ID: 1151816416

View in Genome Browser
Species Human (GRCh38)
Location 17:76473585-76473607
Sequence CCCCGAGCTGCGGCTTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151816416_1151816427 3 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816427 17:76473611-76473633 CAGTGGGATGGCTGAGGCCAGGG 0: 1
1: 0
2: 2
3: 45
4: 477
1151816416_1151816432 27 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816432 17:76473635-76473657 CCAGGTCGCTCACCTGCCCTTGG 0: 1
1: 1
2: 0
3: 23
4: 201
1151816416_1151816424 -9 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816424 17:76473599-76473621 AGCTCGGGGGGGCAGTGGGATGG 0: 1
1: 0
2: 2
3: 33
4: 406
1151816416_1151816428 9 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816428 17:76473617-76473639 GATGGCTGAGGCCAGGGCCCAGG 0: 1
1: 0
2: 7
3: 82
4: 693
1151816416_1151816425 -3 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816425 17:76473605-76473627 GGGGGGCAGTGGGATGGCTGAGG 0: 1
1: 0
2: 7
3: 83
4: 861
1151816416_1151816426 2 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816426 17:76473610-76473632 GCAGTGGGATGGCTGAGGCCAGG 0: 1
1: 0
2: 6
3: 72
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151816416 Original CRISPR CCCCGAGCTGCGGCTTCCTG TGG (reversed) Intronic