ID: 1151816416

View in Genome Browser
Species Human (GRCh38)
Location 17:76473585-76473607
Sequence CCCCGAGCTGCGGCTTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151816416_1151816428 9 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816428 17:76473617-76473639 GATGGCTGAGGCCAGGGCCCAGG 0: 1
1: 0
2: 7
3: 82
4: 693
1151816416_1151816427 3 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816427 17:76473611-76473633 CAGTGGGATGGCTGAGGCCAGGG 0: 1
1: 0
2: 2
3: 45
4: 477
1151816416_1151816426 2 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816426 17:76473610-76473632 GCAGTGGGATGGCTGAGGCCAGG 0: 1
1: 0
2: 6
3: 72
4: 664
1151816416_1151816432 27 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816432 17:76473635-76473657 CCAGGTCGCTCACCTGCCCTTGG 0: 1
1: 1
2: 0
3: 23
4: 201
1151816416_1151816424 -9 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816424 17:76473599-76473621 AGCTCGGGGGGGCAGTGGGATGG 0: 1
1: 0
2: 2
3: 33
4: 406
1151816416_1151816425 -3 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816425 17:76473605-76473627 GGGGGGCAGTGGGATGGCTGAGG 0: 1
1: 0
2: 7
3: 83
4: 861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151816416 Original CRISPR CCCCGAGCTGCGGCTTCCTG TGG (reversed) Intronic
900097997 1:948139-948161 CCCGGAGCTGGTGCTGCCTGTGG - Exonic
900391807 1:2436916-2436938 CACCCAGCTGAGGCCTCCTGGGG + Intronic
900830920 1:4964837-4964859 CCCAGAGCTGGTGCTTCCTCAGG + Intergenic
901852208 1:12022762-12022784 CCTCGAATTGCGGCTTCCTCTGG + Intronic
902656113 1:17869477-17869499 CCCCCACCTGCGGCTCCCTGTGG - Intergenic
903183109 1:21614978-21615000 CCCTGAGCTGCGGATTCGTGGGG - Intronic
903448495 1:23437263-23437285 CCCTGAGCAGCGCCTTCCTCGGG - Exonic
903950757 1:26994564-26994586 CCCCCAACTGCCTCTTCCTGCGG - Exonic
905584486 1:39105843-39105865 CCCTGAGCTGCTGCTTCTCGGGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906128044 1:43439570-43439592 CCCAGAGCTGAGCCTTCCTATGG + Intronic
906528264 1:46508929-46508951 CCCTGAGCTGAGTCATCCTGGGG - Intronic
912354263 1:109042172-109042194 CCCCGCGCGGCGGGGTCCTGAGG - Intergenic
915355995 1:155255433-155255455 CCCCGAGCTCCGGCTGCCGCAGG + Intronic
918249074 1:182685530-182685552 TCCCCAGCTGCAGCTTCCTTTGG - Intergenic
919650984 1:200148412-200148434 CTCCCAGCTGCTGCTTCCAGTGG - Intronic
920352083 1:205343982-205344004 CCCCGGCCTGCGGCTTGCTTCGG - Intronic
924772149 1:247087941-247087963 CCCTGAGCTGTGGGTTCCTGTGG - Intergenic
1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG + Intergenic
1070934471 10:80282582-80282604 CCCAGAGCTGCAGCTTCCTGAGG - Intronic
1074533985 10:114315623-114315645 CCCGCATCTGCGCCTTCCTGTGG - Exonic
1077186011 11:1235693-1235715 CCCTGGGCTGTGGCTGCCTGTGG + Intronic
1077505469 11:2928117-2928139 GTCCGAGCTGCTGCTGCCTGTGG - Intergenic
1077532081 11:3102063-3102085 CCCCGAGGGCCGGCTTCCAGGGG - Intronic
