ID: 1151809578

View in Genome Browser
Species Human (GRCh38)
Location 17:76430162-76430184
Sequence TCCAATTTCTAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151809578_1151809582 21 Left 1151809578 17:76430162-76430184 CCTTCCACCTTCTAGAAATTGGA 0: 1
1: 0
2: 0
3: 19
4: 189
Right 1151809582 17:76430206-76430228 CTCCCATTCTGTGTCCTTGTGGG 0: 1
1: 0
2: 2
3: 21
4: 265
1151809578_1151809581 20 Left 1151809578 17:76430162-76430184 CCTTCCACCTTCTAGAAATTGGA 0: 1
1: 0
2: 0
3: 19
4: 189
Right 1151809581 17:76430205-76430227 TCTCCCATTCTGTGTCCTTGTGG 0: 1
1: 1
2: 1
3: 54
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151809578 Original CRISPR TCCAATTTCTAGAAGGTGGA AGG (reversed) Intronic
900802995 1:4748927-4748949 TCACAGTTCTAGAAGCTGGAAGG - Intronic
904902380 1:33867691-33867713 ACCAACATCTTGAAGGTGGAGGG + Intronic
905353163 1:37361392-37361414 TCCAACTTCTACAAGGTGGGAGG - Intergenic
907635309 1:56128591-56128613 TTTAATTTCTAAAAGGTTGAAGG + Intergenic
909891649 1:81015025-81015047 TCCAGTTTTTAGAAGATAGATGG - Intergenic
915443765 1:155962841-155962863 TCCAAATTCTAGGGGTTGGAGGG - Intronic
915688008 1:157655391-157655413 CGCAGTTACTAGAAGGTGGAGGG + Intergenic
918739551 1:188110660-188110682 TCTAAATTCTAGAAGGTTCAAGG - Intergenic
919330294 1:196162630-196162652 ACCATATTGTAGAAGGTGGATGG - Intergenic
1066012792 10:31209762-31209784 TCCAGTTCCTAGCAGGTGGAAGG + Intergenic
1068006922 10:51402264-51402286 TCCAATATCAAGAAGGTGGTTGG - Intronic
1068387154 10:56345623-56345645 TCAAATTCCTAGAAATTGGATGG + Intergenic
1070357969 10:75658974-75658996 TCCAAATTCTGTAAGGTGGCTGG + Intronic
1072542998 10:96412715-96412737 CCCAAATGCTACAAGGTGGAGGG - Intronic
1076496231 10:130899478-130899500 TCCAAATTCTTGGAGGTGGCAGG + Intergenic
1079985921 11:27200887-27200909 ACACATTTCTAGAAGGTGTAAGG - Intergenic
1081064498 11:38523839-38523861 TCCCACTCCTAGAAGGGGGATGG + Intergenic
1082982661 11:59137471-59137493 TCCCTTTTCTGGAAGGAGGAAGG + Intergenic
1084258859 11:67961125-67961147 TGCAATTTCTATCAGGTGGTCGG + Intergenic
1086366527 11:86112322-86112344 TCAAATAGCTAGAAGGAGGATGG - Intergenic
1091028558 11:132163036-132163058 TCCAATTACTAGAAGTGTGATGG + Intronic
1093145791 12:15565231-15565253 TCCAATTTCTACAGGCAGGAAGG - Intronic
1093355570 12:18162717-18162739 TCCAGGTTCTAGACTGTGGAAGG - Intronic
1096038341 12:48492537-48492559 TCCACTTCCTAAAAGATGGAGGG + Intronic
1096796674 12:54082291-54082313 TGCCATTTCTAAAAGGAGGAAGG + Intergenic
1101085724 12:101233797-101233819 TTCGAATTCTAGAAGTTGGAGGG + Intergenic
1101439422 12:104692324-104692346 TGCAATGTCTTGAAGGTGGTAGG - Intronic
1102061368 12:109934407-109934429 CCCAATTTCTAGAAAGAGAAAGG + Intronic
1102383007 12:112483614-112483636 TCCAGTCTCTACAGGGTGGAGGG - Intronic
1103969499 12:124661222-124661244 TCCAGTTTCTAAAAGGAGGCAGG - Intergenic
1105395826 13:20033439-20033461 TGTAATTTATAGAAGGAGGAAGG - Intronic
1110936844 13:81301932-81301954 TCCAATTTCTAGAAGGAGACTGG + Intergenic
1113275862 13:108729034-108729056 TTCAAATTCTGGAAGATGGAGGG + Intronic
