCCCTCAGATTGAAGG + Intergenic
1160635402 19:71273-71295 CAGCTTGGCCCTGAGCTTGAGGG - Intergenic
1162792254 19:13069221-13069243 TTGGGTGGCCCTGAACTTGGGGG + Intronic
1163601586 19:18252297-18252319 GGGGTTGCCCCTGAACTTGAGGG + Intronic
1164759398 19:30717525-30717547 ATGGCTGTCCCTGAGCTGGGAGG + Intergenic
1167529699 19:50007585-50007607 CTGGTTGTCCCTGGTCTGGAAGG + Exonic
925737654 2:6978425-6978447 TAAGGTGTCCCTGAGCTTGGAGG - Intronic
927611636 2:24547454-24547476 TTAGTTTTCCCTGAACTGGAGGG + Intronic
929455385 2:42061359-42061381 TTGGTTGTCCCTGCTCCTGAGGG + Intergenic
929464896 2:42135551-42135573 TTGGTTGTCTCTTCCCTTGAGGG - Intergenic
936079495 2:109422754-109422776 TAGGTTGCCCCTGATTTTGAAGG + Intronic
936508837 2:113129599-113129621 TTGGTTGTTCCTCAGATAGAAGG - Exonic
936566079 2:113583774-113583796 CAGCTTGGCCCTGAGCTTGAGGG + Intergenic
937227748 2:120379365-120379387 TTGGTAGGGCCTGAGCTTGGTGG - Intergenic
938560749 2:132470141-132470163 GTGTTTGTCCCTGAATTTGAGGG + Intronic
942998126 2:182290201-182290223 TTGGTAATTCCTGAGCTTAATGG - Intronic
947993980 2:234511742-234511764 TTGGTTGGGAATGAGCTTGATGG + Intergenic
1170995961 20:21359172-21359194 TTGGTTGTTTCTGAGCCTAAAGG + Intronic
1171126008 20:22602723-22602745 TTGGTTGTCCCACAGCTTGGGGG + Intergenic
1171231009 20:23485142-23485164 TTGGTGGTGTCTGAGCCTGAAGG + Intergenic
1172197241 20:33100310-33100332 TTCGTTAACCCTGAGCATGATGG - Intronic
1175588935 20:60171654-60171676 TTTGTTTTCTCTGAGCTTGGAGG - Intergenic
1176236208 20:64054670-64054692 TTGCCTGTCCCTGAGCAAGAAGG - Intronic
1181267769 22:21641060-21641082 TTGGTAGTCCCTGCACTTGAGGG - Intergenic
955726044 3:61933922-61933944 TTTGCTTTCCCTGGGCTTGATGG - Intronic
962039004 3:131685059-131685081 TTGTTTGACTCTGAGCTTCATGG - Intronic
964656088 3:159067394-159067416 TTGGTTCACCCAGAGCCTGAGGG - Intronic
966002392 3:174966218-174966240 TTGTTTCTCCTTGATCTTGAAGG + Intronic
969052765 4:4385178-4385200 TAGGTTGTCCCAGAGATGGACGG - Exonic
969664152 4:8547454-8547476 TTCGTAGACCCTGAACTTGATGG + Intergenic
971201164 4:24510406-24510428 TTGTTTTTCTCTCAGCTTGATGG - Intergenic
973606407 4:52591976-52591998 TGTGTTGTCCCTGAGCTAGAAGG + Exonic
975363383 4:73499013-73499035 TTGGTTGTCGCTAGCCTTGAAGG + Intronic
976031225 4:80756718-80756740 TTGGTTGTCACAGAGCTATATGG + Intronic
977227977 4:94416059-94416081 TTGGTTCTTCATGAGCTTTAGGG + Intergenic
977894760 4:102350872-102350894 TAGGTAATCCCTGAGCTTTAAGG + Intronic
978768252 4:112427230-112427252 TTGGCTGCCACAGAGCTTGAAGG - Intronic
978969706 4:114788204-114788226 TTGGTTGTCTTTGAGTATGAGGG - Intergenic
979590299 4:122471307-122471329 TTGTTTTTCCCTCAGCTTTATGG + Intergenic
980770355 4:137364154-137364176 TTGGTGTTCTCTGAGCTTGCTGG - Intergenic
986410218 5:7472048-7472070 TTGGTTTTCTCTGAGCTTCTTGG + Intronic
988030216 5:25753848-25753870 GTGATAGTCCCTGAGCTGGAGGG + Intergenic
989507202 5:42240508-42240530 TTGGTTGTTCCTTATCTTGAAGG - Intergenic
989651257 5:43693084-43693106 TTTATTGTCCCTGAACCTGAGGG + Intronic
990972302 5:61522008-61522030 TTGGTTGTCCCAAAACTTGGAGG - Intronic
992286644 5:75242291-75242313 TTTGCAGTCCCTGAGCTTGATGG - Intergenic
994381501 5:99077227-99077249 TTGGTGTTCTCTGAGCTTGCTGG + Intergenic