1078345189 11:10541392-10541414 CCCGGAGCAGGGGCTTCATGAGG + Intergenic
1082215002 11:49558668-49558690 CCTCGAGGAGCGGCTGCCTGGGG + Intergenic
1082890974 11:58138251-58138273 TCCCCAGCTGGGGCTGCCTGAGG + Intronic
1083227616 11:61294819-61294841 CCCCGACACGCGGCTGCCTGCGG + Intronic
1083860070 11:65415625-65415647 CCCACAGCTGAGGCTTCATGTGG + Intergenic
1083891561 11:65598252-65598274 CCCCGAGCTCCAGCTGCCTTAGG - Exonic
1084024385 11:66438703-66438725 CGCCGACCTCGGGCTTCCTGAGG + Exonic
1084518056 11:69647014-69647036 CCCTCACCTGGGGCTTCCTGGGG - Intronic
1086634579 11:89065801-89065823 CCTCGAGGAGCGGCTGCCTGGGG - Intronic
1087818005 11:102679969-102679991 CACAGAGCTGCAGCTTCCTCAGG - Intergenic
1089158116 11:116417381-116417403 CCCTCAGCTGTTGCTTCCTGTGG + Intergenic
1089784547 11:120898659-120898681 CTCCCAGCTGCAGCATCCTGGGG + Intronic
1091304937 11:134530828-134530850 ACCCGAGCTGCTGCTTCTAGGGG + Intergenic
1096524299 12:52201341-52201363 TCTCCAGCTGGGGCTTCCTGAGG - Intergenic
1096782638 12:53999930-53999952 CCGCGACCTGCGATTTCCTGGGG - Intronic
1100855062 12:98750831-98750853 CCCGCAGCTGAGGCTTCCTGCGG - Intronic
1101254892 12:102966851-102966873 CCCCCAGCTTCTGCTTTCTGAGG + Intergenic
1104381687 12:128313062-128313084 GCCCAAGCTGCTGCTTCCTCTGG + Intronic
1104799400 12:131543647-131543669 GCTCGAGCTGGAGCTTCCTGGGG - Intergenic
1105606526 13:21930702-21930724 CCAGCAGCTGGGGCTTCCTGAGG - Intergenic
1106176338 13:27335643-27335665 GCCTGAGCTGGGGGTTCCTGAGG + Intergenic
1106411440 13:29514165-29514187 CCCCGAGCTGCCGCAGCCTCAGG - Exonic
1109062058 13:57632389-57632411 ACCCGAGCTGCGGCACCCGGTGG - Exonic
1109090117 13:58031659-58031681 CTCCGAGTTGCTGCTTTCTGAGG + Intergenic
1111895788 13:94139834-94139856 CCACCAGCTGTAGCTTCCTGGGG + Intronic
1113563609 13:111303730-111303752 CCCAGACCTGCGGGTTTCTGAGG + Intronic
1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG + Intronic
1113961516 13:114128790-114128812 CTCCCCGCTGGGGCTTCCTGTGG - Intronic
1114454835 14:22847664-22847686 CCCCGCCCTGCAGGTTCCTGGGG - Exonic
1114652188 14:24292282-24292304 CCACGAGCTGCGGCGCCATGGGG - Exonic
1119829404 14:77687779-77687801 TCCTGTGCTGAGGCTTCCTGGGG + Intronic
1121105881 14:91279423-91279445 CCCAGAGCTCCTCCTTCCTGAGG - Intronic
1121897556 14:97662644-97662666 CCCCGAGCTGCTCCTTTCTGAGG + Intergenic
1122232583 14:100314084-100314106 GGCAGAGCTGCGTCTTCCTGGGG + Intergenic
1122355809 14:101122269-101122291 CCCCGATGTGTGGCCTCCTGGGG + Intergenic
1122975874 14:105170504-105170526 CCCCGGGCTGGGGGCTCCTGAGG - Intergenic
1125506974 15:40272682-40272704 CCCTGCGCTGCTGCTTCCTGAGG - Exonic
1127387158 15:58475774-58475796 CCCTGAGCTGCTGCTTCCATGGG - Intronic
1128081874 15:64861676-64861698 CCTGGAGCTGGGGCTTCCTGAGG + Intronic
1128107378 15:65054868-65054890 CACCGAGCCTAGGCTTCCTGGGG + Exonic
1128517055 15:68348972-68348994 CCCACAGCTCCTGCTTCCTGGGG + Intronic