1113509306 13:110839305-110839327 TCCAATTTCAAGATAGGGGAGGG - Intergenic
1114373962 14:22123035-22123057 TCCGTTTTCTAGAATGTAGATGG + Intergenic
1115353105 14:32417526-32417548 TGAAATTTCTGGAGGGTGGAGGG + Intronic
1115963806 14:38864738-38864760 TCCAAGTTCTATCTGGTGGAAGG - Intergenic
1116825604 14:49670527-49670549 TCCTATCTATAGAAGGGGGAAGG - Intronic
1116994505 14:51308495-51308517 TTCAATTTCTAAAATCTGGAAGG + Intergenic
1121937936 14:98037548-98037570 TCCATTTTCTTGAACGTTGAAGG + Intergenic
1122040513 14:98984542-98984564 TCCATTTTATAGATGGGGGAAGG + Intergenic
1122249683 14:100429197-100429219 TCAGAGTTCTAGAAGGTGGATGG - Intronic
1124136041 15:27037178-27037200 TCCGGGTTCTGGAAGGTGGAAGG - Intronic
1124643744 15:31419801-31419823 TCCAAATTCTAGAAGCTCGAAGG + Intronic
1125253078 15:37728917-37728939 TCAAATAGCTAGAAGGAGGACGG - Intergenic
1125971018 15:43911870-43911892 TGCAACTTCTAGGAGGTGGTAGG + Intronic
1126305482 15:47250873-47250895 TACATTTTCAAAAAGGTGGAAGG + Intronic
1126792729 15:52235756-52235778 GCCAATTTCTAGCAGAGGGAAGG + Exonic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130760832 15:86818027-86818049 TACAGTTTCTAGAAGGAGCATGG + Intronic
1131392127 15:92058203-92058225 TAGCATCTCTAGAAGGTGGAGGG + Intronic
1134073334 16:11273870-11273892 TTGAATTTCTAGAAGCAGGAGGG + Intronic
1136093269 16:27935821-27935843 TGCAATTTCAAGGAGGAGGATGG - Intronic
1137997549 16:53235187-53235209 TCCAAATATTAGAAGGAGGACGG - Exonic
1138272720 16:55707489-55707511 TCCAATCTCCAGAAGTAGGATGG - Intergenic
1140191369 16:72819965-72819987 TCCTCTTTCTGCAAGGTGGAAGG - Intronic
1140915165 16:79486899-79486921 TCCACCTTGTAGGAGGTGGAGGG - Intergenic
1150063372 17:62088153-62088175 ACAAAATTCTAGAAGCTGGAAGG - Intergenic
1150353956 17:64467479-64467501 TCCTATTTCTAGTAGCTGGGTGG - Intronic
1150944274 17:69727606-69727628 TCAAATTTGTAGAAAGTAGAAGG - Intergenic
1150948927 17:69779964-69779986 TCCAATTTGCAGACGGTAGAAGG - Intergenic
1151809578 17:76430162-76430184 TCCAATTTCTAGAAGGTGGAAGG - Intronic
1152310100 17:79544794-79544816 CCCCATGTCTAGAAGGTGGGGGG - Intergenic
1158762863 18:60411136-60411158 GGCAATTACTAGAACGTGGAGGG + Intergenic
1158820196 18:61150504-61150526 TCCAATTTCTGAATGGAGGAGGG - Intergenic
1159276174 18:66223752-66223774 GCCAATTTCAAGACGGTGGCAGG - Intergenic
1165166501 19:33860833-33860855 TCCAGCGTCTAGAATGTGGAAGG - Intergenic
1165166502 19:33860836-33860858 TCCACATTCTAGACGCTGGAAGG + Intergenic
1165619545 19:37233786-37233808 TCCAATTTCTACATTGAGGAGGG + Intronic
1168087529 19:54059403-54059425 AACAATTTCTAGATGGTGAAAGG - Intronic
925493723 2:4423505-4423527 ACCAAGTTCTAGAATGTGCAAGG - Intergenic
925710339 2:6732917-6732939 TCCAAATTTTAGTAGGTAGATGG - Intergenic
926123754 2:10258635-10258657 TCCTACTACTAGAAGGTGGTCGG - Intergenic
926691118 2:15734504-15734526 TTCATTTCCCAGAAGGTGGAGGG + Intronic
926714193 2:15911031-15911053 TCCAGTTTGGAGAAGGAGGATGG + Intergenic
928055884 2:28054129-28054151 TCCCTTTTCTAGATGATGGAGGG + Intronic
928098960 2:28423673-28423695 TCCATTTTCTGTGAGGTGGAAGG - Intergenic
