ID: 1151812491

View in Genome Browser
Species Human (GRCh38)
Location 17:76452819-76452841
Sequence TGCTCCGAGGCCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151812491_1151812498 -7 Left 1151812491 17:76452819-76452841 CCCGCGCCCCCGGCCTCGGAGCA 0: 1
1: 0
2: 1
3: 19
4: 351
Right 1151812498 17:76452835-76452857 CGGAGCACCCCGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151812491 Original CRISPR TGCTCCGAGGCCGGGGGCGC GGG (reversed) Exonic