1129536237 15:76315578-76315600 CTCCAAGCTGCTGCTTCCAGTGG + Intergenic
1130259456 15:82344153-82344175 CCCCAGGCTGCAGCTGCCTGTGG + Intronic
1130269222 15:82435015-82435037 CCCCAGGCTGCAGCTGCCTGTGG - Intronic
1130281810 15:82525032-82525054 CCCCAGGCTGCAGCTGCCTGTGG - Intergenic
1130283948 15:82540363-82540385 CCCCCATCTGCAGCTTCCCGCGG - Intronic
1130473177 15:84241195-84241217 CCCCAGGCTGCAGCTGCCTGTGG - Intronic
1130480592 15:84355260-84355282 CCCCAGGCTGCAGCTGCCTGTGG - Intergenic
1130491120 15:84432499-84432521 CCCCAGGCTGCAGCTGCCTGTGG + Intergenic
1130502704 15:84511299-84511321 CCCCAGGCTGCAGCTGCCTGTGG + Intergenic
1130595462 15:85245785-85245807 CCCCAGGCTGCAGCTGCCTGTGG - Intergenic
1131225322 15:90620117-90620139 CCCCGAGCTGTGGCAGGCTGTGG + Intronic
1132405299 15:101538383-101538405 CCCCAACCTGGGGTTTCCTGGGG - Intergenic
1132733460 16:1374471-1374493 CCCCGGGGTGCGGTTGCCTGGGG - Intronic
1132761497 16:1510606-1510628 CCTCCAGCTGCAGCTTCCTGAGG + Exonic
1132828822 16:1917867-1917889 CCCTGACCGGCGCCTTCCTGGGG - Intronic
1132986147 16:2768672-2768694 CCCCAAGCTGCGGCTCTCCGAGG + Intronic
1134231923 16:12436267-12436289 CCTTAAGCTGCGGCCTCCTGTGG - Intronic
1135429816 16:22374048-22374070 CCCCGTGCCGAGGCTTCCTGCGG + Intronic
1138432169 16:56975918-56975940 CCCACACCTGCGCCTTCCTGCGG + Intronic
1138661934 16:58525559-58525581 CCTTGAGCTTCGGCTTCCTGAGG - Intronic
1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG + Intronic
1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG + Intronic
1142260585 16:89040874-89040896 CTCCGAGCTGTGGGTTCCTGAGG - Intergenic
1142642555 17:1292878-1292900 CTCCGCGCTGCTGCGTCCTGGGG + Intronic
1144874712 17:18391330-18391352 CCCCCATCTGCTGCTTCCTAGGG - Intergenic
1145157513 17:20553091-20553113 CCCCCATCTGCTGCTTCCTAGGG + Intergenic
1145759061 17:27415589-27415611 CCCCGAATTGCTGCTTCTTGGGG - Intergenic
1145799926 17:27676446-27676468 CCCCCATCTGCTGCTTCCTGGGG + Intergenic
1145960218 17:28882793-28882815 CTCTGAGCTGGGTCTTCCTGGGG + Intronic
1147538213 17:41334696-41334718 CCCCCATCTGCTGCTTCCTAGGG + Intergenic
1149010007 17:51846392-51846414 CCCTGAGCTGGGGCTGCCTATGG + Intronic
1150138439 17:62708909-62708931 TCCCTGGCTGGGGCTTCCTGGGG - Intronic
1151210003 17:72537409-72537431 CCCCCAGCCCCGCCTTCCTGGGG + Intergenic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1152683649 17:81683311-81683333 CCCCTCGCAACGGCTTCCTGTGG - Intronic
1153887407 18:9478875-9478897 CCCAGAGCTGGGGTGTCCTGGGG + Intronic
1155089678 18:22494297-22494319 CCAAGAGCTGTGGCTTCCTGGGG + Intergenic
1157335233 18:46732990-46733012 TCCCGAGCTGCCCCTTTCTGAGG - Intronic
1159577167 18:70193359-70193381 CCGAGGGCTGCTGCTTCCTGGGG + Exonic
1160557655 18:79736453-79736475 CCCCGAGCGTCCGCTCCCTGCGG - Exonic
1160659730 19:292280-292302 CCCTGAGCTGAGGGTGCCTGGGG + Intergenic
1160934111 19:1585174-1585196 GCGCCAGCTGCGGCTTGCTGCGG + Exonic
