ID: 1151816425

View in Genome Browser
Species Human (GRCh38)
Location 17:76473605-76473627
Sequence GGGGGGCAGTGGGATGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 952
Summary {0: 1, 1: 0, 2: 7, 3: 83, 4: 861}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151816414_1151816425 -2 Left 1151816414 17:76473584-76473606 CCCACAGGAAGCCGCAGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1151816425 17:76473605-76473627 GGGGGGCAGTGGGATGGCTGAGG 0: 1
1: 0
2: 7
3: 83
4: 861
1151816416_1151816425 -3 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816425 17:76473605-76473627 GGGGGGCAGTGGGATGGCTGAGG 0: 1
1: 0
2: 7
3: 83
4: 861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151816425 Original CRISPR GGGGGGCAGTGGGATGGCTG AGG Intronic