929412788 2:41715919-41715941 TCCAATTTCTAGAAGGTCCTTGG + Intergenic
930413304 2:51054857-51054879 TCCAATTTATATGAGATGGAGGG - Intergenic
931496718 2:62815169-62815191 TCCCATTTCTCCAAGGTGGAAGG + Intronic
932658865 2:73634797-73634819 TCCAGGTTCTAGACTGTGGAAGG - Intergenic
932665461 2:73694760-73694782 TCCAGGTTCTAGACTGTGGAAGG - Intergenic
933080843 2:77983294-77983316 TCTAATGTCTAGAAGCTAGAAGG + Intergenic
935132448 2:100270800-100270822 TCCAATTTTTAAAACGTGAAGGG - Intergenic
937301840 2:120847583-120847605 TCCAAGTTCTAGGCGGTGGCAGG - Intronic
937888696 2:126918326-126918348 TTCAATTTCTAGAAGTTTTAAGG - Intergenic
938657152 2:133446209-133446231 GACAATTTCTAGAAGGTTGAAGG + Intronic
938697295 2:133845695-133845717 TCGCATTTCTAGCAGGAGGAAGG - Intergenic
940336962 2:152539328-152539350 TCCATCTTCTAGAGGGTGGGTGG + Intronic
940586377 2:155657188-155657210 GCCAATTTCTAGAAGATGTTAGG + Intergenic
940857931 2:158744225-158744247 TCCAATTCACAGAAGGTGGTGGG + Intergenic
940888326 2:159010652-159010674 TCCTATTTCAAGGATGTGGACGG + Intronic
942317310 2:174707956-174707978 TCTAATATCCAGAAGGTGAAAGG - Intergenic
942482893 2:176407789-176407811 TCCAATTACTCAGAGGTGGATGG - Intergenic
942888508 2:180958693-180958715 TCCTATTTTTAAAAGGAGGAAGG + Intergenic
943201414 2:184830753-184830775 TCCATTCTCTAGGAGGAGGAAGG - Intronic
943400109 2:187398100-187398122 CCCAATTAGTAAAAGGTGGAAGG + Intronic
945724690 2:213462358-213462380 TGCAATCTCTAGAAATTGGATGG + Intronic
946595544 2:221302049-221302071 ACTCATTTCTTGAAGGTGGAGGG - Intergenic
947046552 2:225993528-225993550 TTCAATTGTTAGAAGATGGAAGG + Intergenic
947288511 2:228545349-228545371 TCCATTATCAAGAAGGTGGAGGG - Intergenic
948415822 2:237802649-237802671 TACAATTTCCAAAAGGGGGATGG - Intronic
1169092557 20:2870643-2870665 TCCATTTACTAGAAGGGGAAAGG + Intronic
1170039501 20:12025251-12025273 ACCACTTTCTCCAAGGTGGATGG + Intergenic
1171562172 20:26135651-26135673 TCCAACCTCCAGCAGGTGGAAGG + Intergenic
1171848138 20:30290304-30290326 TGCCATTTCTAAAAGGAGGAAGG + Intergenic
1172119219 20:32587990-32588012 GGCATTTTCTAGAAGCTGGAAGG + Intronic
1172746607 20:37214956-37214978 TCCAATTTTTAAAATGTAGAAGG - Intronic
1173298429 20:41779694-41779716 CCCAGTTTCTACAAGGAGGAAGG - Intergenic
1174719102 20:52792217-52792239 TCCAGTTTCAAAAAGCTGGATGG + Intergenic
1179379128 21:40882056-40882078 TCCAAGAGCTAGAAGGAGGAAGG + Intergenic
1183409966 22:37649050-37649072 GCCCATCTCTGGAAGGTGGAGGG - Intronic
1184335075 22:43848175-43848197 TCCATTTTCTGGAAGGTGGCAGG - Intronic
951233289 3:20204949-20204971 TCCAGTTTCTAGACAGTGGCTGG - Intergenic
953022278 3:39122375-39122397 TCACATTTCTAGAAGATGGAAGG + Intronic
953129381 3:40123818-40123840 TCCTGTTTCTAGCGGGTGGATGG + Intronic
953430063 3:42831867-42831889 TGCAATTACTAGTAGGTGAAAGG + Intronic
953501458 3:43439024-43439046 TCCAAATTCAAGAAGCTGAAAGG + Intronic
954318110 3:49812298-49812320 TGCACCTTGTAGAAGGTGGAGGG + Intronic
955141038 3:56270373-56270395 TCCAGTTTCCAGAATGTGTATGG + Intronic
955175217 3:56606743-56606765 TAAAAATTCTAGAAGATGGAGGG - Intronic