1161777842 19:6273430-6273452 CCCGGCGCTGCGGATTCATGAGG + Intronic
1161797008 19:6393070-6393092 CACCGAGCGGCGGCTTCCCCGGG - Exonic
1161873242 19:6886805-6886827 CCCCCAGCTGGTGCTTTCTGGGG + Intergenic
1161977728 19:7615605-7615627 CCCCGGGCTGCGGGGTCCGGGGG + Exonic
1163062335 19:14769518-14769540 CCCTGAGCTGAGGCTTCAAGAGG + Intronic
1164903366 19:31947000-31947022 AACAGAGCTGCTGCTTCCTGAGG + Intergenic
1166072779 19:40396638-40396660 GCCAGAGGTGCGGCTTCCAGAGG - Exonic
1166072790 19:40396716-40396738 GCCGGAGGTGCGGCTTCCAGAGG - Exonic
1166072802 19:40396794-40396816 GCCGGAGGTGCGGCTTCCAGAGG - Exonic
1166072815 19:40396872-40396894 GCCGGAGGTGCGGCTTCCAGAGG - Exonic
1166869728 19:45864148-45864170 CCCCCAGCTGTCGCGTCCTGGGG + Intronic
1167113722 19:47476666-47476688 CCCAGAGTCGGGGCTTCCTGAGG - Exonic
1167116100 19:47489854-47489876 CCTGGGGCTGGGGCTTCCTGAGG + Intronic
1167565801 19:50255942-50255964 GCCCTAGCTGTGGGTTCCTGAGG + Intronic
1168649468 19:58084585-58084607 CCCTGGGTGGCGGCTTCCTGTGG - Exonic
925150825 2:1613641-1613663 GCCAGAGCTGCGGCTCCTTGAGG + Intergenic
927289961 2:21395539-21395561 CCCAGAGCTGCCTCTTCCTGGGG - Intergenic
927591355 2:24360535-24360557 CCCCGCCCCCCGGCTTCCTGCGG - Exonic
928172622 2:29013050-29013072 CCACCAGCTGAGGCTGCCTGAGG - Intronic
929564444 2:42975658-42975680 CCCCGAGCTGGGGCTTGGGGAGG + Intergenic
931111272 2:59113976-59113998 CCCCTTACTGCTGCTTCCTGTGG + Intergenic
931348745 2:61470561-61470583 CCCCGGGCTGCCGCGGCCTGCGG - Intronic
934521715 2:95024199-95024221 CTTCAGGCTGCGGCTTCCTGTGG + Intergenic
935622823 2:105144083-105144105 CCCCGAGCCGCAGCTGCCGGGGG - Intergenic
938035043 2:128028198-128028220 CTCTGAGCCGCGGCGTCCTGTGG + Intergenic
938303298 2:130230997-130231019 CCCGGAGCTGGCGCTGCCTGTGG + Intergenic
938453374 2:131443240-131443262 CCCGGAGCTGGCGCTGCCTGTGG - Intergenic
946909086 2:224442676-224442698 CGCCGAGCCGAGGCTGCCTGGGG + Intergenic
947550382 2:231041419-231041441 CCCCGACCTCCTGCATCCTGAGG + Intronic
948467459 2:238159127-238159149 TCCCGGGCGGCGGCTCCCTGCGG - Exonic
1169373024 20:5043196-5043218 ACCCCAGCTGAGGATTCCTGGGG - Intergenic
1170895885 20:20414020-20414042 CCCGGACCAGCGGCTTGCTGGGG - Intronic
1171045898 20:21809280-21809302 GCGGGAGCTGGGGCTTCCTGGGG + Intergenic
1174081493 20:47973460-47973482 CCCTGGGCCGGGGCTTCCTGTGG + Intergenic
1174114210 20:48215757-48215779 CCCCCAGCTGCTCCTTCCCGAGG + Intergenic
1174135005 20:48373426-48373448 CCCTGGGCCGGGGCTTCCTGTGG - Intergenic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1175399627 20:58693017-58693039 CCCGGGGCTGCAGCTTCCCGCGG - Exonic
1175403032 20:58711323-58711345 CCCTGTGCTGAGGCCTCCTGTGG - Intronic
1175992266 20:62795535-62795557 CACGGAGCTGCTGCTTCCTAGGG + Intergenic
1176422344 21:6526363-6526385 CCCTGAGCTGAGGCTGCCAGGGG + Intergenic
1179697835 21:43134679-43134701 CCCTGAGCTGAGGCTGCCAGGGG + Intergenic
