ID: 1151812498

View in Genome Browser
Species Human (GRCh38)
Location 17:76452835-76452857
Sequence CGGAGCACCCCGAGCTCCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151812492_1151812498 -8 Left 1151812492 17:76452820-76452842 CCGCGCCCCCGGCCTCGGAGCAC 0: 1
1: 0
2: 1
3: 39
4: 310
Right 1151812498 17:76452835-76452857 CGGAGCACCCCGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1151812487_1151812498 4 Left 1151812487 17:76452808-76452830 CCTCCTCGTGGCCCGCGCCCCCG 0: 1
1: 0
2: 2
3: 42
4: 328
Right 1151812498 17:76452835-76452857 CGGAGCACCCCGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1151812485_1151812498 9 Left 1151812485 17:76452803-76452825 CCGGCCCTCCTCGTGGCCCGCGC 0: 1
1: 0
2: 1
3: 12
4: 261
Right 1151812498 17:76452835-76452857 CGGAGCACCCCGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1151812484_1151812498 10 Left 1151812484 17:76452802-76452824 CCCGGCCCTCCTCGTGGCCCGCG 0: 1
1: 0
2: 1
3: 22
4: 239
Right 1151812498 17:76452835-76452857 CGGAGCACCCCGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1151812491_1151812498 -7 Left 1151812491 17:76452819-76452841 CCCGCGCCCCCGGCCTCGGAGCA 0: 1
1: 0
2: 1
3: 19
4: 351
Right 1151812498 17:76452835-76452857 CGGAGCACCCCGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1151812486_1151812498 5 Left 1151812486 17:76452807-76452829 CCCTCCTCGTGGCCCGCGCCCCC 0: 1
1: 0
2: 1
3: 34
4: 382
Right 1151812498 17:76452835-76452857 CGGAGCACCCCGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1151812481_1151812498 29 Left 1151812481 17:76452783-76452805 CCGCGGCGCAGGGGGCTGGCCCG 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1151812498 17:76452835-76452857 CGGAGCACCCCGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1151812489_1151812498 1 Left 1151812489 17:76452811-76452833 CCTCGTGGCCCGCGCCCCCGGCC 0: 1
1: 1
2: 6
3: 82
4: 624
Right 1151812498 17:76452835-76452857 CGGAGCACCCCGAGCTCCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151812498 Original CRISPR CGGAGCACCCCGAGCTCCCG CGG Exonic