ID: 1151812597

View in Genome Browser
Species Human (GRCh38)
Location 17:76453178-76453200
Sequence AGCGGCGGCGAACGAGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151812587_1151812597 17 Left 1151812587 17:76453138-76453160 CCATAACTGCTCTGCGCGAGTCT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1151812597 17:76453178-76453200 AGCGGCGGCGAACGAGGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 143
1151812586_1151812597 20 Left 1151812586 17:76453135-76453157 CCGCCATAACTGCTCTGCGCGAG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1151812597 17:76453178-76453200 AGCGGCGGCGAACGAGGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151812597 Original CRISPR AGCGGCGGCGAACGAGGCGC GGG Exonic
900349672 1:2228503-2228525 GGCGGCGGCGGGCGCGGCGCGGG + Intergenic
900629153 1:3624716-3624738 AGCGGCTGGGAAGGAGGGGCTGG - Intergenic
900786266 1:4652767-4652789 GCCGGCGGGGAAGGAGGCGCCGG - Intergenic
902541939 1:17162144-17162166 AGCAGCGGCAACCGAGGCCCAGG - Intergenic
903907292 1:26696171-26696193 GGCGGCGGCGGCCGAGGCGCCGG - Exonic
906319722 1:44808521-44808543 GGCGGCGGCGAAAGAGGCCCTGG - Exonic
907486513 1:54781704-54781726 GGCGGCGCTGAACCAGGCGCTGG - Exonic
908355703 1:63323404-63323426 AGCGGCGGCGGGCCTGGCGCGGG + Exonic
908355921 1:63324434-63324456 AGCGGCGGCGGCCGAGGCTGCGG - Exonic
908501206 1:64745194-64745216 GGCGGCGGCGAGGGGGGCGCGGG + Exonic
910449030 1:87328648-87328670 AGCGGCGGCGGACGGTGCGGAGG - Exonic
912167321 1:107056752-107056774 GGCGGCGGCGAAGGAGGGGAGGG + Exonic
912305204 1:108560111-108560133 AGCGGCGGCGGAGGCGGCGGCGG + Exonic
919103532 1:193122093-193122115 CGCGGCGGCGAAGGAGGAGGAGG + Exonic
920312364 1:205056269-205056291 AGGGGAGGCAAAGGAGGCGCTGG - Intronic
922307473 1:224356902-224356924 AGCGGCGGCGACGGAGGAGGAGG + Exonic
1063418128 10:5889940-5889962 AGCAGCGGCGGTCGAGGGGCGGG - Intergenic
1064712436 10:18140772-18140794 AGCGGCGGCGGCGGTGGCGCAGG + Exonic
1065214980 10:23439855-23439877 AGCGGCGGAGCCCGCGGCGCCGG - Exonic
1070328332 10:75401879-75401901 AGCGGCGGCGGCGGCGGCGCGGG - Exonic
1070895829 10:79982320-79982342 AGCAGCGCCGCCCGAGGCGCTGG - Intronic
1071544881 10:86521659-86521681 AGCGGCGGCGCAGGAGGCGGCGG - Exonic
1072562227 10:96586884-96586906 GGCGGCGGCGGAGGAGGCGGCGG - Exonic
1074121580 10:110497755-110497777 AGCGGGGGCGAGGGACGCGCGGG - Intergenic
1075629321 10:123991696-123991718 GGCGGCGGCGGAGGAGGCGGTGG + Intergenic
1079296695 11:19241237-19241259 GGCGGGGGCGAACGAGGGGGAGG - Intronic
1080606603 11:33869490-33869512 AGCGGCGGCGACGGCGGCGGCGG - Exonic
1081805015 11:45885749-45885771 GGCGGCTGCGAAGGAGGCGGAGG - Exonic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1083747058 11:64742558-64742580 AGCGGCGGCGAAGGGAGGGCCGG - Intronic