995005555 5:107190272-107190294 TTGGTTATCTCTGAGCTTCCTGG - Intergenic
995065865 5:107861881-107861903 TTGGTGGTCTCTGTGCGTGATGG - Intronic
997720611 5:136075676-136075698 ATGGCTGTCCCTGACCTTGTTGG - Intergenic
1000836057 5:166155721-166155743 TTGGATCTCCCTGATTTTGAAGG - Intergenic
1001254313 5:170171891-170171913 CTGCCTGTCCCTGAGCCTGAGGG + Intergenic
1001308447 5:170593479-170593501 TTTGTTGTCACTGAGATGGAAGG - Intronic
1002638060 5:180617847-180617869 GTGGGTGTCCCAGAGGTTGAGGG - Intronic
1002940468 6:1711159-1711181 TGGGTTGTCCCTAACCTTGTTGG - Intronic
1004225866 6:13783789-13783811 TTGGTTGTCCATGATTCTGAAGG - Intergenic
1005409239 6:25525121-25525143 TTGGTGGTCTCTGAGCTTTCTGG - Intronic
1007563430 6:42829679-42829701 TTGGTTGGTCCTGAGCATGTTGG - Exonic
1008490284 6:52079290-52079312 TTTGATCTCCCTGAGCATGAAGG + Intronic
1010938542 6:81888683-81888705 TTGGTTGTGCCTAAGTTTGCTGG - Intergenic
1016266495 6:142238406-142238428 GTGATTGTCTCTGGGCTTGAGGG - Intergenic
1017477332 6:154811159-154811181 TTGTTTGTCCCTTAGGGTGATGG + Intronic
1017996805 6:159538785-159538807 TTGGATCTCTCTGAGCCTGATGG + Intergenic
1022506744 7:30912299-30912321 TGGGGTGTCCCTGGGCTTGGGGG + Intronic
1024882865 7:54109769-54109791 TTGTTTCTCGCTGAGGTTGATGG - Intergenic
1028317117 7:89417504-89417526 TTGGTTTTCCTTGAGCTTCCTGG + Intergenic
1031384746 7:121135116-121135138 TTGATTTTTCCTGAGCTTCACGG - Intronic
1034384058 7:150723459-150723481 TTGGGGGACCCTGTGCTTGAAGG - Exonic
1035917691 8:3643175-3643197 TTGGTTTTCCCTGAGCTTCCTGG - Intronic
1036473873 8:9075687-9075709 TTCATTTTCCCTGAGCCTGAAGG - Intronic
1036963286 8:13269329-13269351 GTGGTTGTCCTTGAGCTACAGGG + Intronic
1037592010 8:20320877-20320899 TTAGTTGGCCCTCAGCTTCATGG - Intergenic
1037963291 8:23115722-23115744 TGGGGTGTCCCTGAGCCTGTGGG + Intronic
1041308014 8:56483711-56483733 TTTGTTTTCCCAGAGCTTTAAGG + Intergenic
1041757325 8:61328739-61328761 TTGGTTGTCTCTCAGCAGGAGGG + Intronic
1043250706 8:78069666-78069688 TTGGCAGACCCTGCGCTTGATGG + Intergenic
1044843398 8:96357071-96357093 TTGATTGTCCCAGTGGTTGAAGG + Intergenic
1047047888 8:121075043-121075065 TTGGCTGTCCCTTAACTGGATGG + Intergenic
1047953046 8:129951372-129951394 TATGTTGTCCTTGAGGTTGATGG - Intronic
1048908525 8:139111830-139111852 TTGGTAGTCCCTGATCTAGGAGG + Intergenic
1048973078 8:139656040-139656062 TTGAATGTCCCGGAGCTTCATGG - Intronic
1049886345 9:29444-29466 CAGCTTGGCCCTGAGCTTGAGGG - Intergenic
1050052007 9:1612310-1612332 CTGGCTTTGCCTGAGCTTGAGGG + Intergenic
1056935433 9:90912266-90912288 TGGGTTCTCCCAGAGCCTGAGGG + Intergenic
1058861820 9:109123895-109123917 CTGTTTGTCCCTGAGGTTGTTGG - Intergenic
1059005834 9:110401002-110401024 TTATTTGTCACTTAGCTTGATGG - Exonic
1059259201 9:112959632-112959654 TTTCTTATCACTGAGCTTGAGGG + Intergenic
1062709280 9:137964994-137965016 TTGGTTTTCCCTGTACTTGGTGG + Intronic
1192930536 X:75801235-75801257 TTGGTTGGCCCTCAGTTAGAAGG - Intergenic
1193297420 X:79849713-79849735 TTGGTTGTTCCTGAGTTCAATGG + Intergenic
1197493873 X:127153652-127153674 TTGGTTGACCTTCAGCCTGAAGG + Intergenic
1197940406 X:131782932-131782954 TTGGATGTCCCTGAGAAGGATGG - Intergenic