ID: 1151816426

View in Genome Browser
Species Human (GRCh38)
Location 17:76473610-76473632
Sequence GCAGTGGGATGGCTGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 664}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151816414_1151816426 3 Left 1151816414 17:76473584-76473606 CCCACAGGAAGCCGCAGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1151816426 17:76473610-76473632 GCAGTGGGATGGCTGAGGCCAGG 0: 1
1: 0
2: 6
3: 72
4: 664
1151816422_1151816426 -8 Left 1151816422 17:76473595-76473617 CCGCAGCTCGGGGGGGCAGTGGG 0: 1
1: 0
2: 1
3: 27
4: 252
Right 1151816426 17:76473610-76473632 GCAGTGGGATGGCTGAGGCCAGG 0: 1
1: 0
2: 6
3: 72
4: 664
1151816416_1151816426 2 Left 1151816416 17:76473585-76473607 CCACAGGAAGCCGCAGCTCGGGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1151816426 17:76473610-76473632 GCAGTGGGATGGCTGAGGCCAGG 0: 1
1: 0
2: 6
3: 72
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151816426 Original CRISPR GCAGTGGGATGGCTGAGGCC AGG Intronic