1088172909 11:107018103-107018125 AGCGGCGGCGGAGGCGGCGGTGG + Exonic
1088400877 11:109422122-109422144 AGCGGCGGCGAAGGCGGCGGCGG + Exonic
1093958781 12:25250862-25250884 GGCGGCGGCGAAGGTGGCGGCGG - Intronic
1096143969 12:49265139-49265161 TGCGGCGGTGAAGGAGGCGAAGG - Exonic
1097107676 12:56634972-56634994 GGCGGCGGCGGCAGAGGCGCAGG + Intronic
1098320654 12:69239956-69239978 AGCGCCGGCGAGGGAGGAGCCGG - Intronic
1105745723 13:23375522-23375544 AGCCGCGGCGGCCGAGGAGCAGG + Intronic
1105943662 13:25171696-25171718 GGCGGCGGCGAGCGCGGCTCAGG - Exonic
1106304058 13:28494913-28494935 GGCGGCGGCGAACGAGAGGACGG - Exonic
1106413494 13:29526959-29526981 AGCGGCGCAGTACGAGGAGCAGG - Intronic
1107307376 13:39037683-39037705 GGCGGCGGGGAGGGAGGCGCCGG + Exonic
1107851288 13:44576033-44576055 AGCGGCGGCGGCCGCGGCGGTGG + Exonic
1112580838 13:100675034-100675056 GTCGGCGGCGAAGGAGGCGCAGG + Intronic
1113655683 13:112066925-112066947 AGCGGAGGCGCACGCGGGGCCGG - Intergenic
1113861501 13:113490481-113490503 AGCGGTGGCGTCGGAGGCGCGGG - Intronic
1115592210 14:34874959-34874981 GGCGGCGGCGGGCGAGGAGCCGG - Intronic
1116657929 14:47674751-47674773 GGCGGCGGCGAGCGGAGCGCAGG + Exonic
1117478229 14:56118518-56118540 CACGGCGGCGAAGGGGGCGCGGG - Exonic
1117602569 14:57390632-57390654 CGCGGCTGCGAAGGAGGCGGCGG + Exonic
1122558304 14:102592996-102593018 AGTGGCGGCTGGCGAGGCGCAGG - Exonic
1124983385 15:34583740-34583762 AGCGGCAGGGACCGGGGCGCGGG - Intronic
1125510788 15:40291375-40291397 AGCGGCGCGGAGCGCGGCGCTGG - Exonic
1125685024 15:41558998-41559020 AGCGGCGGCGACGGCGGCGACGG + Intronic
1134024714 16:10944886-10944908 AGCGGCGGCGAAGGGCGCCCGGG + Intronic
1136110984 16:28063546-28063568 GGCGGCGGCGGACGCGGCGCGGG + Intergenic
1137476012 16:48810826-48810848 CTCGGCGGCAAAAGAGGCGCCGG + Intergenic
1141972508 16:87492943-87492965 GGCGACGGCGGAGGAGGCGCCGG + Intergenic
1148437177 17:47693997-47694019 GGCGGCGGCGGAGGAGGAGCGGG + Intergenic
1151370813 17:73645125-73645147 GGCAGCGGCGGCCGAGGCGCTGG - Intergenic
1151755319 17:76072391-76072413 AGCGGCGGTGGACGTGGTGCCGG - Exonic
1151812597 17:76453178-76453200 AGCGGCGGCGAACGAGGCGCGGG + Exonic
1152225404 17:79090466-79090488 AGCGGCGGCGGAGCAGGCCCGGG - Intronic
1152970686 18:158597-158619 TGCGGCGGCGGCCGAGGCGGAGG - Exonic
1156008445 18:32470480-32470502 AGCGGCGGCCGCCGAGGCGCGGG - Intronic
1160577304 18:79864024-79864046 CGCGGCGGCGCAGGCGGCGCAGG - Exonic
1160592182 18:79951124-79951146 AGCGGGGGCGACCGGGGCCCGGG + Intronic
1162030912 19:7916901-7916923 GGCGGCGGCGTCAGAGGCGCAGG - Exonic
1162457765 19:10796270-10796292 AGTGGGGGCCAATGAGGCGCTGG - Intronic
1162861056 19:13506124-13506146 AGCGGAGGCGGGCGAGGAGCCGG - Exonic
1162954389 19:14090340-14090362 AGCGGCGGACGACGAGGCGGCGG + Exonic
1166367462 19:42284614-42284636 AGCGGCGACGGCCGAGGAGCGGG + Intronic
