ID: 1151816424

View in Genome Browser
Species Human (GRCh38)
Location 17:76473599-76473621
Sequence AGCTCGGGGGGGCAGTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151816416_1151816424 -9 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816424 17:76473599-76473621 AGCTCGGGGGGGCAGTGGGATGG 0: 1
1: 0
2: 2
3: 33
4: 406
1151816406_1151816424 30 Left 1151816406 17:76473546-76473568 CCAGCGGCTGTGGGTGGTGACGG 0: 1
1: 0
2: 1
3: 14
4: 252
Right 1151816424 17:76473599-76473621 AGCTCGGGGGGGCAGTGGGATGG 0: 1
1: 0
2: 2
3: 33
4: 406
1151816414_1151816424 -8 Left 1151816414 17:76473584-76473606 CCCACAGGAAGCCGCAGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1151816424 17:76473599-76473621 AGCTCGGGGGGGCAGTGGGATGG 0: 1
1: 0
2: 2
3: 33
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151816424 Original CRISPR AGCTCGGGGGGGCAGTGGGA TGG Intronic