ID: 1151812491 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:76452819-76452841 |
| Sequence | TGCTCCGAGGCCGGGGGCGC GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 372 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 19, 4: 351} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151812491_1151812498 | -7 | Left | 1151812491 | 17:76452819-76452841 | CCCGCGCCCCCGGCCTCGGAGCA | 0: 1 1: 0 2: 1 3: 19 4: 351 |
||
| Right | 1151812498 | 17:76452835-76452857 | CGGAGCACCCCGAGCTCCCGCGG | 0: 1 1: 0 2: 0 3: 10 4: 97 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151812491 | Original CRISPR | TGCTCCGAGGCCGGGGGCGC GGG (reversed) | Exonic | ||