957408810 3:79809459-79809481 TACAATATCTAGAAGATGGCAGG - Intergenic
958696983 3:97540229-97540251 TGCAATTTCTAGAGGCTTGATGG + Intronic
960203307 3:114864663-114864685 TCCAAATTTTAGGAGGTAGATGG + Intronic
962805588 3:138924771-138924793 TTCAATTTGTAGAAGGAGTAGGG + Intergenic
962859597 3:139387428-139387450 TCCAGCTTTTGGAAGGTGGAGGG - Intronic
964928703 3:161988876-161988898 ACCAATATCTAGAAGATGCAAGG - Intergenic
967836222 3:193965622-193965644 GCCAATTTCTACCATGTGGAAGG - Intergenic
969459948 4:7323774-7323796 TCCCATTTCTCGGGGGTGGAGGG - Intronic
971228878 4:24781269-24781291 TCCAGTGTCTGGAAGGGGGAAGG + Intergenic
973024595 4:45251500-45251522 CACCATTTCTAGATGGTGGATGG - Intergenic
973061599 4:45733145-45733167 TCTGATTTCTAGAATGAGGAAGG - Intergenic
973717036 4:53687216-53687238 TTCTATTTCTAAAAGGTGAAAGG - Intronic
975761028 4:77620026-77620048 TTTAATTTCTAGGAGGTGGGAGG - Intergenic
977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG + Intergenic
977722723 4:100259369-100259391 ACCAATTTCTACAAGGTAGATGG - Intergenic
979205974 4:118038467-118038489 TGCAATTTTTAAAAGATGGATGG - Intronic
980811936 4:137894326-137894348 TCCATTTTGTATAAGGTGTAAGG - Intergenic
983806157 4:171995325-171995347 TTTAATTTCTAGGAGATGGATGG - Intronic
984269012 4:177528073-177528095 TGCAATTTCCAGAAATTGGAGGG + Intergenic
984821317 4:183885183-183885205 TCCAAATTCTGAAAGGTGGGTGG - Intronic
984933008 4:184864505-184864527 TTCAATTTCTAGCAAGTGAAAGG - Intergenic
985961856 5:3308643-3308665 TCTAATTTCTAGAAAAAGGAAGG + Intergenic
986550045 5:8943297-8943319 TTCAATTTCTAGGATGGGGAAGG + Intergenic
988633729 5:32958969-32958991 TCACAGTTCTAGAAGCTGGAAGG + Intergenic
993962669 5:94319287-94319309 TCCAACATTTAGAAGTTGGAAGG - Intronic
994593385 5:101801000-101801022 TTCATTTTCTTGAAGGTGTATGG + Intergenic
994797971 5:104331042-104331064 TAAAATTTCTAGAAGATGGATGG - Intergenic
995420839 5:111964800-111964822 TACAATTTCTAGGTTGTGGAAGG + Intronic
997867364 5:137476451-137476473 GTGAATATCTAGAAGGTGGAAGG + Intronic
999594338 5:153185443-153185465 TTCAAACTTTAGAAGGTGGAAGG - Intergenic
1000644595 5:163745525-163745547 TCTAATATCTAGAATGTGTAAGG - Intergenic
1001014023 5:168124719-168124741 TCCATTTGCTAGCAAGTGGATGG + Intronic
1002509994 5:179709069-179709091 TCCCATTTCTGGAATGTGGCTGG + Intronic
1003520592 6:6855485-6855507 TCCAATGCCTAGATGGTGGCTGG - Intergenic
1003969752 6:11287827-11287849 TTCAACTTCCAGAAGCTGGAAGG - Intronic
1004254152 6:14047626-14047648 TCCAATTGGTAGAAGGTAGGAGG + Intergenic
1005648961 6:27868735-27868757 TACAATTTATGGGAGGTGGAGGG + Intergenic
1005986293 6:30877845-30877867 TCCAATTACTGGAAAATGGAAGG - Intronic
1006542999 6:34755888-34755910 TCCCTTTTCTAAAAGGAGGAAGG + Intergenic
1010644378 6:78369562-78369584 TACATTTTCCAGAAGGTAGAAGG + Intergenic
1011112565 6:83854042-83854064 TCCACTTTCTAGAAGGAGGTGGG + Intronic
1011259429 6:85456046-85456068 TCCCACTTCTAGAGGGTAGATGG + Intronic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1013280445 6:108631468-108631490 TTTATTTTCTAGGAGGTGGAGGG + Intronic