927652394 2:24920332-24920354 TGGGGCGGCGAGGGAGGCGCCGG + Intergenic
930096545 2:47570605-47570627 AGCGGCGGGTAAGGAGCCGCGGG - Exonic
936122655 2:109760344-109760366 AGCGGCGGCGGCGGCGGCGCAGG + Intergenic
936222038 2:110611129-110611151 AGCGGCGGCGGCGGCGGCGCAGG - Intergenic
941686838 2:168456298-168456320 AGCGGCCGCGGAGGAGGCGGCGG + Exonic
944221806 2:197310734-197310756 GGCGGCGGCGGAGGAGGAGCAGG - Exonic
944580109 2:201125002-201125024 AGCAGGGGCAAACGAGGCACTGG + Intronic
945905285 2:215586179-215586201 AGCCAGGGCGAAGGAGGCGCTGG - Intergenic
945988380 2:216372304-216372326 AGCAGCGGCGGCCGCGGCGCCGG - Intergenic
1176062317 20:63177826-63177848 GGCGGCGGCGCGGGAGGCGCAGG + Intergenic
1176952662 21:15064948-15064970 GGCGGCGGCGGAGGAGGCGGCGG - Exonic
1178334537 21:31731803-31731825 AGCGGCGGAGTCCGAGGCCCGGG + Exonic
1178914547 21:36699261-36699283 AGCGGAGGGGAGCGAGTCGCAGG - Exonic
1180110157 21:45643735-45643757 AGCGGCGGCGACCGCGGCTGAGG - Exonic
1180559064 22:16601417-16601439 AGCGGCGGCGCGCGGGGGGCGGG + Intergenic
1182278624 22:29205817-29205839 AGCGGCGGCGCAGGGGGCGGGGG + Intergenic
1182604104 22:31489912-31489934 CGCGGCGGGGAAGGCGGCGCCGG - Intronic
1184412230 22:44331876-44331898 GGCGGCGGCGGGCGCGGCGCGGG - Intergenic
1184891016 22:47379225-47379247 GGCGGAGGCGAAGGAGGCGGCGG + Intergenic
1184891042 22:47379306-47379328 GGCGGCGGCGGAGGAGGCGGCGG + Intergenic
1184891047 22:47379321-47379343 GGCGGCGGCGGAGGAGGCGGCGG + Intergenic
1184891052 22:47379336-47379358 GGCGGCGGCGGAGGAGGCGGCGG + Intergenic
949514701 3:4796466-4796488 GGCGGCGGCGGAGGAGGCCCAGG + Intronic
954540654 3:51391337-51391359 AGCGGCGGCGGCGGAGGCGGCGG - Exonic
956659491 3:71583814-71583836 GGCGGCGGCGGCAGAGGCGCGGG + Intronic
962222255 3:133573827-133573849 AGCGGCGGCGCGCGAGCCCCCGG + Exonic
964570775 3:158105798-158105820 GGCGGCGGCGGAGGAGGCGGAGG - Exonic
964570782 3:158105819-158105841 GGCGGCGGCGGAGGAGGCGGAGG - Exonic
968965154 4:3765955-3765977 AGCTCCGGCGAGCGAGGCGGCGG + Intergenic
970456140 4:16226269-16226291 ACCGGCGGCGGGAGAGGCGCCGG - Exonic
972960650 4:44448425-44448447 GGCGGCGGCGGCCGACGCGCCGG + Exonic
975342534 4:73258364-73258386 AGCGGCGGCGGTGGAGGCGGCGG - Exonic
975415399 4:74099094-74099116 GGCGGCGGAGAGCGTGGCGCGGG + Exonic
980075150 4:128287235-128287257 AGGTGCGGCGGCCGAGGCGCGGG + Intronic
981136205 4:141213701-141213723 AGCAGCTGCGGAGGAGGCGCTGG + Intergenic
982198174 4:152936433-152936455 GGCGGGGGCGACCGCGGCGCGGG + Intronic
988825322 5:34929732-34929754 AGCGGCGGCGGCGGCGGCGCTGG - Exonic
990955036 5:61332354-61332376 AGCGGCGGCGGCGGCGGCGCGGG + Exonic
992104361 5:73437440-73437462 AGCTGCTGCGAACCAGCCGCGGG - Intergenic
995224606 5:109689415-109689437 AGCGGCGGCGCAGCAGCCGCTGG - Exonic