1179719336 21:43306476-43306498 CCCCGGGCTGTGCCTGCCTGGGG - Intergenic
1180155209 21:45974274-45974296 CCCCGCGCCGCGGGCTCCTGTGG + Intergenic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
1184531956 22:45061881-45061903 CCCGGAGCTGGGGAATCCTGTGG + Intergenic
949435145 3:4020996-4021018 TCCCTAACTGCTGCTTCCTGGGG - Intronic
953897353 3:46812457-46812479 CCCAGAGCGGCAGCTCCCTGGGG - Exonic
961988036 3:131158253-131158275 CCCCTAACTGCAGCTTCCTCAGG + Intronic
965523329 3:169690530-169690552 CCCTGAGCTGGTGCTTCTTGTGG - Intergenic
966313154 3:178616519-178616541 CACCAAGCTGCTGCTGCCTGGGG + Intronic
968086451 3:195876058-195876080 CCTGGAGCCTCGGCTTCCTGTGG - Intronic
968093101 3:195909903-195909925 GCCCGGCCTGCGCCTTCCTGCGG + Intronic
968481086 4:833408-833430 CCCCTTGCTGCGGCCTCATGTGG + Intergenic
968972531 4:3803474-3803496 CCCCATGTTGGGGCTTCCTGTGG + Intergenic
969415114 4:7052942-7052964 CCCACAGCTGGGGCTTCCTCTGG - Intronic
972458704 4:39279322-39279344 GCTGGAGCTGCCGCTTCCTGAGG - Intronic
975367443 4:73545210-73545232 CCCCGAGATGAAGCTTCCAGAGG + Intergenic
981005584 4:139871686-139871708 CCCTGAGCTGTGTCTTCCTCAGG + Intronic
981387284 4:144146464-144146486 CCCAGGGATGTGGCTTCCTGAGG - Intergenic
985119679 4:186627558-186627580 CCCAGAGCTGGGGCCTGCTGGGG - Intronic
985992583 5:3575572-3575594 CCCTGAGCTGAGGCGTCCTCTGG + Intergenic
986569680 5:9152196-9152218 CACAGGCCTGCGGCTTCCTGTGG + Intronic
986759467 5:10867117-10867139 CCCCTGGCTGCGGTTTACTGAGG - Intergenic
990185701 5:53206793-53206815 CCCCCAGCTGCATCTTCCAGCGG + Intergenic
996693903 5:126371537-126371559 CACCGAGCTGGGGCTGTCTGTGG - Intronic
996818018 5:127595075-127595097 CTACGAGCTGTGGCTTCCTTGGG + Intergenic
998426986 5:142037074-142037096 CGCCGACCTCGGGCTTCCTGAGG + Intergenic
1000393519 5:160749378-160749400 CCCCCAGCTCCTTCTTCCTGTGG - Intronic
1001699880 5:173699140-173699162 CCCCTGGCTGTGGCTGCCTGTGG + Intergenic
1003121230 6:3320368-3320390 CCCCAAGGGGCGGCTTCTTGGGG - Intronic
1005734431 6:28732364-28732386 CCGAGAGCCACGGCTTCCTGTGG + Intergenic
1005923186 6:30418434-30418456 CCCAGGGCTGCTGCTTGCTGAGG - Intergenic
1006231419 6:32590341-32590363 CCCGGAGCTGCTGCTCCTTGAGG - Intergenic
1006460591 6:34155353-34155375 CCTGGAGTTGCAGCTTCCTGCGG - Intronic
1006936710 6:37723676-37723698 TACCGACCTGGGGCTTCCTGAGG - Intergenic
1007330264 6:41101306-41101328 CTTCGTGCTGCGGCTTCCTTAGG + Intergenic
1008483637 6:52011992-52012014 CTCAGAGCTGCAGCTTTCTGAGG + Intronic
1008630559 6:53359614-53359636 CCCCGCGCTGACCCTTCCTGGGG + Intergenic
1013076128 6:106773370-106773392 CCCTGAGTTTCGCCTTCCTGAGG + Intergenic
1013289514 6:108708354-108708376 CCCCTAGCTGAGGCTTTGTGTGG - Intergenic
1013602644 6:111719576-111719598 CCCCAAGTTGCTGCTTTCTGAGG - Intronic
1013737898 6:113248806-113248828 CCCCAAACTGCTGCTTCCTCTGG + Intergenic
1018868802 6:167765869-167765891 CCCTGAGCAGAAGCTTCCTGAGG - Intergenic