1014555464 6:122839764-122839786 TCCAGTGTCTAGAAGGTGACTGG - Intergenic
1017943563 6:159075372-159075394 TCCAATTTCAACAAGGAGTATGG - Intergenic
1021047087 7:15936715-15936737 TACATTTTTTAGTAGGTGGAGGG + Intergenic
1021330594 7:19334302-19334324 TCAGATTTTTAGAAGGTAGACGG + Intergenic
1023621909 7:42082109-42082131 TTCATTTTATAGAAGCTGGATGG - Intronic
1028513140 7:91647074-91647096 TTGAATTTGTAGAAGGTTGAGGG + Intergenic
1028865866 7:95710795-95710817 TCACATTTCTAGAAGTGGGAGGG + Intergenic
1030633794 7:111925413-111925435 TCAAATTTCTAGAAAGTGTGAGG + Intronic
1033057165 7:138067894-138067916 TCCAATTTTTACAAGGTTGAAGG - Intronic
1033610284 7:142958172-142958194 CCCAATTTCTAGGAGGGAGATGG - Intronic
1037029295 8:14083296-14083318 TCCAATTTCTAGCAGGATGTGGG + Intergenic
1038354634 8:26816224-26816246 TCCAATTCCTTGAAGGTGACAGG - Intronic
1039038872 8:33388038-33388060 TCAAATTTCTAGATGGTGCTTGG - Intronic
1046526494 8:115387735-115387757 TCCAACTTGTATAAGGTGTAAGG - Intergenic
1049653096 8:143784831-143784853 TACTATGTCTAGAAGGTGGAAGG + Intergenic
1050237946 9:3602549-3602571 TCCAAGTTCTGGAAAGTCGATGG + Intergenic
1050835202 9:10068727-10068749 TCCAAGTTGGAGCAGGTGGAAGG + Intronic
1053786270 9:41654956-41654978 TGCCATTTCTAAAAGGAGGAAGG + Intergenic
1054174983 9:61868900-61868922 TGCCATTTCTAAAAGGAGGAAGG + Intergenic
1054449844 9:65397944-65397966 TGCCATTTCTAAAAGGAGGAAGG + Intergenic
1054662554 9:67711893-67711915 TGCCATTTCTAAAAGGAGGAAGG - Intergenic
1054918581 9:70519089-70519111 TCTAGTTTATAGAAGGTAGAAGG + Intergenic
1056268425 9:84923045-84923067 GCCAATGTCTGAAAGGTGGAGGG - Intronic
1056290674 9:85140771-85140793 TTCTATTTATAGAAGGTGGATGG - Intergenic
1056981720 9:91318811-91318833 TCCAATTTCTGGAGAGTGCAGGG - Intronic
1057114812 9:92510831-92510853 GCCATTTTCTAGAAGAAGGATGG + Intronic
1058973732 9:110106770-110106792 TCCAATTTCTGGACTGTTGACGG - Intronic
1059190591 9:112322168-112322190 TCCAGTCTCTAGCAGGAGGAGGG + Intronic
1059235567 9:112758066-112758088 TCCATCTTCTCTAAGGTGGAAGG - Intronic
1059883664 9:118720527-118720549 TCTCAATTCTAGAAGCTGGAAGG + Intergenic
1061099908 9:128484686-128484708 TCCAGATTCTGGAAGGGGGAAGG - Exonic
1061635480 9:131905764-131905786 TCCAAATTCTGGAAGGAGGCAGG - Intronic
1185609577 X:1386503-1386525 TGGAATTTCTCGAAGGTTGATGG + Exonic
1186263653 X:7808325-7808347 ACCCAATTCTAGAAGGAGGATGG + Intergenic
1187666943 X:21624031-21624053 TTCAATTTCTAAAATGTGTATGG + Intronic
1189487357 X:41443808-41443830 TCCAGTCTCCTGAAGGTGGATGG - Intergenic
1190442876 X:50493523-50493545 TCAGATTTCTTGAAGGTGGAGGG - Intergenic
1190622469 X:52301073-52301095 TCAAATAGCTAGAAGGAGGAAGG - Intergenic
1192706921 X:73536167-73536189 TCCACTTTCTACAAAATGGATGG - Intergenic
1195518262 X:105801749-105801771 TCCATTTTGTATAAGGTGTAAGG - Intergenic
1197410805 X:126114079-126114101 GCCACTTAATAGAAGGTGGATGG - Intergenic
1198030253 X:132747642-132747664 TCCCATTTGTACAAGGGGGAGGG + Intronic
1198977855 X:142357406-142357428 ACCAGTTTCTAAAAGGAGGATGG - Intergenic
1199026723 X:142947963-142947985 TCCCATTTCCTGAAAGTGGAAGG - Intergenic