997560974 5:134846048-134846070 GGCGGCGGCGAGGCAGGCGCTGG - Exonic
998425550 5:142025139-142025161 AGCGGAGGGGACCGAGGGGCCGG + Intergenic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1001506361 5:172283674-172283696 GGAGGTGGCGGACGAGGCGCCGG - Exonic
1005040350 6:21595232-21595254 TTCGGCGGCGAAGGAGGCGGCGG - Exonic
1005327887 6:24720271-24720293 GGCGGCGGCGGAAGAGGCGGCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006618004 6:35342775-35342797 GGCGGCGGGGAACGGGGTGCGGG + Intronic
1016596992 6:145814497-145814519 CGCGGCCGGGACCGAGGCGCTGG - Intronic
1017103154 6:150865919-150865941 AGCGGCGGCGGCGGAGGCGGCGG + Exonic
1017146687 6:151240910-151240932 AGCAGCGGCGAGCGCGGCGGGGG + Intronic
1019427197 7:983308-983330 AGCGGCAGCGGGCGAGGCCCCGG - Exonic
1019531307 7:1504707-1504729 AGCGGGGGCGGCCGGGGCGCAGG + Intergenic
1019711492 7:2520041-2520063 GGCGGCGGCGCCCGGGGCGCTGG + Exonic
1022698025 7:32728743-32728765 CGCGGCGCCGCCCGAGGCGCTGG - Intergenic
1023955713 7:44885311-44885333 AGCGGCAGCGAGCGCGGCGGCGG - Exonic
1024043864 7:45574568-45574590 GGCGGCGGCGGAGGCGGCGCGGG + Exonic
1025697972 7:63789872-63789894 AGCGGCGGCGGCTGAGGCGGAGG + Intergenic
1026765105 7:73155202-73155224 AGCCGCCGCGGACGGGGCGCGGG + Intergenic
1027041578 7:74964957-74964979 AGCCGCCGCGGACGGGGCGCGGG + Exonic
1027082064 7:75237412-75237434 AGCCGCCGCGGACGGGGCGCGGG - Intergenic
1027421188 7:78019596-78019618 AGACGCGGCGGACGCGGCGCGGG - Exonic
1028477004 7:91264500-91264522 GGCGGCGGAGAAGGAGGCGGAGG + Exonic
1029390645 7:100271958-100271980 AGCTGCCGCGGACGGGGCGCGGG - Exonic
1034618254 7:152436590-152436612 AGCGGCGGCGCGCGGGGGGCGGG - Intergenic
1039060367 8:33567356-33567378 AGCGGCGACGAGCGATGCCCCGG + Intergenic
1039984667 8:42437167-42437189 AGAGGCGGAGATCGAGGCGGAGG - Exonic
1041068181 8:54102000-54102022 AGGGGCGGCGGGCGAGGGGCAGG - Exonic
1042271554 8:66961594-66961616 GGCGGCGGCGAATGCGGCGCGGG - Exonic
1042962865 8:74321492-74321514 GGCGGCGGCGAAGGAGGAGGAGG - Intronic
1044821887 8:96160728-96160750 GGCGGCGGCGCAGGACGCGCGGG + Exonic
1047292193 8:123540812-123540834 AGGGACGGCGAATGAGGGGCAGG - Intronic
1053550986 9:39078955-39078977 AGCGGCGGAGATGGGGGCGCAGG + Intronic
1053815095 9:41899034-41899056 AGCGGCGGAGATGGGGGCGCAGG + Intronic
1054615501 9:67288407-67288429 AGCGGCGGAGATGGGGGCGCAGG - Intergenic
1055945527 9:81688711-81688733 GGCGGCGGCGGGCGAGGTGCAGG + Exonic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1062537752 9:137028314-137028336 AGCGGGGGCGGGCGGGGCGCGGG - Intronic
1191675122 X:63785239-63785261 AGGGGCGGCGGAGGGGGCGCTGG - Intronic
1191830206 X:65407585-65407607 GGCGGCGGCGGGCGAGGCGCAGG - Intronic
1195716843 X:107826308-107826330 GGCGGCGGCGACCGGGGCCCGGG + Exonic
1198767089 X:140091328-140091350 GGCGGCGGCGACCGAGGCGGCGG + Intergenic