1018941386 6:168310548-168310570 CCCTGAGCTGAGGCTACCGGAGG + Intronic
1020013842 7:4820076-4820098 CCCTGAGCTGACTCTTCCTGTGG + Intronic
1022050910 7:26670459-26670481 CCCCGAGAGAAGGCTTCCTGAGG - Intronic
1022628128 7:32059407-32059429 GCCCCAGGTGGGGCTTCCTGTGG - Intronic
1022698037 7:32728779-32728801 CCCCGCGCAGCTGTTTCCTGGGG + Intergenic
1023083862 7:36550580-36550602 TCCTGAGCTCTGGCTTCCTGTGG + Intronic
1023859561 7:44209740-44209762 AAGCGAGCTGCTGCTTCCTGAGG + Intronic
1023984932 7:45088852-45088874 CGCCGAGCTGCTGCTGCCCGAGG - Exonic
1024249126 7:47492970-47492992 CCCCCAGCTCCTGCTTCTTGGGG + Intronic
1026889413 7:73973378-73973400 TCCCGGGCACCGGCTTCCTGCGG + Intergenic
1029538388 7:101169027-101169049 CCCAGAGCTGGGGAATCCTGGGG + Intergenic
1032202452 7:129831768-129831790 CCCGGTGCTGGGGCTTCCAGAGG + Exonic
1034886747 7:154804140-154804162 TCCAGAGCTGCGGCGTCCTGAGG + Intronic
1035287999 7:157818588-157818610 CCCCCAGCTGGTGCCTCCTGTGG + Intronic
1035333694 7:158112587-158112609 CTCCCAGCTGGGCCTTCCTGGGG - Intronic
1036115186 8:5951677-5951699 CCCTGAACTGAAGCTTCCTGAGG - Intergenic
1036800468 8:11787146-11787168 CAGGGAGCTGCGCCTTCCTGGGG + Exonic
1037535296 8:19817737-19817759 CCCAGAGCTGCGCCTGCCTGGGG + Intronic
1037589755 8:20303126-20303148 CCTGGGGCTGCAGCTTCCTGGGG - Intronic
1037887683 8:22603496-22603518 CCTGGAGCTGCGGCATCTTGGGG - Exonic
1039794999 8:40905423-40905445 CCCAGAACTGCAGCTTCCAGTGG + Intergenic
1042307067 8:67343494-67343516 CCTCGAGGTACGGCTTCTTGGGG - Exonic
1043439644 8:80265889-80265911 CCCCCAGCTGCATCTTCCGGTGG - Intergenic
1048886435 8:138913672-138913694 CTCCCAGCTGCTGCTTCCAGTGG - Exonic
1048935774 8:139355461-139355483 CACTGAGCTGCAGCTCCCTGTGG - Intergenic
1049775146 8:144400612-144400634 CCCCTAGCTGCCTCTGCCTGGGG - Intronic
1053477480 9:38392836-38392858 CCAGGAGCTGCGGCTTCCCGAGG - Intronic
1055102987 9:72484311-72484333 GCCAGAGCTTCTGCTTCCTGTGG - Intergenic
1057207750 9:93183868-93183890 CGCCGGGCTGCGGCGTGCTGAGG + Intergenic
1057306300 9:93914087-93914109 CCCCGAGGTGGGGCTCACTGTGG - Intergenic
1057851647 9:98571043-98571065 CCCCGGCCTGCAGCTGCCTGAGG - Intronic
1061893871 9:133636859-133636881 CCCCGAGCTTGGGCATCATGGGG + Intronic
1061937918 9:133868407-133868429 CACCGTGCTGAGGCTCCCTGAGG + Intronic
1061986933 9:134135505-134135527 GCCCGGGCTGCGCCTTCCCGCGG - Intronic
1062213605 9:135377568-135377590 CCCTGAGATGAGGCGTCCTGTGG + Intergenic
1062304145 9:135893059-135893081 CCTCCAGCTGCAGCTTCTTGAGG - Intronic
1186402148 X:9269841-9269863 CCCCGAGCTTCTGCTTCATGGGG + Intergenic
1200162409 X:154016312-154016334 CCTGGAGCTGCAGCCTCCTGGGG + Intronic
1200182665 X:154160222-154160244 CCTCGAGCTGCCCCCTCCTGAGG - Intergenic
1200188319 X:154197336-154197358 CCTCGAGCTGCCCCCTCCTGAGG - Intergenic
1200193969 X:154234476-154234498 CCTCGAGCTGCCCCCTCCTGAGG - Intergenic
1200199724 X:154272280-154272302 CCTCGAGCTGCCCCCTCCTGAGG - Intronic